CIP electrochemical biosensor based on CRISPR-Cas12a cooperating with Exo III to assist double-circulation signal amplification and application

Abstract

The invention discloses a CIP electrochemical biosensor based on CRISPR-Cas12a cooperating with Exo III to assist double-circulation signal amplification and application, and belongs to the technical field of food safety detection. According to the invention, a sensitive CIP detection method is established on the basis of cascade signal amplification catalyzed by CRISPR-Cas12a in cooperation with Exo III. The CRISPR-Cas12a system has the advantage of high dynamic catalytic efficiency, is accurate in targeting, high in trans-cleavage activity and simple in design, and can effectively improve the analysis performance of the biosensor. A double-enzyme cooperative sensing system is established, so that the stability and the specificity of a CIP detection platform can be effectively improved. The detection limit is relatively low, the linear range is relatively wide, the analysis performance is excellent when the CIP in a food sample is detected, and the detection method has a huge prospect as a useful tool for food safety detection.

Description

Technical Field

[0001] The present invention belongs to the technical field of food safety detection, and in particular relates to a CIP electrochemical biosensor based on CRISPR-Cas12a and ExoIII-assisted double-cycle signal amplification and its application. Background Art

[0002] Ciprofloxacin (CIP) is a synthetic quinolone antibiotic that destroys bacterial activity by inhibiting the activity of DNA gyrase and blocking bacterial DNA replication. It is used in animal husbandry and aquaculture to treat diseases caused by bacteria. At present, it has become a common practice to add CIP to animal feed to promote growth and prevent diseases. However, a large amount of CIP residues in food can enter the human body through the food chain, causing harm to human health. Studies have shown that CIP can cause severe allergic reactions, gastrointestinal diseases, chronic bacterial prostatitis, and renal failure in humans. The Chinese national standard stipulates that its maximum residue limit in animal food is 100 μg / kg. Therefore, the demand for efficient detection of CIP residues is growing.

[0003] The existing methods for detecting CIP include high performance liquid chromatography (HPLC), capillary electrophoresis (CE) and spectrophotometry. Although these analytical methods have good specificity and sensitivity, they still have disadvantages such as high cost, complex pretreatment, time-consuming and need for professionals, which limits their widespread application. In recent years, electrochemical sensors have stood out due to their advantages such as fast response speed, easy miniaturization, simple equipment and high sensitivity, and have received increasing attention in the detection of quinolone antibiotic residues.

[0004] In order to further improve the detection sensitivity, various signal amplification technologies have been widely used in the field of biosensing. Among them, the enzyme-catalyzed signal amplification strategy is efficient and easy to operate, so it is often introduced into electrochemical sensors for signal amplification. However, the technology of using enzymes to enhance signals usually requires delicate sequence design, which undoubtedly increases the complexity of the signal amplification strategy and also limits the widespread application of enzyme-assisted signal amplification technology. Fortunately, there are many tool enzymes that can cleave or extend DNA in a sequence-independent manner. Exonuclease III (Exo III) is a sequence-independent enzyme that does not require a specific recognition sequence. Therefore, Exo III can be used as an effective targeted recovery catalytic tool to enhance signals and improve sensitivity. It is worth noting that the recently discovered incidental cleavage properties of some CRISPR-Cas proteins have attracted widespread attention, and only a single CRISPR RNA (crRNA) is needed to perform complex gene editing. In particular, Cas12a nuclease, once crRNA recognizes the target DNA, the trans-cleavage activity of Cas12a is activated, and single-stranded DNA in the system can be cut indiscriminately. The CRISPR-Cas12a system can specifically discriminate RNA-guided target sequences, thereby improving its specificity and sensitivity, flexibility, and simplicity. CRISPR-driven biosensors can enable high-throughput and field-deployable detection of nucleic acid and non-nucleic acid biomarkers, few of which are currently used for the detection of antibiotics.

[0005] Therefore, based on the catalytic properties of the enzyme, how to maximize the reverse cleavage activity of Cas12a by combining the CRISPR-Cas12a system with Exo III auxiliary signal amplification technology and further develop the application of CRISPR-driven biosensors in the field of antibiotic detection has become an urgent problem to be solved. Summary of the invention

[0006] The first object of the present invention is to disclose a CIP electrochemical biosensor based on CRISPR-Cas12a and Exo III-assisted double-cycle signal amplification, which has a wide linear detection range and high sensitivity to ciprofloxacin.

[0007] The second purpose of the present invention is to propose an application of a CIP electrochemical biosensor in the detection of ciprofloxacin, and to establish a dual-enzyme cooperative sensing system based on the cascade signal amplification strategy catalyzed by CRISPR-Cas12a and Exo III, which can effectively improve the stability and specificity of the CIP detection platform, and can show a relatively low detection limit and a wide linear range.

[0008] In order to solve the above problems, the technical solution adopted by the present invention is as follows:

[0009] A CIP electrochemical biosensor based on CRISPR-Cas12a and Exo III-assisted double-cycle signal amplification, the biosensor comprising a gold electrode (AuE), a DNA2 probe modified on the electrode, and a signal molecule; wherein the sequence of the DNA2 is: ATTGACCGCTGTGTGACGCAACACTCAAT-(CH2)6-SH; and the signal molecule is SA-HRP.

[0010] Furthermore, the method for modifying the electrode with the DNA2 probe is as follows: dilute the probe DNA2 with Tris-HCl buffer to obtain a mixed solution and store it in the dark; then immerse the pretreated gold electrode in the mixed solution, let it stand overnight, and then rinse the gold electrode fixed with DNA2 with Tris-HCl buffer. Subsequently, immerse the modified electrode in MCH, let it stand in a fume hood, and finally rinse it with ultrapure water to obtain DNA2@AuE.

[0011] Furthermore, the application of the above CIP electrochemical biosensor in detecting ciprofloxacin comprises the following steps:

[0012] (1) pre-treating the gold electrode to obtain a pre-treated gold electrode;

[0013] (2) Modifying DNA2 on the surface of the pretreated gold electrode to obtain DNA2@AuE;

[0014] (3) reacting the CIP aptamer with DNA1 to prepare the ligand / DNA1 duplex, and then adding different concentrations of CIP to generate the CIP-aptamer complex;

[0015] (4) adding H1, H2 and Exo III to the CIP-aptamer complex prepared in step (3) for incubation, inactivating Exo III after the incubation, and adding the Cas12a / crRNA binary complex to prepare a Cas12a / crRNA / DNA activation chain ternary complex;

[0016] (5) DNA2@AuE was incubated with the Cas12a / crRNA / DNA activation chain ternary complex, and SA-HRP was added and incubated again. Finally, the mixture was immersed in TMB colorimetric solution for electrochemical measurement and the electrochemical signal was recorded.

[0017] Furthermore, when the concentration range of CIP was 0.064 ng / mL to 1000 ng / mL, the current value decreased with the increase of CIP concentration; the change of current value was linearly related to the logarithmic value of CIP concentration;

[0018] The linear correlation equation is y = 0.296x + 0.820, and the regression coefficient is 0.997;

[0019] Where y is the change in current value, and x represents the logarithmic value of CIP concentration; according to the 3σ rule (S / N=3), the detection limit (LOD) was calculated to be 0.022 ng / mL.

[0020] Furthermore, the sequence of the DNA1 is GATTACGATTGTACGTATCATTTTTT; and the concentration of the DNA1 is 50nM to 300nM.

[0021] Further,

[0022] The sequence of H1 is:

[0023] CCCATCAGGGGGCTAGGCTACTTTGCTAGCCTAGCCCCCTGATGGGCG TACAATCGTAATC;

[0024] The sequence of H2 is:

[0025] CCCATCAGGGGGCTAGGCTACTTTGCTAGCCTAGCCCCCTGATGGGTA GCCTAGCCC.

[0026] Furthermore, the SA-HRP is added dropwise and the incubation time is 5 to 25 minutes.

[0027] Furthermore, the SA-HRP was added dropwise and incubated for 20 minutes.

[0028] Furthermore, the concentration of Exo III added was 0.14 U / μL, and the action time was 60 min.

[0029] Furthermore, the trans-cleavage time of CRISPR-Cas12a is 40 minutes.

[0030] Compared with the prior art, the advantages of the present invention are as follows:

[0031] 1) The present invention establishes a sensitive CIP detection method based on the cascade signal amplification catalyzed by CRISPR-Cas12a and Exo III. The double cycle mediated by Exo III significantly amplifies the signal output, greatly improving the sensitivity of the detection system.

[0032] 2) The present invention constructs a CIP electrochemical biosensor based on CRISPR-Cas12a and Exo III assisted dual-cycle signal amplification. In the presence of a target, the aptamer specifically binds to the target CIP to produce a free single-stranded reporter probe, which in turn triggers the cascade cycle amplification catalyzed by Exo III, produces a large amount of DNA single strands as the activation strand of CRISPR-Cas12a, and then activates the trans-cleavage activity of CRISPR-Cas12a, cutting the signal DNA probe modified on the surface of the gold electrode, and generating a significantly decreased electrochemical signal.

[0033] 3) The electrochemical biosensor of the present invention has a wide linear detection range and high sensitivity for ciprofloxacin, and is also successfully applied to the sensitive detection of ciprofloxacin in actual food samples. In addition, due to the non-sequence dependence of Exo III and CRISPR-Cas12a, the detection method only needs to design two simple hairpin structures to achieve the synergistic effect of ExoIII-driven double-cycle cleavage and CRISPR-Cas12a's trans-cleavage activity. Therefore, the constructed electrochemical biosensor is expected to become an effective tool for food safety detection.

[0034] 4) The CRISPR-Cas12a system disclosed in the present invention has the advantages of high kinetic catalytic efficiency, precise targeting, high trans-cleavage activity, and simple design, which can effectively improve the analytical performance of biosensors. At the same time, according to the specific properties of different enzymes, and their different requirements and recognition methods for nucleic acid substrate sequences, a dual enzyme cooperative sensing system is established, which can effectively improve the stability and specificity of the CIP detection platform.

[0035] 5) The biosensor of the present invention exhibits a relatively low detection limit and a wide linear range, and also exhibits excellent analytical performance when detecting CIP in real food samples, showing great prospects as a useful tool for food safety testing. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 Schematic diagram of the CIP detection principle based on CRISPR-Cas12a-cooperative Exo III catalytic cascade signal amplification;

[0037] Figure 2 Schematic diagram of the detection principle for EIS (A) and CV (B) measurements; AuE (a), DNA2 / AuE (b), MCH / DNA2 / AuE (c), Activated Cas12a / MCH / DNA2 / AuE (d), SA-HRP / Activated Cas12a / MCH / DNA2 / AuE (e);

[0038] Figure 3 It is a proof-of-principle diagram; among them, (A) It verifies the response of the detection system to CIP, without CIP (a), with CIP (b); (B) It verifies the double cycle of DNA catalyzed by Exo III, without CIP (a), with CIP (b), without Exo III (c), without H1 (d), and without H2 (e); (C) It verifies the role of CRISPR-Cas12a, without CIP (a), with CIP (b), without Cas12a and crRNA (c), without crRNA (d), and without Cas12a (e); (D) Gel electrophoresis verifies the detection principle. Lane M: Marker (20bp), Lane 1: CIP + Apt / DNA1 (1μM) + H1 (1μM) + H2 (1μM) + Exo III (1UμL -1 )+Cas12a / crRNA (500nM)+DNA2 (1μM), lane 2: no CIP, lane 3: no Exo III, lane 4: no Cas12a, lane 5: no crRNA, lane 6: no Cas12a and crRNA. CIP concentration was 1000ng mL -1 ;

[0039] Figure 4 The relationship between optimization of key experimental conditions and △I; (A) the change of current difference (△I) with DNA1 concentration; (B) the change of △I with Exo III concentration and reaction time; (C) the relationship between △I and CRISPR-Cas12a trans-cleavage time; (D) the relationship between △I and SA-HRP incubation time; △I = I0-I, where I0 is the current value when there is no target, I is the current value generated after the target is introduced into the reaction, and the error bar represents the standard deviation (n = 3);

[0040] Figure 5 Quantitative detection diagram of CIP; (A) It curves corresponding to different concentrations of CIP, from curve a to curve j (ng mL-1): 0, 0.064, 0.25, 1, 4, 16, 64, 250, 1000, 4000; (B) Relationship between current value change (△I) and CIP concentration; Inset: Linear relationship between △I and the logarithm of CIP concentration, error bars represent standard deviation (n=3);

[0041] Figure 6 (A) Specificity study by measuring the It current signals corresponding to different antibiotics; the mixture consists of CM, TET, SDZ, SDM and CIP; the concentrations of CIP and interfering antibiotics are both 1000 ng mL -1 ; Figure 6(B) is the stability study of the biosensor, the CIP concentration is 1000 ng mL -1 ; Error bars represent standard deviation (n=3). DETAILED DESCRIPTION

[0042] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, the specific implementation methods of the present invention are described in detail below in conjunction with specific embodiments.

[0043] The sources of the reagents and drugs used in the following examples of the present invention are shown in Table 1 below.

[0044] Table 1 Sources of reagents and drugs used in each example

[0045]

[0046]

[0047] All oligonucleotide chains were custom-synthesized by Sangon Biotechnology (Shanghai) Co., Ltd. The specific oligonucleotide chain sequences are shown in Table 2 below.

[0048] Table 2 Oligonucleotide chain sequence

[0049]

[0050]

[0051] The sources of the equipment used are shown in Table 3 below.

[0052] Table 3 Sources of equipment used

[0053] equipment company Electrochemical workstation (CHI660E) Shanghai Chenhua Instrument Co., Ltd. Vortexer Hangzhou Miou Instrument Co., Ltd. Centrifuge Hangzhou Miou Instrument Co., Ltd. metal bath Hangzhou Miou Instrument Co., Ltd. Ultrasonic cleaning machine Nanjing Hechuang Scientific Instrument Co., Ltd. Water bath Hangzhou Miou Instrument Co., Ltd. Gel electrophoresis apparatus Bio-Rad Biomedical Products (Shanghai) Co., Ltd.

[0054] Electrochemical measurements

[0055] All electrochemical measurements were performed on an electrochemical workstation (CHI660E) with a three-electrode system (gold electrode as working electrode, saturated calomel electrode as reference electrode, and platinum electrode as counter electrode). 3- / 4- Cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS) were performed in solution. CV measurements were performed in the range of -0.2 V to 0.7 V with a scan rate of 50 mV s -1 , EIS was performed in the frequency range of 0.1 Hz to 10 kHz, with a bias potential of 0.265 V and an amplitude of 5 mV. The It curve was measured at -0.1 V, and the electrocatalytic current was recorded 60 s after the HRP redox reaction reached a steady state.

[0056] Example 1

[0057] A method for preparing a CIP electrochemical biosensor based on CRISPR-Cas12a synergistic with Exo III assisted double-cycle signal amplification, comprising the following steps:

[0058] (1) Treat the gold electrode with piranha solution (volume ratio of concentrated sulfuric acid to 30% hydrogen peroxide is 3:1) for 5 min, then polish it with 0.3 μm and 1 μm alumina powder in sequence. After polishing, rinse the electrode thoroughly with ultrapure water, then immerse it in ethanol and ultrapure water for 5 min respectively, and then drop the piranha solution on the surface of the gold electrode and incubate it for 5 min. Finally, electrochemically treat the gold electrode in 0.5 M H2SO4 solution until a stable voltammogram is observed. Rinse the electrode again with ultrapure water, blow dry it with nitrogen gas, and set aside.

[0059] (2) The signal probe DNA2 was diluted to 1 μM with 10 mM Tris-HCl buffer (containing 100 mM NaCl, 10 mM MgCl2 and 1 mM EDTA, pH 7.4), and the SS bond was reduced with 20 mM TCEP at 37°C in the dark for 2 h.

[0060] (3) Immerse the pretreated gold electrode (AuE) in the mixed solution obtained in step (2) above and leave it at 4°C overnight to fix the DNA2 probe; then rinse the gold electrode fixed with DNA2 with 10mM Tris-HCl buffer to remove the unbound DNA2 probe.

[0061] (4) The modified electrode was immersed in 10 mM MCH and allowed to stand in a fume hood for 15 min to eliminate nonspecific adsorption and promote the formation of a DNA self-assembled monolayer on the electrode surface. Finally, it was rinsed with ultrapure water to obtain DNA2@AuE.

[0062] Example 2

[0063] The method for detecting ciprofloxacin based on CRISPR-Cas12a assisted by Exo III double-cycle signal amplification using a CIP electrochemical biosensor is as follows:

[0064] (1) 200 nM CIP aptamer chain was mixed with 200 nM DNA1, and the resulting mixture was heated to 95°C for 5 min and then gradually cooled to room temperature for 1 h to generate aptamer / DNA1 duplex.

[0065] (2) Add different concentrations of CIP (0, 0.064, 0.25, 1, 4, 16, 64, 250, 1000, 4000 ng mL) to the aptamer / DNA1 duplex in step (1). -1) and reacted at 37°C for 30 min to generate CIP-aptamer complex and release free DNA1.

[0066] (3) Add H1 (200 nM), H2 (200 nM) and Exo III (0.14 UL -1 ), incubated at 37 ° C for 60 min. The mixture was then placed in an 80 ° C metal bath for 10 min to inactivate Exo III. 100mMCas12a (5 μL), 100mM crRNA (5 μL) and 40U RNase Inhibitor (0.5 μL) were reacted to form a Cas12a / crRNA binary complex, which was then added to the above-mentioned inactivated mixture and reacted at 37 ° C for 20 min to produce a Cas12a / crRNA / DNA activation chain ternary complex to activate the trans-cleavage activity of Cas12a.

[0067] (4) The gold electrode previously modified with the DNA2 chain was incubated with the mixture to allow Cas12a to cut the single-stranded DNA2. The electrode was rinsed three times with ultrapure water, and then 6 μL SA-HRP (streptavidin-labeled horseradish peroxidase) was dropped on the electrode surface and incubated at room temperature for 20 min.

[0068] (5) The electrode rinsed with ultrapure water is immersed in TMB colorimetric solution for electrochemical measurement to record the electrochemical signal.

[0069] The principle of detecting CIP based on CRISPR-Cas12a synergistically with Exo III catalytic cascade signal amplification is as follows Figure 1As shown. By designing the DNA1 probe to form a semi-complementary hybrid double strand with the aptamer, in the presence of CIP, CIP specifically binds to its aptamer sequence to form a CIP-aptamer complex, resulting in the separation of the semi-complementary double-stranded DNA probe and the generation of a free single-stranded reporter probe DNA1. The free DNA1 probe then binds to the 3′ protruding end sequence of H1 to generate a DNA1 / H1 hybrid duplex with a blunt end at the 3′ end, which serves as the substrate for Exo III. Exo III then gradually hydrolyzes and cuts H1 from the 3′ end to generate a single-stranded DNA as the activation strand of CRISPR-Cas12a, while releasing DNA1 to participate in the next cycle. The DNA activation strand generated in the first cycle can hybridize with H2, and also generates a new activation strand under the action of Exo III, while releasing the original DNA activation strand to participate in the next cycle. Amplified by the cascade cycle catalyzed by Exo III, a large amount of DNA single strands are enriched as the activation chain of Cas12a / crRNA, and then combined with the Cas12a / crRNA binary complex and activated CRISPR-Cas12a trans-cutting activity, and the DNA2 probe modified on the gold electrode surface containing SA (streptavidin) aptamer is cut. Finally, due to the inability to capture SA-HRP (streptavidin-labeled horseradish peroxidase) to the electrode surface, almost no catalytic current signal is generated. On the contrary, in the absence of CIP, the Exo III cutting cycle cannot be opened, and then no activation chain is produced, causing the CRISPR-Cas12a system to be unable to be activated, and the DNA2 probe modified on the gold electrode remains intact, so that SA-HRP is introduced into the electrode surface, catalyzing TMB to produce current signals. Therefore, based on the cascade cycle amplification of CRISPR-Cas12a synergistic Exo III catalysis, sensitive electrochemical detection of CIP can be achieved.

[0070] After analyzing the prepared electrochemical biosensor, it was found that too low a DNA1 concentration would limit the detection system's response to the target, whereas too high a DNA1 concentration would result in a signal response when no target was present. Therefore, the concentration of DNA1 would affect the strength of the signal, such as Figure 4 As shown in A, with the increase of DNA1 concentration (50nM~300nM), the current difference (△I) gradually increases, reaches a peak at 200nM, and then gradually decreases, so 200nM is selected as the optimal concentration of DNA1.

[0071] Since the effect of Exo III is closely related to the DNA cycle amplification effect and the activation of Cas12a trans-cleavage activity, the concentration and duration of Exo III action will also affect the signal strength. Figure 4 As shown in B, the concentration and reaction time were 0.14UμL -1At 40 and 60 min, the current difference reached the maximum. Therefore, the optimal concentration of Exo III was 0.14 U μL -1 The best action time is 60 minutes.

[0072] The trans-cleavage of Cas12a is crucial for subsequent signal output, as shown in the figure Figure 4 As shown in C, the current difference reaches the maximum when the cutting time is 40 min, so 40 min is selected as the optimal time for Cas12a trans cleavage.

[0073] The incubation time of SA-HRP will affect whether SA-HRP can fully bind to DNA2 modified on the gold electrode, and whether a stable electrochemical signal can be obtained. Figure 4 As shown in Figure D, as the incubation time of SA-HRP increased from 5 min to 25 min, the current difference gradually increased and reached equilibrium at 20 min, indicating that 20 min was sufficient for SA-HRP to fully bind to DNA2, so 20 min was selected as the optimal incubation time for SA-HRP.

[0074] Example 3

[0075] To verify the feasibility of the constructed electrochemical biosensor, electrochemical impedance spectroscopy (EIS) and cyclic voltammetry (CV) were first measured. The EIS Nyquist plot consists of a straight line and a semicircle, which represent the diffusion process and the interfacial charge transfer resistance (Rct), respectively. Figure 2 As shown in A, the Nyquist curve obtained by the bare gold electrode (AuE) is almost a straight line (a), which only represents the diffusion process, indicating that the bare electrode surface is treated very cleanly. When the thiolated DNA2 is covalently fixed to the AuE surface through the Au-S bond, the semicircle diameter increases significantly (b), indicating that the negatively charged phosphate backbone of the DNA molecule is bound to [Fe(CN)6] 3- / 4- There is electrostatic repulsion between them. When occupied by MCH, the semicircle diameter further increases (c). This is because MCH blocks the vacant sites on the electrode surface, resulting in an increase in the electron transfer resistance on the electrode surface. After incubation with Exo III and CRISPR-Cas12a reaction mixture, the semicircle diameter decreases significantly (d). This is because the activated Cas12a cleaves the signal probe DNA2 on the electrode surface, resulting in a decrease in the amount of DNA2 modified on the electrode surface and a decrease in the electron transfer resistance. Finally, after the introduction of SA-HRP on the electrode surface, the steric hindrance and electron transfer resistance increase slightly (e). At the same time, the gradual modification process of the electrode surface is verified by measuring CV, such as Figure 2 As shown in B, the results are completely consistent with the EIS, indicating the successful preparation of the constructed electrochemical biosensor.

[0076] The chronoamperometry was then used to verify the detection principle. Figure 3 As shown in A, in the absence of CIP, the current value is very large (a). This is because the synergistic effect of the two enzymes cannot be initiated when CIP is not present, and a large amount of SA-HRP is bound to the DNA2 on the electrode surface, catalyzing TMB to produce a redox reaction. In the presence of CIP, the current value drops significantly (b). This is because CIP triggers the synergistic effect of the two enzymes, causing a large amount of DNA2 pre-modified on the electrode to be cut, making it impossible to bind SA-HRP to produce a catalytic current. The above results show that the detection system has a good responsiveness to the target CIP. Further experiments verified the feasibility of Exo III catalyzed dual-cycle amplification. Figure 3 As shown in B, when CIP is not present, the Apt / DNA1 duplex and H1 and H2 can resist the hydrolysis of Exo III and the activation of Cas12a, so that a large amount of DNA2 pre-modified on the electrode is retained intact and combined with SA-HRP to produce a significant catalytic current (a). On the contrary, when CIP is present, the synergistic effect of the double enzyme is successfully initiated, and the DNA2 on the electrode surface is cut, resulting in the inability to bind SA-HRP to produce a catalytic current (b). In the absence of Exo III, the current value changes very little (c), because the DNA cleavage cycle cannot be started without Exo III, no DNA activation chain is generated, and the DNA2 modified on the electrode surface is retained, thereby combining with SA-HRP to output an obvious electrochemical signal. Similarly, in the absence of H1, the DNA cleavage cycle catalyzed by Exo III cannot be started, and the current value does not change significantly (d). In the absence of H2, the current value shows a certain degree of reduction (e), indicating that the second cycle catalyzed by Exo III with H2 as the substrate cannot be carried out, and only the first cycle with H1 as the substrate is opened, which is smaller than the signal response generated by the double cycle. Figure 3 C verifies the role of CRISPR-Cas12a in the detection system. In the absence of CIP, a large current value is generated due to the inability to carry out the dual enzyme synergistic process (a). In the presence of CIP, the current value decreases significantly (b), because CIP triggers the dual enzyme synergistic effect, causing a large amount of DNA2 pre-modified on the electrode to be cut under the trans-cutting effect of Cas12a, thereby being unable to bind SA-HRP to generate a catalytic current. When the detection system lacks a complete Cas12a / crRNA binary complex, the current response changes are not obvious (ce), indicating that the lack of the CRISPR-Cas12a system makes it impossible to cut the DNA2 modified on the electrode surface. The above results verify the feasibility of Exo III and Cas12a synergistic sensing to detect CIP.

[0077] In addition, the feasibility of the detection principle was further verified by 12% gel electrophoresis (PAGE). Lane 1 shows a fuzzy band, indicating that the target CIP successfully triggered the synergistic effect of Exo III and CRISPR-Cas12a, resulting in the degradation of all single-stranded DNA in the reaction system. In contrast, lane 2 shows a clear band corresponding to the DNA2 probe, indicating that in the absence of the target CIP, the catalytic action of Exo III cannot be initiated, and CRISPR-Cas12a cannot be activated, resulting in the complete existence of DNA2. In the absence of Exo III, no activation chain is produced, and the activity of CRISPR-Cas12a cannot be exerted, and the single-stranded DNA in the system will not be hydrolyzed, resulting in the appearance of multiple DNA bands (lane 3). Lanes 4 to 6 verify the effect of CRISPR-Cas12a. Due to the lack of Cas12a (lane 4), crRNA (lane 5) and Cas12a / crRNA binary complex (lane 6), the Cas12a / crRNA / activation chain ternary complex cannot be formed, resulting in the inability to activate the cleavage activity of Cas12a on single-stranded DNA, thereby keeping DNA2 intact. The gel electrophoresis results further demonstrated the responsiveness of the detection system to the target CIP, and verified the important role of Exo III and CRISPR-Cas12a.

[0078] Example 4

[0079] In order to test the quantitative detection performance of the sensor for CIP, different concentrations of CIP were detected under the optimal experimental conditions.

[0080] like Figure 5 As shown in A, the current value decreases with the increase of CIP concentration. -1 Up to 1000ng mL -1 In the range of , the change of current value is linearly related to the logarithmic value of CIP concentration, such as Figure 5 As shown in B.

[0081] The linear correlation equation is y=0.296x+0.820, and the regression coefficient is 0.997, where y is the change in current value (ΔI), and x represents the logarithmic value of CIP concentration.

[0082] According to the 3σ rule (S / N=3), the detection limit (LOD) was calculated to be 0.022 ng mL -1 As shown in Table 4 below, compared with some existing reported methods for detecting CIP, the proposed biosensor exhibited comparable or better detection performance, with a relatively lower LOD and a wider detection range.

[0083] Table 4 Comparison of this biosensor with other reported CIP biosensors

[0084] method <![CDATA[Detection range (ng / mL -1 )]]> <![CDATA[Limit of detection (ng mL -1 )]]> Surface-enhanced Raman scattering <![CDATA[27.6~2.76×10 5 ]]> 27.6 Fluorescent aptasensor 0.63～80 0.63 Colorimetric aptasensor 7.358～110.37 0.079 Electrochemical sensor 0.1～200 0.052 Photoelectrochemical sensor 0.37～551.85 0.11 Electrochemiluminescence sensor <![CDATA[1.84~1.84×10 3 ]]> 0.44 The present invention 0.064～1000 0.022

[0085] The specificity and stability of the constructed biosensor were tested. First, several control antibiotics (including CM, TET, SDZ, and SMD) were selected to evaluate the specificity of the detection. Figure 6 As shown in A, under the same experimental conditions, the target antibiotic CIP and the mixture consisting of the interfering antibiotic and CIP both showed obvious changes in current signals. This is because the presence of CIP can trigger the synergistic sensing of Exo III and Cas12a, resulting in significant changes in the electrochemical signal, while the interfering antibiotic cannot initiate the synergistic effect of the two enzymes and only produces a current value similar to the background signal. The above results show that the proposed biosensor can accurately distinguish CIP from interfering substances and has good specificity for the detection of CIP. In addition, the stability of the constructed biosensor was evaluated by measuring the changes in current signals at different storage times, with a time interval of 12 days. As shown in Figure 6 As shown in Figure B, the measured ΔI changed only slightly from day 0 to day 48, reflecting that the biosensor has satisfactory stability.

[0086] Since CIP in food can cause serious harm to the human body, such as allergic reactions, organ failure, and "three-hazard" effects, it is of great significance to detect the CIP content in food. The constructed biosensor was used to measure the CIP content in milk and apple juice samples to test its application potential in actual sample analysis.

[0087] Example 5

[0088] CIP electrochemical biosensor detects CIP content in milk and apple juice. The steps are as follows:

[0089] (1) 10 mL of milk sample was centrifuged at 3500 × g (10° C.) for 10 min to remove fat. Then, 5 mL of skim milk sample was taken, mixed with 150 μL of 17.2% potassium ferrocyanide and 150 μL of 53.5% zinc sulfate, and centrifuged at 3500 × g for 10 min (15° C.) to precipitate protein. The supernatant was then collected, filtered with a 0.22 μm filter membrane, and diluted for later use.

[0090] (2) Add 1 mL of apple juice to a 5 mL centrifuge tube containing 1 mL of ethyl acetate solution. Then, vortex the mixture and centrifuge it at 5000 × g for 5 min (25°C). Repeat this process several times. Then, collect the supernatant and dilute it with 10 mM Tris-HCl buffer. Finally, filter the diluted sample solution with a filter membrane (0.22 μm) for later use.

[0091] (3) CIP standards were added to pretreated milk and apple juice samples to prepare a series of CIP concentrations, including 0.1, 1, 10, 100, and 1000 ng mL -1 , and a recovery experiment was performed. As shown in Table 5 below, the recovery rate was between 90.4% and 109.7%, and the RSD (2.3%-6.8%) was within the acceptable range.

[0092] Table 5 Results of spike recovery experiments in food samples

[0093]

[0094] The results showed that the electrochemical biosensor based on CRISPR-Cas12a synergistic with Exo III catalytic cascade signal amplification had good analytical performance in the detection of actual food samples, showing potential application value in food safety detection.

[0095] The present invention is based on CRISPR-Cas12a and Exo III catalyzed cascade signal amplification, and establishes a sensitive CIP detection method. The double cycle catalyzed by Exo III makes the signal output significantly amplified, greatly improving the sensitivity of the detection system. The CRISPR-Cas12a system has the advantages of its high kinetic catalytic efficiency, precise targeting, high trans-cleavage activity, and simple design, which can effectively improve the analytical performance of the biosensor. At the same time, according to the specific properties of different enzymes, and their different requirements and recognition methods for nucleic acid substrate sequences, a dual enzyme collaborative sensing system is established, which can effectively improve the stability and specificity of the CIP detection platform. In addition, the biosensor shows a relatively low detection limit and a wide linear range, and also shows excellent analytical performance when detecting CIP in real food samples, showing great prospects as a useful tool for food safety detection.

[0096] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A CIP electrochemical biosensor based on CRISPR-Cas12a and Exo III assisted double cycle signal amplification, characterized in that: The biosensor comprises a gold electrode, a DNA2 probe modified on the electrode and a signal molecule; wherein the sequence of the DNA2 is: ATTGACCGCTGTGTGACGCAACACTCAAT-(CH2)6-SH; and the signal molecule is SA-HRP.

2. According to claim 1, the CIP electrochemical biosensor based on CRISPR-Cas12a synergistically with Exo III assisted double-cycle signal amplification is characterized in that, The method for modifying the electrode with the DNA2 probe is as follows: dilute the probe DNA2 with Tris-HCl buffer to obtain a mixed solution and store it in the dark; then immerse the pretreated gold electrode in the mixed solution, let it stand overnight, and then rinse the gold electrode fixed with DNA2 with Tris-HCl buffer. Subsequently, immerse the modified electrode in MCH, let it stand in a fume hood, and finally rinse it with ultrapure water to obtain DNA2@AuE.

3. Use of the CIP electrochemical biosensor as claimed in any one of claims 1 or 2 in detecting ciprofloxacin, characterized in that: The following steps are involved: (1) pre-treating the gold electrode to obtain a pre-treated gold electrode; (2) Modifying DNA2 on the surface of the pretreated gold electrode to obtain DNA2@AuE; (3) reacting the CIP aptamer with DNA1 to prepare the ligand / DNA1 duplex, and then adding different concentrations of CIP to generate the CIP-aptamer complex; (4) adding H1, H2 and Exo III to the CIP-aptamer complex prepared in step (3) for incubation, inactivating Exo III after the incubation, and adding the Cas12a / crRNA binary complex to prepare a Cas12a / crRNA / DNA activation chain ternary complex; (5) DNA2@AuE was incubated with the Cas12a / crRNA / DNA activation chain ternary complex, and SA-HRP was added and incubated again. Finally, the mixture was immersed in TMB colorimetric solution for electrochemical measurement and the electrochemical signal was recorded.

4. The use according to claim 3, characterized in that: When the concentration range of CIP was 0.064 ng / mL to 1000 ng / mL, the current value decreased with the increase of CIP concentration; the change of current value was linearly related to the logarithmic value of CIP concentration; The linear correlation equation is y = 0.296x + 0.820, and the regression coefficient is 0.997; Where y is the change in current value, and x represents the logarithmic value of CIP concentration; according to the 3σ rule (S / N=3), the detection limit (LOD) was calculated to be 0.022 ng / mL.

5. The use according to claim 3, characterized in that: The sequence of the DNA1 is GATTACGATTGTACGTATCATTTTTT; the concentration of the DNA1 is 50nM to 300nM.

6. The use according to claim 3, characterized in that: The sequence of H1 is: CCCATCAGGGGGCTAGGCTACTTTGCTAGCCTAGCCCCCTGATGGGCG TACAATCGTAATC; The sequence of H2 is: CCCATCAGGGGGCTAGGCTACTTTGCTAGCCTAGCCCCCTGATGGGTA GCCTAGCCC.

7. The use according to claim 3, characterized in that: The incubation time for adding SA-HRP is 5 to 25 minutes.

8. The use according to claim 7, characterized in that: The incubation time after adding SA-HRP was 20 min.

9. The use according to claim 3, characterized in that: The concentration of Exo III added was 0.14U / μL; the action time was 60min.

10. The use according to claim 3, characterized in that: The trans-cleavage time of CRISPR-Cas12a is 40 minutes.

Images