SNP (Single Nucleotide Polymorphism) molecular marker associated with back fat thickness and eye muscle area character of pig and application of SNP molecular marker

Abstract

The invention belongs to the technical field of molecular biotechnology and molecular markers, and particularly relates to an SNP molecular marker associated with back fat thickness and eye muscle area characters of pigs and application of the SNP molecular marker. A high-throughput sequencing technology is utilized to identify the SNP site related to the pig meat production performance, on one hand, the influence of the SNP site on the meat production efficiency is explored, and on the other hand, an available molecular marker is provided for improving new application of pig genetic breeding. The marker corresponds to a site 7061212 of a No.1 chromosome of a pig of an international reference genome Sscrofa11.1 version. A Cgt exists at the 84bp position of the first exon region of LOC106508795, and a Cgt exists at the 84bp position of the first exon region of The base substitution of A results in single nucleotide polymorphism. Genetic typing is carried out on the SNP site, and correlation analysis shows that AA genotype individuals have excellent characters of thin back fat, large eye muscle area and the like of living bodies with the weight of 100 kg.

Description

Technical Field

[0001] The invention belongs to the field of molecular biotechnology and molecular marker technology, and specifically relates to a SNP molecular marker related to pig backfat thickness and eye muscle area and its breeding application. The molecular marker is cloned from base 7061212 of pig chromosome 1, and the site is located at 84bp of the first exon region of LOC106508795. Background Art

[0002] my country is the world's largest producer and consumer of live pigs, and the live pig industry is one of the key pillar industries of agriculture. [1] Breeding pig breeds with excellent traits is particularly important to ensure the rapid development of the pig industry. In the past few decades of development, my country's pig industry has achieved excellent results, its independent innovation capabilities have been continuously improved, and its supply capacity of high-quality pig breeds has been continuously enhanced, laying a solid foundation for the stable development of the pig industry and greatly satisfying the public's demand for pork-related meat products. [2] .

[0003] With the rapid development of molecular biology technology and high-throughput sequencing technology, the goal of efficiently obtaining gene sequences has been achieved, and then the dominant trait mutant individuals can be quickly screened out by comparing wild genotypes. From the molecular field, the speed of cultivating high-quality breeding pigs can be accelerated, and the quality of pork-related agricultural products can be improved as soon as possible, injecting strong impetus into the national meat food supply. The research on excellent traits of livestock and poultry involves aspects such as pig back fat thickness and eye muscle area. Many key genes affecting traits have been screened using the above technical means, such as LOC106508795, which is a long non-coding RNA (lncRNA) with a length of more than 200 nucleotides, which shows a strong regulatory power on gene expression. A large number of literatures have confirmed that SNPs in lncRNAs will change the function of lncRNAs, thereby affecting gene regulation and trait expression. By identifying SNP markers related to pig muscle development and combining them with traits for association analysis, more advantageous genotypes can be found to accelerate breeding work in breeding pigs.

[0004] In view of this, the present invention aims to provide a SNP marker and breeding application related to pig backfat thickness and eye muscle area traits. The present invention detects SNPs in the exon region of lncRNA-LOC106508795, screens SNP molecular markers related to pig muscle development, promotes the development of animal genetic breeding more scientifically and efficiently, and provides a new idea for solving breeding problems.

[0005] Main references

[0006] [1] Zhang Haifeng, Chen Rui, Chen Nan, et al. Development of China's pig industry in 2022 and trends in 2023 [J]. China Pig Industry, 2023, 18(02): 13-18.

[0007] [2] Li Mingquan. Improve the pig industry chain and lay a solid foundation for the development of the pig industry [J]. China Pig Industry, 2021, 16(01): 43-45. Summary of the invention

[0008] The purpose of the present invention is to provide a SNP molecular marker associated with pig backfat thickness and eye muscle area traits, and screen genetic markers associated with pig muscle development. By cloning the gene sequence of the 7061028-7062011 segment of pig chromosome 1, and using high-throughput sequencing methods to find SNP sites and genotyping methods, the correlation between SNP sites and pig backfat thickness and eye muscle area traits is analyzed, thereby providing new marker sites for improving pig meat production efficiency.

[0009] The present invention is based on the above-mentioned SNP molecular marker and proposes a new breeding application to accelerate the work of improving pork meat production performance. The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1. There is a C>A base mutation at the 800th position of the sequence. The three genotypes show significant changes in back fat thickness and eye muscle area in living bodies with a body weight of 100 kg; the results show that the AA genotype of the SNP site is a favorable genotype for improving pig meat production efficiency.

[0010] The present invention is achieved through the following technical solutions:

[0011] A SNP molecular marker associated with pig backfat thickness and eye muscle area traits, wherein the site of the SNP molecular marker corresponds to the gene sequence of the 7061028-7062011 segment of pig chromosome 1, the fragment length is 984bp, and the nucleotide sequence thereof is as described in SEQ ID NO.1. By performing BLAST comparison on the NCBI website, it is found that there is a nucleotide polymorphism (SNP) site in the amplified fragment, specifically as follows Figure 3 The mutation of this SNP site is specifically at the 7061212th base of chromosome 1, and the base changes from C to A. According to the naming rules of the Ensembl database, the mutation site is named rs325246183.

[0012] The primer pair was designed based on the pig gene sequence (NC_010443.5) published in the NCBI database. The sequence of the primer pair is as follows:

[0013] Forward primer (SEQ ID NO. 2): 5′-ACTCGGGCTGCGAAAGTTTA-3′;

[0014] Reverse primer (SEQ ID NO. 3): 5'-CTTGAATCACCTGGGCCACT-3'.

[0015] The above primer pair can detect and type the SNP sites in the gene region of the 7061028-7062011 segment of pig chromosome 1.

[0016] After PCR amplification, purification of PCR products, cloning and sequencing, and sequence comparison analysis using the above primer pair, a genetic marker associated with pig meat production performance was screened. The nucleotide sequence of the genetic marker is shown in SEQ ID NO.1 below, where the mutation site is located at position 800 of the sequence.

[0017] ACTCGGGCTGCGAAAGTTTAACTTTCCCAATATTGCTTCACCTGGGGTGAAGCTAATGCACACAGTCTATTTAGGCCTCTACTGAGCTTGACAATCTTTTTTTTTTTTGCCATTTCTAGGGCCACTCCCGCGGCATATGGAGGTTCCCAGGTTAGGGGTCTAATCGGATCTGTAGCCGCCGGCCTACACCACAGCCACAGCAACGCAGAGTCCAAGCCATGTCAGTGACCTACACCACAGCTCACAGCAACGTCGGATCCTTAACCCACTGAGCAAGGCCAGGTTTCCAACCCGCAACCTCATGGTTCCTAGTCGGATTCGTTAACCACTGTGCCACGACCAGAACTCCTAGCTTAACACCCTTAAGTTAGAGCACAGTGGTTAATGTCCTACCTAACAGTGTAGAATCATTATGTAAGCTAAAATAATTTATTATCAAAACGTCTTTAAGTCCAGTAGACTCATACGTTTTCCACGATTCAAATTATGTTAATAAAATGTCCATCTTTTCCCCAAATGGGTCACAGCACGTTATAGCCTCATCGTCATGAAAGAAAGCAAGATTGGTCAAATTAAGTTTAAAGGGCCTCTCAATTTTGTTGATTCTGTACTTTCCCCTGGCTTCGGGCTAGAACGACGGGTAGTTCAGGCTTTAAAACTCCTACATCAGAGTTCAATAATATTCGGGAATGGCCTCTAGTTGTGAAATAAGAACTCAAAACCCACCTCTCTCCTGGCTATGAATTCCTGTCTGTAAACCAACCAGCAAAATGTACGGGTGGGAACCCATCGTCCTGGGM(C / A)GGGATCTCCTCCAGAATTGCCAGGAGTTGAAGCACTGTGTGTGCAGAATTCACAGGAACAGAGCGTGCGGGGGAGGAGGAGGCGGTGCCACCATGAGGGGCCCAGCGACCCGGTGCGTTTCCCGTCCTTTCACGTCGCCCCGGCTTTCTCTCCTCCCCTCACCTAGTGGCCCAGGTGATTCAAG

[0018] A SNP marker method for improving pig meat production performance comprises the following steps:

[0019] 1. Extract genomic DNA from the blood of Large White pigs;

[0020] 2. Design primers based on the genomic sequence from -799 bp upstream to 184 bp downstream of the site. Use the above primers to perform PCR amplification on pig genomic DNA, and obtain the nucleotide sequence from -799 bp upstream to 184 bp downstream of the site by direct sequencing (see SEQ ID NO.1 for details), which contains 1 SNP site;

[0021] 3. This mutation site can be used as a genetic marker to conduct association analysis on the meat production traits of Large White pigs.

[0022] The present invention provides a genotyping method for detecting SNP sites in the above sequence.

[0023] Another technical purpose of the present invention is to provide the application of the SNP molecular marker in the traits of pig backfat thickness and eye muscle area, and to determine the association between individuals with different genotypes and the traits using a high-throughput sequencing method, comprising the following steps:

[0024] 1. In order to determine the correlation between SNPs in the 7061028-7062011 region of chromosome 1 and the backfat thickness and eye muscle area traits of pigs, Large White pigs were selected as the experimental material;

[0025] 2. The polymorphism was detected by high-throughput sequencing, and the correlation between the polymorphic loci and the backfat thickness and eye muscle area of ​​pigs was analyzed. The mixed linear model (Mixed) in SAS statistical software was used to conduct association analysis between the three genotypes and meat production phenotypes.

[0026] Compared with the prior art, the present invention has the following advantages and effects:

[0027] The present invention studies and determines that the SNP that affects the pig backfat thickness and eye muscle area traits is located at the 7061212 base of pig chromosome 1. Among them, the M at position 800 in the nucleotide sequence of the SNP molecular marker is an allele replacement, and the base replacement causes a functional change of lncRNA-LOC106508795, which in turn leads to changes in the relevant traits of meat production performance: in the backfat thickness trait of a living body weighing 100kg, the AA genotype individual of the SNP site has a thinner backfat thickness; in the eye muscle area trait of a body weight of 100kg, the eye muscle area of ​​the AA genotype individual of the SNP site is larger. Therefore, the AA genotype of the SNP site changes in the two key traits related to meat production efficiency, which indeed proves that it is beneficial to improve meat production performance. The purpose of the present invention is to explore SNP sites related to the pig backfat thickness and eye muscle area traits, and then provide applications for pig genetic breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 : The present invention clones and detects the segment 7061028-7062011 of pig chromosome 1; the concentration of agarose gel is 1%; wherein: lane 1: PCR amplification product, lane M: DL2000Maker;

[0029] Figure 2 : Sequencing map of the genetic marker sequence C>A of the present invention;

[0030] Figure 3 : The nucleotide sequence of the 7061028-7062011 segment of pig chromosome 1; the one mutation site marked in red in the sequence is the specific site that causes the polymorphism in this segment. DETAILED DESCRIPTION

[0031] Example 1: Amplification of DNA fragments in the 7061028-7062011 region of porcine chromosome 1 and establishment of a SNP detection method

[0032] 1. Primer pairs were designed based on the genome sequence of the 7061028-7062011 segment of pig chromosome 1. The specific sequences are as follows:

[0033] Forward primer (SEQ ID NO. 2): 5'-ACTCGGGCTGCGAAAGTTTA-3'.

[0034] Reverse primer (SEQ ID NO. 3): 5'-CTTGAATCACCTGGGCCACT-3'.

[0035] 2. Use the above primers to perform PCR amplification on the genomic DNA of the experimental group of pigs.

[0036] The PCR reaction system is shown in Table 1.

[0037] Table 1 PCR reaction system

[0038]

[0039] The PCR reaction conditions are shown in Table 2.

[0040] Table 2 PCR reaction conditions

[0041]

[0042] After the obtained PCR product was purified and cloned, it was commissioned to Wuhan Aoke Biotechnology Co., Ltd. for sequence determination. BLAST comparison analysis revealed a C / A base mutation at the 800th base of the sequence.

[0043] Example 2: Association analysis between the genetic markers of the present invention and the traits of pig backfat thickness and eye muscle area

[0044] 1. In order to determine the correlation between SNPs in the 7061028-7062011 region of chromosome 1 and pig trait differences, this experiment selected Large White pigs (435 heads) as the experimental material.

[0045] 2. SNP detection was performed by high-throughput sequencing, and the correlation between SNP and pig muscle development was analyzed. The mixed linear model (Mixed) in SAS statistical software was used to analyze the association between genotype and phenotype values. Among them, the analysis model is as follows: Y ijkl =u+G i +F j +S k +B l +ε ijklm , where Y ijkl is the observed value of the trait; u is the total average value of the trait; G i is the genotype effect; F j , S k , B l are fixed effects, namely family, gender, and batch effects; ε ijklm is a random error, assuming that it obeys N(0, σ 2 )distributed.

[0046] 3. The gene sequence polymorphism analysis of the rs325246183 site in the 7061028-7062011 region of chromosome 1 of pigs was performed, and three genotypes were detected in the above populations. The genotype frequencies and their distribution are shown in Table 3.

[0047] Table 3 Genotype and allele frequencies of polymorphic site rs325246183

[0048]

[0049] From Table 3, it can be concluded that the frequency of A allele of polymorphic locus rs325246183 in the Large White pig population is higher than that of C allele. The Hardy-Weinberg equilibrium test results show that in Large White pigs (χ 2 =2.911, P=0.088>0.05), the genotype distribution of the polymorphic site rs325246183 was consistent with the genetic equilibrium state.

[0050] Table 4 Association analysis between polymorphic site rs325246183 and backfat thickness and eye muscle area traits

[0051]

[0052] Note: The above values ​​are least squares mean ± standard error. In each pig breed, the same letters in the same column indicate no significant difference (P>0.05). If the letters are different, lowercase letters indicate significant difference (P<0.05), uppercase letters indicate extremely significant difference (P<0.01), and unmarked letters indicate no significant difference (P>0.05). The numbers in brackets indicate the number of pigs.

[0053] The association analysis results in Table 4 showed that the polymorphic site rs325246183 was significantly correlated with the backfat thickness and eye muscle area traits of 100 kg body weight in Large White pigs. The backfat thickness of Large White pigs with AA genotype was significantly lower than that of those with CC genotype (P<0.05). In terms of the eye muscle area trait of 100 kg body weight, the eye muscle area of ​​Large White pigs with AA genotype was significantly larger than that of those with CA genotype (P<0.05). In summary, the homozygous mutant AA genotype can be used as the best choice to improve the meat production efficiency of pigs. According to the phenotype, the scope of genetic testing can be narrowed down, and pigs with AA genotype at this SNP site can be found. The pigs with this genotype can be monitored in real time, and other traits including feed conversion rate and daily weight gain can be observed. Pigs with excellent performance in multiple traits can be further selected as breeding pigs. In addition to considering the influence of the gene level on heritability, attention should also be paid to the external environment. Measures such as optimizing the pig farm environment, fine feeding, and daily quarantine can be taken. By using molecular markers to assist in the selection of dominant genotypes, the traits can be fundamentally changed, and strengthening the daily management of breeding pigs can further accelerate the genetic breeding process. Based on the above results, the present invention speculates that the polymorphic site rs325246183 can be used as a potential genetic marker for improving pig muscle development. The application of this genetic marker and the new breeding ideas proposed based on this can accelerate the expansion of the scale of dominant trait breeding pigs, gradually realize the cultivation of high-quality commercial pig lines, and ultimately achieve the maximum economic benefits of China's pig industry.

Claims

1. A SNP molecular marker associated with pig backfat thickness and eye muscle area traits, characterized in that: The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, wherein M in the sequence is A or C.

2. The SNP molecular marker according to claim 1, characterized in that: The pigs include Large White pigs.

3. The SNP molecular marker according to claim 1, characterized in that: The sequences of the primer pairs used to detect the SNP molecular markers are shown in SEQ ID NO.2 and SEQ ID NO.

3.

4. The use of the SNP molecular marker according to claim 1 in improving the meat production performance of pigs, characterized in that: The steps include: 1) Extracting genomic DNA from the blood of Large White pigs; 2) Design primers based on the genome sequence from -799 bp upstream to 184 bp downstream of the site; perform PCR amplification on pig genomic DNA using the primers, and obtain the nucleotide sequence from -799 bp upstream to 184 bp downstream of the site by direct sequencing, wherein the sequence contains 1 SNP site; 3) This mutation site can be used as a genetic marker to conduct association analysis on the meat production traits of Large White pigs.

5. The use according to claim 4, characterized in that: The meat production performance-related traits are back fat thickness and eye muscle area of ​​live animals weighing up to 100 kg; the C>A mutation at position 800 in the nucleotide sequence of the SNP molecular marker: in the back fat thickness trait of live animals weighing up to 100 kg, the back fat thickness of individuals with the AA genotype at this SNP site is thinner; in the eye muscle area trait of live animals weighing up to 100 kg, the eye muscle area of ​​individuals with the AA genotype at this SNP site is larger.

Images