An Indel marker EH-03-Indel-108 closely linked to ear height in maize and its application.
Patent Information
- Application Number
- CN202510602197.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-12
- Publication Date
- 2026-05-26
- Estimated Expiration
- 2045-05-12
AI Technical Summary
Existing gene editing technologies for breeding high ear position maize face problems such as biosafety risks, long breeding cycles, high costs of molecular marker detection, low throughput, and low efficiency in lodging resistance breeding. Furthermore, there is a lack of tightly linked molecular markers for early screening.
A new Indel marker, EH-03-Indel-108, closely linked to ear height in maize, was developed and located in a specific region of chromosome 3 of maize. The ear height haplotype of maize inbred lines was rapidly identified by PCR amplification and agarose gel electrophoresis analysis.
It enables precise identification of the ear height trait in maize, improves the breeding efficiency of lodging-resistant varieties, simplifies the operation process and reduces costs, and promotes maize genetic improvement and the selectivity of breeding materials.
Smart Images

Figure CN120485412B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of plant molecular breeding technology, and more specifically, to an Indel marker EH-03-Indel-108 that is closely linked to ear height in maize and its application. Background Technology
[0002] Ear height in maize is a crucial agronomic trait affecting lodging resistance, photosynthetic efficiency, and mechanized harvesting. Its genetic regulation involves multiple gene interactions and environmental factors, and has long been a key objective in maize breeding. Current research primarily focuses on major gene cloning and gene editing technologies, but the following limitations remain:
[0003] I. Limitations of Existing Gene Editing Technologies
[0004] Existing technologies, such as Chinese patent CN110862994B, disclose a method for reducing maize plant height and ear height by mutating the ZKM76 gene using CRISPR / Cas9 technology. However, this method relies on complex processes such as gene editing vector construction, genetic transformation, and mutant screening, posing risks to transgenic biosafety and a long breeding cycle. Furthermore, this research only verifies the function of a single gene, while ear height, as a typical quantitative trait, is controlled by multiple genes and minor QTLs. Relying solely on single-gene editing cannot fully cover genetic diversity, limiting the universality of its breeding applications.
[0005] II. Technological Gaps in Molecular Marker-Assisted Breeding
[0006] Current research on molecular markers for ear height in maize is relatively scarce, especially regarding efficient molecular markers closely linked to ear height that can be used for early screening. Although Chinese patent CN110862994B located a QTL region related to plant height and ear height using GWAS, no specific molecular markers have been developed, and existing markers are mostly based on SNPs (single nucleotide polymorphisms), resulting in high detection costs and low throughput. On the other hand, CN119144648A focuses on the maize yield-related gene ZmGG2 and does not involve ear height, reflecting a gap in research on specific molecular markers for ear height.
[0007] III. Practical Needs and Technological Bottlenecks in Lodging-Resistant Breeding
[0008] Ear height is directly related to lodging resistance, and reducing ear height is a key approach to improving maize's lodging resistance. However, traditional breeding relies on phenotypic selection, which is greatly affected by the environment and has low efficiency; existing gene editing technologies, while precise, are limited by transgenic regulations, and molecular marker-assisted breeding (MAS) is limited in application due to a lack of efficient markers. For example, existing indel (insertion / deletion) markers are mostly distributed in non-coding regions or are not strongly linked to the target trait, making it difficult to achieve accurate identification and early selection of ear height. Summary of the Invention
[0009] The purpose of this invention is to provide an Indel marker EH-03-Indel-108 that is closely linked to the ear height of maize and its application, so as to solve the problems mentioned in the background art.
[0010] To achieve the above objectives, the present invention provides an Indel marker EH-03-Indel-108 that is closely linked to ear height in maize. The Indel marker is located in the region Chr3:163961992-163963992 on maize chromosome 3 and is a 4bp insertion / deletion polymorphism marker. In maize inbred lines with low ear height, there is a 4bp nucleotide sequence CCTG insertion at this site, while in maize inbred lines with high ear height do not have an insertion at this site.
[0011] Preferably, the primer pair used to detect the Indel marker polymorphism includes:
[0012] Forward primer: 5'-CACCGAGGTGGGACTAAAAAG-3',
[0013] Reverse primer: 5'-TAGGAGAAGAGCAGGCAGGAG-3';
[0014] The primer pair can specifically amplify DNA fragments containing the Indel site, with the amplification product being 216 bp in length (when the insert sequence is included) or having no corresponding band due to the absence of the insert sequence.
[0015] Preferably, the detection of the Indel marker PH-03-Indel-108 specifically includes the following steps:
[0016] S1: Extraction of genomic DNA from maize inbred lines;
[0017] S2: Using the DNA from step S1 as a template, perform PCR amplification using the primer pair described above;
[0018] S3: PCR products were analyzed by agarose gel electrophoresis: if a 216bp band appeared, indicating CCTG insertion, it was determined to be a low-ear haplotype; if no 216bp band appeared, indicating no CCTG insertion, it was determined to be a high-ear haplotype.
[0019] Preferably, the PCR amplification system is 20 μL and contains:
[0020] 1 μL DNA template, 10 μL 2×PCRMix, 0.5 μL 10 μM forward primer, 0.5 μL 10 μM reverse primer, 8 μL ddH2O;
[0021] The amplification program was as follows: pre-denaturation at 94℃ for 30 seconds, followed by 34 cycles, each cycle consisting of denaturation at 98℃ for 10 seconds, annealing at 62℃ for 15 seconds, extension at 72℃ for 10 seconds, and a final extension at 72℃ for 5 minutes, followed by storage at 4℃.
[0022] On the other hand, the present invention also provides the application of the Indel marker PH-03-Indel-108 in marker-assisted breeding of maize, for screening low ear position varieties and lodging-resistant maize inbred lines.
[0023] As a preferred method, the genomic DNA of the maize inbred line to be tested is detected using the above-mentioned detection method. If a 216bp band is detected, it is determined to carry a low ear haplotype and can be used as a target material for lodging resistance breeding.
[0024] As a preferred option, the breeding of low-ear-position maize varieties includes the following steps:
[0025] (1) Using maize inbred lines carrying the Indel marker low ear haplotype and containing CCTG insertion as donor parents, cross with target parents to obtain F1 generation;
[0026] (2) Self-cross or backcross the F1 generation to construct a segregating population;
[0027] (3) Use the above detection methods to screen individuals carrying low-ear haplotypes in the segregating population;
[0028] (4) Combine phenotypic identification and agronomic trait analysis to breed new maize varieties with low ear position and lodging resistance.
[0029] Preferably, the reagents for detecting the ear height trait of maize include primer pairs for detecting the Indel marker polymorphism, DNA extraction reagents, PCR reaction reagents, and agarose gel electrophoresis reagents.
[0030] Preferably, the DNA extraction reagent includes 1.5×CTAB buffer containing 0.2% mercaptoethanol, chloroform / isoamyl alcohol in a 24:1 ratio, anhydrous ethanol, 75% ethanol, and TE buffer; the PCR reaction reagent includes DNA polymerase, dNTPs, and a Mg2+ buffer system.
[0031] Preferably, the Indel marker PH-03-Indel-108 detects 4bp insertion / deletion polymorphisms in the region Chr3:163961992-163963992 on maize chromosome 3, enabling early molecular identification of maize ear height trait and significantly improving the breeding efficiency of lodging-resistant varieties.
[0032] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0033] 1. Precise Identification of Ear Height Trait in Maize: The Indel marker EH-03-Indel-108 provided by this invention can effectively distinguish ear height haplotypes in maize inbred lines. Through PCR amplification and agarose gel electrophoresis analysis, it is possible to quickly determine whether a maize inbred line carries a low ear height haplotype (containing a 4bp CCTG insertion) or a high ear height haplotype (without an insertion). This precise identification method provides important technical support for maize breeding.
[0034] 2. Improve the efficiency of lodging-resistant variety breeding: Low-ear maize inbred lines have stronger lodging resistance and are more adaptable to mechanized harvesting and high-density planting. This invention, through molecular marker-assisted breeding, can screen maize materials carrying low-ear haplotypes at an early stage, significantly shortening the breeding cycle and improving the efficiency of lodging-resistant variety breeding.
[0035] 3. Simple operation and low cost: The detection method provided by this invention has simple steps, requires conventional reagents and equipment, and is suitable for large-scale application. The identification of ear height trait can be completed through conventional DNA extraction, PCR amplification, and electrophoretic analysis, reducing breeding costs.
[0036] 4. Promoting Maize Genetic Improvement: This invention not only provides important clues for the molecular mechanism research of maize ear height, but also provides a reference for the development of molecular markers for other agronomic traits. By combining conventional breeding and molecular breeding techniques, the genetic improvement process of maize can be further optimized.
[0037] 5. Enhanced selectivity of breeding materials: By using the Indel marker of the present invention, breeders can screen maize inbred lines with ideal ear height at an early stage, avoiding the limitations of traditional breeding that relies on phenotypic selection, and improving the accuracy and efficiency of selection.
[0038] In summary, this invention can effectively classify maize ear height and detect differences in Indel polymorphism. The Indel markers for maize ear height provided by this invention can be used for marker-assisted breeding of maize ear height, which has important theoretical and practical guiding significance for accelerating the genetic selection and improvement of maize varieties. The purpose of this invention is to locate the functional loci of maize ear height-related genes and develop Indel-specific markers for identifying maize ear height based on the locus sequence information. Through these molecular markers, maize ear height can be predicted, providing molecular-assisted technology support for the early identification and screening breeding of maize ear height. Attached Figure Description
[0039] The accompanying drawings are provided to further illustrate the invention and form part of the specification. They are explained in detail together with the embodiments of the invention, but do not constitute a limitation thereof.
[0040] Figure 1 This is a normal distribution diagram of the ear height trait;
[0041] Figure 2 A distribution map of chromosomes marked with SNPs;
[0042] Figure 3 QQ plot and Manhattan plot for genome-wide association analysis of maize ear height;
[0043] Figure 4 Analysis of allelic variation effects at important SNP sites related to ear height;
[0044] Figure 5 Partial results of Sanger sequencing alignment of 249 maize candidate genes;
[0045] Figure 6 Electrophoresis diagram of PCR products from internal reference primers of 200 maize inbred lines;
[0046] Figure 7 Electrophoresis gel images of ear-high primer PCR products from 200 maize inbred lines;
[0047] Figure 8 Statistical table of electrophoresis results for IVR primers of maize endogenous genes and PCR products of Indel molecular markers at ear position;
[0048] Figure 9 Statistical table of results for electrophoresis verification of polymer markers at the spikelet position. Detailed Implementation
[0049] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments and accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0050] The Indel marker EH-03-Indel-108, which is closely linked to ear height in maize, is located in the region Chr3:163961992-163963992 on maize chromosome 3. It is a 4bp insertion / deletion polymorphism marker. In maize inbred lines with low ear position, there is a 4bp nucleotide sequence CCTG insertion at this site, while in maize inbred lines with high ear position do not have an insertion at this site.
[0051] This invention provides 1149 phenotypically diverse and representative DH lines selected from 5572 maize DH lines. These lines were planted in an experimental field in Guangxing Village, Yangshu Street, Acheng District, Harbin City, Heilongjiang Province (126°53′8.73″E, 45°29′39.88″N) in 2023 and 2024, respectively. Each line was planted in two rows, 2.5 m long. The 21 main agronomic and yield traits were investigated according to standards, and data on ear height and other traits were recorded and compiled. After simplified genome resequencing of each line, the genome was assembled against a reference genome to obtain SNP polymorphic markers. Major SNPs associated with ear height were obtained through association analysis based on the ear height trait data, and haplotype analysis was performed on these major SNPs. Based on field phenotypes, 150 maize inbred lines of each type were selected: high ear position (greater than 86.6 cm) and low ear position (less than 67.9 cm). Major SNP polymorphisms were verified by Sanger sequencing and Indel markers in the sequences were obtained. PCR primers were designed based on the Indels, and the high ear position haplotypes of maize inbred lines were distinguished by PCR and agarose gel electrophoresis bands.
[0052] Example 1: Investigation and Phenotypic Data Analysis of Ear Height Trait in Maize Inbred Lines
[0053] Using 1149 high-quality maize inbred lines bred over the past 15 years from the Shenzhen Genomics Institute of the Chinese Academy of Agricultural Sciences, these lines were grown under field conditions in Acheng District, Harbin City, Heilongjiang Province in 2023 and 2024. A randomized block design was employed, with each variety planted in two rows, each 3m long, with a row spacing of 0.65m and a plant spacing of 0.2m. Fertilization and irrigation were managed as usual in the field. Ear height was measured at maturity, excluding the first plant in each row. Five representative plants from each variety were selected to measure the distance from the ground to the ear. Data on ear height and other traits were recorded and compiled. Statistical analysis of the phenotypic data under the two environments was performed using Microsoft Excel 2022 and IBM SPSS Statistics V27.0. The normality of the distribution was evaluated based on the coefficient of variation, skewness, and kurtosis. Finally, a frequency distribution histogram was plotted using Origin 2021 software to test the normality of the phenotypic data. Statistical analysis of the ear height trait in maize showed that the mean value ranged from 82.93 to 86.36 cm under two different environmental conditions, with phenotypic variation ranging from 21.00 to 174.00 cm and a coefficient of variation ranging from 17.86% to 24.58%. The coefficient of variation exceeded 15% in all environmental conditions, indicating relatively rich phenotypic variation in ear height among the maize inbred line population. The absolute values of skewness and kurtosis for ear height were both less than 1, and the data distribution curve conformed to a normal distribution, indicating that the ear height data conformed to quantitative trait characteristics (such as...). Figure 1 The phenotypic data of ear height in maize were analyzed using the lme4 package in R language, and the generalized heritability was estimated by analyzing the variance of various influencing factors. The heritability of ear height was 85%, indicating that it is mainly affected by genetic factors.
[0054] Example 2: Maize genomic DNA extraction, library construction, and sequencing
[0055] The specific method for constructing a library for the maize inbred lines in Example 1 is as follows:
[0056] (1) Weigh 1.0g of fresh leaves, cut them into small pieces and put them into a mortar. Grind them with liquid nitrogen and then add 3mL of 1.5×CTAB. Grind them into a homogenate and transfer it into a 15mL centrifuge tube. Then add 1mL of 1.5×CTAB to the mortar to rinse and transfer it into the centrifuge tube. Mix well and incubate in a 65℃ water bath for 30min, shaking slowly from time to time.
[0057] The 1.5×CTAB formulation is as follows (1L):
[0058] CTAB 15g 1 mol / L Tris.Cl (EH 8.0) 75mL 0.5 mol / L EDTA 30mL NaCl 61.4g
[0059] Add deionized water to a final volume of 1L, and add mercaptoethanol to a final concentration of 0.2% (2ml) before use.
[0060] (2) After cooling to room temperature, add an equal volume of chloroform / isoamyl alcohol (24:1), mix gently until the lower layer turns dark green.
[0061] (3) Centrifuge at 4200 rpm for 10 min, transfer the upper aqueous phase to a new 15 mL centrifuge tube, add 2 volumes of pre-cooled anhydrous ethanol, mix and let stand for 5 min. Incubate at -20℃ for 30 min to precipitate DNA.
[0062] (4) Centrifuge at 4200 rpm for 10 min, discard the supernatant, add 1 mL of 75% ethanol to wash the precipitate once, invert the centrifuge tube to dry the DNA, and add 50 μL of TE to dissolve the DNA.
[0063] (5) Detect the concentration of DNA and adjust it with water to 20 ng / ul.
[0064] (6) Database construction using the FBI-seq method (Zhao et al, 2023)
[0065] Example 3: GWAS analysis of maize ear height to obtain significant SNPs and candidate genes
[0066] All sequencing data were processed and analyzed using a high-performance computer server. Raw data processing: After quality assessment of the raw PE (Pair-end) sequencing data using FastQC, BWA was used for quality control. Sequencing reads were aligned to the reference genome (B73v4), and SNP detection was performed using GATK. After quality control filtering at the sample and variant levels, 57,849 high-quality SNP markers (minimum allele frequency >0.05, missing data <20%) were selected to ensure the accuracy and reliability of the analysis results. To better understand the population structure and genetic background, a phylogenetic tree was constructed using iqTree software, principal component analysis (PCA) was performed on the whole-genome SNP data using Plink software, and population structure analysis was performed using Faststructure software to clarify the genetic structure within the population. Genome-wide association analysis was conducted on the ear height trait and its BLUP value using the previously selected high-quality SNPs. Association analysis between SNP markers and various traits was performed using a mixed linear model of genotype, phenotype, population structure, and kinship matrix in GEMMA. All SNPs satisfying p < 1.7286e-4 were extracted from the GWAS results file using awk and converted to BED format files (Chr, Start, End). Two major-effect SNPs related to ear height were identified through GWAS analysis based on two years of ear height data, located within Chr3:163961992-163963992. The bedtools intersect tool was used to compare significant SNPs and their upstream and downstream 100kb regions with the B73 RefGen_v4 GFF gene annotation file to screen candidate genes. The results are shown in [Figure number missing]. Figure 2 and Figure 3 .
[0067] Example 4: Association analysis of candidate genes for ear height in maize and mining of Indel markers
[0068] Based on field phenotypes, 150 maize inbred lines of two types—high ear position (greater than 86.6 cm) and low ear position (less than 67.9 cm)—and the maize B73 variety were selected. Genomic DNA was extracted from leaves using the CTAB method. The full-length sequences of candidate genes (including the 5' UTR region, 3' UTR, and all exon sequences) were amplified and sequenced using Sanger sequencing for haplotype analysis. Segmented amplification was employed for DNA sequence amplification. Primers were designed using the free online primer design tool NCBI and synthesized by Shenzhen Sangon Biotech Co., Ltd. The amplification and sequencing primers are as follows:
[0069] Primer name Forward primer (5' to 3') Reverse primer (5' to 3') 1 GTGCTATACCCAAGCCGCG ATCAAGGTCGCCCACGAGAAC 2 AGGGATTTGGTGTGCTGGAAC CTGCTTGTGCTTGAGCTGGAA
[0070] The sequences obtained from sequencing were submitted to Snapgene software for multiple sequence alignment. SNP sites with a deletion value greater than 20% and a secondary allele frequency (MAF) ≤ 5% were removed to verify the authenticity of the SNP variant sites. An indel marker was also identified. Single-gene association analysis was then performed using Tassel software. Haploview software was used to output haplotype results in NEX format containing only polymorphic sites (including indels), and an LDblock diagram was plotted. Excel software was used to analyze the distribution of each haplotype in different subpopulations, and Origin software was used for data visualization. The results are shown below. Figure 4 and Figure 5 .
[0071] Example 5: Development and Validation of Indel Markers for Ear Height in Maize
[0072] Based on candidate gene association analysis, Indel variation sites were screened to distinguish ear height traits among different maize inbred lines. Molecular markers were then developed to rapidly identify the two haplotypes at these sites.
[0073] Specifically as follows:
[0074] (1) DNA was extracted from 249 maize inbred lines sequenced by Sanger using the CTAB method;
[0075] (2) Primer design and selection of internal reference primers:
[0076] Ear height Indel primer design: A 17-25 bp sequence was selected from the conserved region upstream of the Indel site as the upstream primer, and a downstream primer was designed at the Indel site. The Indel site is completely linked to the ear height trait; therefore, the presence or absence of PCR products can be initially determined based on whether the primers are linked to the maize ear height trait, and the accuracy of the molecular marker can be judged based on the actual results. The ear height primer design includes the Indel; therefore, maize inbred lines containing the Indel will produce PCR products, while maize inbred lines not containing the Indel will not produce PCR products. Indel primers EH-03-Indel-108F: 5'-CACCGAGGTGGGACTAAAAAG-3', EH-03-Indel-108R: 5'--3'; the internal control was the universal maize primer IVR, with a product length of 226 bp.
[0077] IVR primer IVR-F: 5'-TAGGAGAAGAGCAGGCAGGAG-3';
[0078] IVR-R: 5'-GGAGCCCGTGTAGAGCATGACGATC-3'; see table below:
[0079]
[0080] (3) Perform PCR amplification using the designed primers. The PCR system is shown below:
[0081] Components Volume (20ul) Mix 10 DNA template 1 Primer-F 0.5 Primer-R 0.5 ddH2O 8
[0082] The PCR reaction program was as follows: 94℃ pre-denaturation for 30 seconds, 34 cycles of 98℃ denaturation for 10 seconds, 62℃ annealing for 15 seconds, 72℃ extension for 10 seconds, 72℃ extension for 5 minutes, and storage at 4℃.
[0083] (4) The presence or absence of amplification products for each material was detected by 1.5% agarose gel electrophoresis. The results are shown in [Figure number missing]. Figure 6 .and Figure 7 .
[0084] (5) The presence or absence of the product is recorded based on the gel mapping, and the accuracy of the marking is then determined. The results are shown in [the original text]. Figure 9 .
[0085] Primers EH-03-Indel-108, designed based on the InDel variant site, amplified 200 maize inbred lines. PCR products with bands were recorded as C, those without bands as D, and the internal control primer band as B. Figure 6 and Figure 7 Analysis of the PCR product results revealed that all 200 maize inbred lines showed bands for the internal control primer IVR, indicating that the extracted maize DNA met the requirements for PCR. Figure 6 For the EH-03-Indel-108 primer, among 49 Hap2 lines out of 200 maize inbred lines, 47 showed a 216bp band on molecular marker electrophoresis, while 2 showed no 216bp band. Similarly, 151 Hap1 lines showed no 216bp band on molecular marker electrophoresis, resulting in a labeling accuracy of 95.92%. Figure 7 and Figure 9 ).
[0086] The beneficial effects of the Indel marker EH-03-Indel-108, which is closely linked to the ear height of maize, and its application in this invention:
[0087] 1. Precise Identification of Ear Height Trait in Maize: The Indel marker EH-03-Indel-108 provided by this invention can effectively distinguish ear height haplotypes in maize inbred lines. Through PCR amplification and agarose gel electrophoresis analysis, it is possible to quickly determine whether a maize inbred line carries a low ear height haplotype (containing a 4bp CCTG insertion) or a high ear height haplotype (without an insertion). This precise identification method provides important technical support for maize breeding.
[0088] 2. Improve the efficiency of lodging-resistant variety breeding: Low-ear maize inbred lines have stronger lodging resistance and are more adaptable to mechanized harvesting and high-density planting. This invention, through molecular marker-assisted breeding, can screen maize materials carrying low-ear haplotypes at an early stage, significantly shortening the breeding cycle and improving the efficiency of lodging-resistant variety breeding.
[0089] 3. Simple operation and low cost: The detection method provided by this invention has simple steps, requires conventional reagents and equipment, and is suitable for large-scale application. The identification of ear height trait can be completed through conventional DNA extraction, PCR amplification, and electrophoretic analysis, reducing breeding costs.
[0090] 4. Promoting Maize Genetic Improvement: This invention not only provides important clues for the molecular mechanism research of maize ear height, but also provides a reference for the development of molecular markers for other agronomic traits. By combining conventional breeding and molecular breeding techniques, the genetic improvement process of maize can be further optimized.
[0091] 5. Enhanced selectivity of breeding materials: By using the Indel marker of the present invention, breeders can screen maize inbred lines with ideal ear height at an early stage, avoiding the limitations of traditional breeding that relies on phenotypic selection, and improving the accuracy and efficiency of selection.
[0092] This invention relates to specific primers that can effectively genotype maize ear height and detect differences in Indel polymorphism. The Indel markers for the maize ear height trait provided by this invention can be used for marker-assisted breeding of maize ear height, and have important theoretical and practical guiding significance for accelerating the genetic selection and improvement of maize varieties.
[0093] The purpose of this invention is to locate the functional loci of genes related to ear height in maize and to develop Indel-specific markers for identifying ear height in maize based on the locus sequence information. These molecular markers can predict ear height in maize, providing molecular-assisted technology support for early identification and screening breeding of this trait.
[0094] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely preferred examples and are not intended to limit the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the claimed invention.
Claims
1. A primer pair for detecting the InDel marker EH-03-Indel-108, which is closely linked to ear height in maize, characterized in that, The InDel marker is located in the region Chr3:163961992-163963992 on chromosome 3 of the maize B73v4 reference genome. It is a 4bp insertion / deletion polymorphism marker. Low-ear maize inbred lines have a 4bp CCTG nucleotide sequence insertion at this site, while high-ear maize inbred lines do not have an insertion at this site. The forward primer sequence of the primer pair is 5'-CACCGAGGTGGGACTAAAAAG-3', and the reverse primer sequence is 5'-TAGGAGAAGAGCAGGCAGGAG-3'. If the PCR product obtained by amplification using these primers shows a 216bp band, it indicates that the maize inbred line has CCTG insertion at the InDel site, and is identified as a low-ear haplotype; if there is no 216bp band, it indicates that the maize inbred line does not have CCTG insertion at the InDel site, and is identified as a high-ear haplotype.
2. A method for detecting the ear height trait in maize, characterized in that, The method includes the following steps: S1: Extract genomic DNA from maize inbred lines; S2: Using the DNA from step S1 as a template, PCR amplification is performed using the primer pair and PCR amplification system described in claim 1. The PCR amplification program is as follows: pre-denaturation at 94℃ for 30 seconds, followed by 34 cycles, each cycle including denaturation at 98℃ for 10 seconds → annealing at 62℃ for 15 seconds → extension at 72℃ for 10 seconds, and finally extension at 72℃ for 5 minutes, and storage at 4℃. The total volume of the PCR amplification system is 20 μL, containing: 1 μL DNA template, 10 μL 2×PCR Mix, 0.5 μL of the forward primer described in claim 1 (10 μM), 0.5 μL of the reverse primer described in claim 1 (10 μM), and 8 μL ddH2O. S3: PCR products were analyzed by agarose gel electrophoresis: If a 216bp band appeared, it indicated that the maize inbred line had CCTG insertion at the InDel site and was identified as a low ear haplotype; if no 216bp band appeared, it indicated that the maize inbred line did not have CCTG insertion at the InDel site and was identified as a high ear haplotype.
3. The method as described in claim 2, characterized in that, The extraction reagents used in step S1 to extract genomic DNA include 1.5×CTAB buffer containing 0.2% mercaptoethanol, chloroform / isoamyl alcohol in a 24:1 ratio, anhydrous ethanol, 75% ethanol, and TE buffer.
4. A reagent for detecting the ear height trait in maize, characterized in that, The reagents include the primer pair as described in claim 1, and also include DNA extraction reagents, PCR reaction reagents and agarose gel electrophoresis reagents.
5. The reagent as described in claim 4, characterized in that, The DNA extraction reagents include 1.5×CTAB buffer containing 0.2% mercaptoethanol, chloroform / isoamyl alcohol in a 24:1 ratio, anhydrous ethanol, 75% ethanol, and TE buffer; the PCR reaction reagents include DNA polymerase, dNTPs, and a Mg²⁺ buffer system.
6. The application of the primer pair as described in claim 1 in marker-assisted breeding of maize, characterized in that, For Screening low-ear-position, lodging-resistant maize inbred lines, the screening method for these lines includes the following steps: (1) Using a maize inbred line carrying the low ear haplotype of the InDel marker as described in claim 1 and having CCTG insertion at that site as the donor parent, cross it with the target parent to obtain the F1 generation; (2) Self-cross or backcross the F1 generation to construct a segregating population; (3) Using the method for detecting ear height trait in maize as described in claim 2, individuals carrying low ear haplotype in the segregating population are screened; (4) Combine phenotypic identification and agronomic trait analysis to breed new maize varieties with low ear position and lodging resistance.
Citation Information
Patent Citations
ZKM76 gene controlling maize plant height and ear height and its application
CN110862994B
Molecular marker highly closely linked with corncob position and application thereof
CN116004881A
SNP (Single Nucleotide Polymorphism) molecular marker highly related to corncob position, negative regulatory factor and application of SNP molecular marker and negative regulatory factor
CN118146331A