Antibodies against ENPP3 and uses thereof

Abstract

Provided herein are antibodies against ENPP3 and uses thereof, in particular monoclonal antibodies against ENPP3, bispecific antibodies against ENPP3 and CD3, nucleic acids comprising nucleotide sequences encoding the antibodies, vectors comprising the nucleic acids, and host cells comprising the nucleic acids or vectors. Also disclosed are pharmaceutical compositions and conjugates comprising the antibodies, as well as the use of the antibodies in the preparation of medicaments.

Description

Technical Field

[0001] The present invention relates to antibodies against ENPP3, and uses of such antibodies, in particular their use in cancer treatment. Background Art

[0002] Ectonucleotide pyrophosphatase / phosphodiesterase 3 (ENPP3, also known as CD203c) is a 150 kDa protein that belongs to a family of exoenzymes that hydrolyze extracellular pyrophosphate or phosphodiester bonds and intracellular nucleotides involved in glycosyltransferase activity. These exoenzymes have ATPase and ATP pyrophosphatase activities and are type II transmembrane proteins.

[0003] Previous studies have shown that ENPP3 has functional relevance in a variety of biological processes such as endometrial receptivity and embryo implantation. ENPP3 is upregulated in neoplastic mast cells in the context of mastocytosis, in acute basophilic leukemia, and in bile duct tumor cells. More notably, ENPP3 has been found to play an important role in tumor development and invasion.

[0004] ENPP3 is expressed in a variety of organs and cell types, including epithelial cells, mucosal surfaces, especially basophils and mast cells. Compared with the restricted expression in normal tissues, ENPP3 is highly expressed in subpopulations of renal cell carcinoma (RCC) and hepatocellular carcinoma (HCC). The expression pattern of ENPP3 shows potential for tumor therapy. SUMMARY OF THE INVENTION

[0006] The present disclosure provides novel antibodies or antigen-binding fragments thereof targeting ENPP3, which may be in the form of monoclonal antibodies or bispecific antibodies, such as bispecific T cell engagers (BiTEs). A variety of functional assays have demonstrated the potent anti-tumor effects of the antibodies.

[0007] In one aspect, the present disclosure provides an antibody or an antigen-binding fragment thereof that specifically binds to ENPP3, comprising a light chain variable region (VL) and a heavy chain variable region (VH), wherein VL comprises LCDR 1-3 having amino acid sequences as shown in SEQ ID NOs: 1-3, respectively, and VH comprises HCDR 1-3 having amino acid sequences as shown in SEQ ID NOs: 6-8, respectively.

[0008] In some embodiments of the antibodies or antigen-binding fragments thereof disclosed herein, VL comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 4, and VH comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 9. In some embodiments, VL comprises the amino acid sequence as set forth in SEQ ID NO: 4 and VH comprises the amino acid sequence as set forth in SEQ ID NO: 9.

[0009] In some embodiments, the antibody is of an isotype selected from the group consisting of IgG, IgA, IgM, IgE, and IgD. In some embodiments, the antibody is of a subtype selected from the group consisting of IgG1, IgG2, IgG3, and IgG4.

[0010] In some embodiments, the antigen binding fragment may be selected from the group consisting of Fab, Fab', F(ab')2, Fv, scFv and ds-scFv.

[0011] In some embodiments, the antibody can be a monoclonal antibody. In some embodiments, the antibody comprises a light chain and a heavy chain, the light chain comprising an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 5, and the heavy chain comprising an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 10.

[0012] In other embodiments, the antibody can be a bispecific antibody or a multispecific antibody. In some embodiments, the antibody can be a bispecific antibody further comprising a second antigen binding region that is bound to a second antigen. In some embodiments, the second antigen can be a tumor-associated antigen or an immune cell antigen. In some embodiments, the second antigen can be a T cell antigen. In some embodiments, the T cell antigen can be selected from the group consisting of T cell receptor (TCR), CD3, CD4, CD8, CD16, CD25, CD28, CD38, CD44, CD62L, CD69, ICOS, 41-BB (CD137) and NKG2D.

[0013] In some embodiments, the second antigen is CD3, and the second antigen binding region comprises VL and VH, wherein VL comprises LCDR 1-3 having the amino acid sequences shown in SEQ ID NOs: 11-13, respectively, and VH comprises HCDR 1-3 having the amino acid sequences shown in SEQ ID NOs: 16-18, respectively.

[0014] In some embodiments, the second antigen-binding region comprises a VL and a VH, wherein the VL comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 14, and the VH comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 19. In some embodiments, the second antigen-binding region comprises a VL and a VH, wherein the VL comprises the amino acid sequence as shown in SEQ ID NO: 14, and the VH comprises the amino acid sequence as shown in SEQ ID NO: 19.

[0015] In some embodiments, the VL of the second antigen binding region is optionally linked to the C-terminus of the VL of an antibody that specifically binds to ENPP3 via a first linker, and the VH of the second antigen binding region is optionally linked to the C-terminus of the VH of an antibody that specifically binds to ENPP3 via a second linker, wherein the first linker and the second linker are the same or different.

[0016] In some embodiments, the first linker and the second linker each independently comprise an amino acid sequence selected from SEQ ID NO: 21 (GSGGGGSGGGGS) and SEQ ID NO: 22 (GSGGSGGGGSGGGGS). In some embodiments, the first linker comprises the amino acid sequence as shown in SEQ ID NO: 21 (GSGGGGSGGGGS), and the second linker comprises the amino acid sequence as shown in SEQ ID NO: 22 (GSGGSGGGSGGGGS).

[0017] In some embodiments, the bispecific antibody comprises a light chain comprising an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:15, and a heavy chain comprising an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:20.

[0018] In some embodiments, the bispecific antibody is a bispecific T cell engager (BiTE).

[0019] In another aspect, the present disclosure provides a bispecific antibody or an antigen-binding fragment thereof, comprising a first antigen-binding region comprising VL and VH that binds to ENPP3 and a second antigen-binding region comprising VL and VH that binds to CD3, wherein the VL of the first antigen-binding region comprises LCDR 1-3 having the amino acid sequences shown in SEQ ID NOs: 1-3, respectively, and the VH of the first antigen-binding region comprises HCDR 1-3 having the amino acid sequences shown in SEQ ID NOs: 6-8, respectively; and the VL of the second antigen-binding region comprises LCDR 1-3 having the amino acid sequences shown in SEQ ID NOs: 11-13, respectively, and the VH of the second antigen-binding region comprises HCDR 1-3 having the amino acid sequences shown in SEQ ID NOs: 16-18, respectively.

[0020] In some embodiments of the bispecific antibodies or antigen-binding fragments thereof disclosed herein, the VL of the first antigen-binding region comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:4, and the VH of the first antigen-binding region comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:9; and the VL of the second antigen-binding region comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:14, and the VH of the second antigen-binding region comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:19.

[0021] In some embodiments, the VL of the first antigen binding region comprises the amino acid sequence shown in SEQ ID NO:4 and the VH of the first antigen binding region comprises the amino acid sequence shown in SEQ ID NO:9; and the VL of the second antigen binding region comprises the amino acid sequence shown in SEQ ID NO:14 and the VH of the second antigen binding region comprises the amino acid sequence shown in SEQ ID NO:19.

[0022] In some embodiments, the VL of the second antigen binding region is optionally linked to the C-terminus of the VL of the first antigen binding region via a first linker, and the VH of the second antigen binding region is optionally linked to the C-terminus of the VH of the first antigen binding region via a second linker, wherein the first linker and the second linker are the same or different.

[0023] In some embodiments, the first linker and the second linker each independently comprise an amino acid sequence selected from SEQ ID NO: 21 (GSGGGGSGGGGS) and SEQ ID NO: 22 (GSGGSGGGGSGGGGS). In some embodiments, the first linker comprises the amino acid sequence as shown in SEQ ID NO: 21 (GSGGGGSGGGGS), and the second linker comprises the amino acid sequence as shown in SEQ ID NO: 22 (GSGGSGGGSGGGGS).

[0024] In some embodiments, the bispecific antibody comprises a light chain comprising an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:15, and a heavy chain comprising an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:20.

[0025] In some embodiments, the bispecific antibody may be a bispecific T cell engager (BiTE).

[0026] In yet another aspect, the present disclosure provides a nucleic acid comprising a nucleotide sequence encoding an antibody or antigen-binding fragment thereof disclosed herein or a bispecific antibody or antigen-binding fragment thereof disclosed herein.

[0027] In another aspect, the present disclosure provides a vector comprising a nucleic acid disclosed herein.

[0028] In another aspect, the present disclosure provides a host cell comprising a nucleic acid disclosed herein or a vector disclosed herein.

[0029] In another aspect, the present disclosure provides a pharmaceutical composition comprising (i) an antibody or antigen-binding fragment thereof disclosed herein, or a bispecific antibody or antigen-binding fragment thereof disclosed herein, and (ii) a pharmaceutically acceptable carrier or excipient.

[0030] In some embodiments of the pharmaceutical composition disclosed herein, the pharmaceutical composition further comprises a second therapeutic agent. In some embodiments, the second therapeutic agent may be selected from antibodies, chemotherapeutic agents and small molecule drugs. In some embodiments, the second therapeutic agent may be selected from Bruton's tyrosine kinase (BTK) inhibitors, PI3K inhibitors, HDAC inhibitors, ERK inhibitors, MAPK inhibitors, PD-1 / PD-L1 inhibitors, LAG3 inhibitors, CTLA-4 inhibitors, TIGIT inhibitors, TIM3 inhibitors and glucocorticoids.

[0031] In yet another aspect, the present disclosure provides a conjugate comprising an antibody or antigen-binding fragment thereof disclosed herein or a bispecific antibody or antigen-binding fragment thereof disclosed herein, and a chemical moiety conjugated thereto.

[0032] In some embodiments of the conjugates disclosed herein, the chemical moiety can be selected from the group consisting of a therapeutic agent, a detectable moiety, and an immunostimulatory molecule.

[0033] In another aspect, the present disclosure provides a method of treating cancer in a subject, the method comprising administering to the subject an effective amount of an antibody or antigen-binding fragment thereof disclosed herein, a bispecific antibody or antigen-binding fragment thereof disclosed herein, a pharmaceutical composition disclosed herein, or a conjugate disclosed herein.

[0034] In some embodiments of the methods disclosed herein, the cancer is an ENPP3-positive cancer. In some embodiments, the cancer can be selected from the group consisting of mastocytosis, leukemia, renal cancer, lung cancer, gastric cancer, ovarian cancer, breast cancer, pancreatic cancer, colon cancer, colorectal cancer, bile duct cancer, liver cancer, and Wilms' tumor.

[0035] In some embodiments, the method further includes administering a second therapeutic agent to the subject. In some embodiments, the second therapeutic agent can be selected from antibodies, chemotherapeutic agents and small molecule drugs. In some embodiments, the second therapeutic agent can be selected from Bruton's tyrosine kinase (BTK) inhibitors, PI3K inhibitors, HDAC inhibitors, ERK inhibitors, MAPK inhibitors, PD-1 / PD-L1 inhibitors, LAG3 inhibitors, CTLA-4 inhibitors, TIGIT inhibitors, TIM3 inhibitors and glucocorticoids.

[0036] In another aspect, the present disclosure provides the use of an antibody or antigen-binding fragment thereof disclosed herein, a bispecific antibody or antigen-binding fragment thereof disclosed herein, a pharmaceutical composition disclosed herein, or a conjugate disclosed herein in the preparation of a medicament for treating cancer in a subject. In some embodiments, the cancer is an ENPP3-positive cancer. In some embodiments, the cancer can be selected from the group consisting of mastocytosis, leukemia, renal cancer, lung cancer, gastric cancer, ovarian cancer, breast cancer, pancreatic cancer, colon cancer, colorectal cancer, bile duct cancer, liver cancer, and Wilms' tumor.

[0037] In another aspect, the present disclosure provides an antibody or antigen-binding fragment thereof disclosed herein, a bispecific antibody or antigen-binding fragment thereof disclosed herein, a pharmaceutical composition disclosed herein, or a conjugate disclosed herein for treating cancer in a subject. In some embodiments, the cancer is an ENPP3-positive cancer. In some embodiments, the cancer can be selected from the group consisting of mastocytosis, leukemia, renal cancer, lung cancer, gastric cancer, ovarian cancer, breast cancer, pancreatic cancer, colon cancer, colorectal cancer, bile duct cancer, liver cancer, and Wilms' tumor. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] An understanding of the features and advantages of the present invention will be gained by reference to the following detailed description of exemplary embodiments and accompanying drawings which illustrate exemplary embodiments utilizing the principles of the invention:

[0039] Figure 1 Binding of Fab 3A10 to recombinant human ENPP3 measured by ELISA is shown. BS A was used as a negative control.

[0040] Figure 2 Shown is the binding of 3A10 mAb to recombinant human ENPP3 measured by ELISA.

[0041] Figure 3A Shown is the binding of 3A10 mAb to the ENPP3-positive cancer cell line SK-Nep-1 measured by flow cytometry. An IgG4 isotype antibody was used as a negative control.

[0042] Figure 3B Binding of 3A10 mAb to LS174T-ENPP3 cells stably expressing ENPP3 as measured by flow cytometry is shown. An IgG4 isotype antibody was used as a negative control.

[0043] Figure 4 The ADCC killing effect of 3A10 mAb on HepG2 cells in the presence of NK cells is shown. IgG4 isotype antibody was used as a negative control.

[0044] Figure 5AShown is the binding of CMD016 to recombinant human ENPP3 measured by ELISA.

[0045] Figure 5B Shown is the binding of CMD016 to recombinant human CD3 measured by ELISA.

[0046] Fig. 6A The binding of CMD016 to the ENPP3-positive cancer cell line SK-Nep-1 measured by flow cytometry is shown. An IgG4 isotype antibody was used as a negative control.

[0047] Figure 6B Binding of CMD016 to CD3-positive Jurkat cells measured by flow cytometry is shown. An IgG4 isotype antibody was used as a negative control.

[0048] Figure 7 Shown is the killing effect of CMD016 on LS174T-ENPP3 cells stably expressing ENPP3 in the presence of human PBMCs. The ENPP3 negative LS174T cell line was used as a negative control.

[0049] Figure 8 Serum CMD016 concentrations of CMD016-treated mice at 24 hours, 48 ​​hours, 72 hours, and 96 hours after treatment are shown.

[0050] Fig.9A Shown are tumor volumes of mice treated with 33.3 μg / kg, 100 μg / kg, and 300 μg / kg CMD016. Mice treated with PBS served as negative controls.

[0051] Fig. 9B Body weights of mice treated with 33.3 μg / kg, 100 μg / kg and 300 μg / kg CMD016 are shown. Mice treated with PBS served as negative controls.

[0052] Fig. 9C Shown are tumor weights of mice treated with 33.3 μg / kg, 100 μg / kg, and 300 μg / kg CMD016. Mice treated with PBS served as negative controls. DETAILED DESCRIPTION OF THE INVENTION

[0054] The above features and advantages of the present invention and additional features and advantages will be more clearly understood hereinafter through detailed description of the following embodiments in conjunction with the accompanying drawings.

[0055] The embodiments described herein with reference to the accompanying drawings are illustrative, exemplary, and are used for a general understanding of the present invention. The embodiments should not be construed as limiting the scope of the present invention. The same or similar elements and elements with the same or similar functions are represented by the same reference numerals throughout the specification.

[0056] Unless otherwise mentioned or defined, all terms used have their ordinary meanings in the art that are clear to those skilled in the art. For example, refer to standard manuals, such as Leuenberger, HGW, Nagel, B. and Klbl, H.eds., "Amultilingual glossary of biotechnological terms: (IUPAC Recommendations)", Helvetica Chimica Acta (1995), CH-4010 Basel, Switzerland; Sambrook et al, "Molecular Cloning: A Laboratory Manual" (2nd Ed.), Vols.1-3, Cold Spring Harbor Laboratory Press (1989); F. Ausubel et al, eds., "Current protocols in molecularbiology", Green Publishing and Wiley InterScience, New York (1987); Roitt et al., "Immunology (6th Ed.), Mosby / Elsevier, Edinburgh (2001); and Janeway et al. al.,"Immunobiology"(6th Ed.),Garland Science Publishing / Churchill Livingstone, New York (2005), and the general background art cited above.

[0057] As used herein, the singular forms "a", "an", and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "an antibody" includes a plurality of antibodies and in some embodiments reference to "an antibody" includes a plurality of antibodies, and so forth.

[0058] Unless otherwise stated or defined, the term “comprise” and variations such as “include” and “comprising” will be understood to mean the inclusion of stated elements or steps or groups of elements or steps but not the exclusion of any other elements or steps or groups of elements or steps.

[0059] As used herein, the term "antibody" refers to an immunoglobulin molecule that has the ability to specifically bind to a specific antigen. Antibodies generally contain a variable region and a constant region in each heavy chain and light chain. The variable regions of the antibody heavy and light chains contain a binding domain that interacts with the antigen. The constant region of the antibody can mediate the binding of the immunoglobulin to host tissues or factors, which include various cells of the immune system (such as effector cells) and components of the complement system such as C1q (the first component in the classical pathway of complement activation). Therefore, most antibodies have a heavy chain variable region (VH) and a light chain variable region (VL) that together form the antibody portion that binds to the antigen.

[0060] A "light chain variable region" (VL) or "heavy chain variable region" (VH) consists of a "framework" region separated by three "complementarity determining regions" or "CDRs". The framework region is used to align the CDRs that specifically bind to an antigenic epitope. The CDRs include the amino acid residues in the antibody that are primarily responsible for antigen binding. Both the VL domain and the VH domain contain the following framework regions (FRs) and CDR regions from the amino terminus to the carboxyl terminus: FR1, CDR1, FR2, CDR2, FR3, CDR3, and FR4. The CDR1, CDR2, and CDR3 of the VL domain are also referred to herein as LCDR1, LCDR2, and LCDR3, respectively; the CDR1, CDR2, and CDR3 of the VH domain are also referred to herein as HCDR1, HCDR2, and HCDR3, respectively.

[0061] The amino acid arrangement of each VL domain and VH domain is consistent with any conventional definition of CDR. Conventional definitions include the Kabat definition (Kabat, Sequences of Proteins of Immunological Interest (National Institutes of Health, Bethesda, MD, 1987 and 1991), Chothia definition (Chothia & Lesk, J. Mol. Biol. 196: 901-917, 1987; Chothia et al., Nature 342: 878-883, 1989); a composite of the Chothia Kabat CDRs, wherein CDR-H1 is a composite of the Chothia CDRs and the Kabat CDRs; the AbM definition used by Oxford Molecular's antibody modeling software; and the CONTACT definition of Martin et al. (world wide webbioinfo.org.uk / abs). Kabat provides a widely used numbering convention (the Kabat numbering system), in which corresponding residues between different heavy chains or between different light chains are assigned the same number. The present disclosure may use CDRs defined according to any of these numbering systems, but preferred embodiments use CDRs defined by Kabat.

[0062] As used herein, the term "antibody" should be understood in its broadest sense and includes monoclonal antibodies (including full-length monoclonal antibodies), polyclonal antibodies, antibody fragments, and multispecific antibodies (e.g., bispecific antibodies) containing at least two antigen-binding regions. The antibody may contain additional modifications, such as non-naturally occurring amino acids, mutations in the Fc region, and mutations in glycosylation sites. Antibodies also include post-translationally modified antibodies, fusion proteins containing antigenic determinants of antibodies, and immunoglobulin molecules containing any other modifications to the antigen recognition site, as long as these antibodies exhibit the desired biological activity.

[0063] As used herein, the term "antigen-binding fragment" of an antibody refers to one or more fragments of an antibody that retain the ability to specifically bind to an antigen (eg, ENPP3 protein). It has been shown that the antigen-binding function of an antibody can be performed by fragments of a full-length antibody.

[0064] Examples of antigen-binding fragments encompassed within the term "antigen-binding portion" of an antibody include (i) a Fab fragment, a monovalent fragment consisting of the VL, VH, CL and CH1 domains; (ii) a F(ab')2 fragment, a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region; (iii) a Fab' fragment, which is essentially a Fab with a portion of the hinge region (see, FUNDAMENTAL IMMUNOLOGY (Paul ed., 3.sup.rd ed. 1993); (iv) a Fd fragment, which consists of the VH and CH1 domains; (v) a Fd' fragment, which has the VH and CH1 domains and one or more cysteine ​​residues at the C-terminus of the CH1 domain; (vi) a Fv fragment, which consists of the VL and VH domains of a single arm of an antibody; (vii) a dAb fragment (Ward et al., (1989) Nature 341:544-546), which consists of a VH domain; (viii) an isolated complementarity determining region (CDR); and (ix) a nanobody, a heavy chain variable region containing a single variable domain and two constant domains. In addition, although the two domains of the Fv fragment, VL and VH, are encoded by separate genes, they can be linked together using recombinant methods via synthetic linkers, enabling them to be made into a single protein chain in which the VL and VH regions pair to form a monovalent molecule (referred to as single-chain Fv (scFv); see, e.g., Bird et al. (1988) Science 242:423-426; and Huston et al. (1993) Science 243:424-426; and Huston et al. (2001) Science 244:425-426). al. (1988) Proc. Natl. Acad. Sci. USA 85: 5879-5883). Such single-chain antibodies are also intended to be encompassed within the term "antigen-binding fragment" of an antibody. In addition, the term also includes "straight-chain antibodies" comprising a pair of tandem Fd fragments (VH-CH1-VH-CH1), which together with complementary light chain polypeptides and modified forms of any of the aforementioned fragments that retain antigen-binding activity form an antigen-binding region.

[0065] These antigen-binding fragments can be obtained using conventional techniques known to those with skill in the art, and the fragments screened for utility in the same manner as are intact antibodies.

[0066] As used herein, the term "binding" or "specific binding" refers to a non-random binding reaction between two molecules, such as an antibody and its target antigen. The binding specificity of an antibody can be determined based on affinity and / or avidity. Avidity represents the equilibrium constant (KD) for the dissociation of an antigen from an antibody and is a measure of the binding strength between an antigenic determinant and an antigen binding site of an antibody: the smaller the value of KD, the stronger the binding strength between an antigenic determinant and an antibody. Alternatively, affinity can also be expressed as an affinity constant (KA), which is 1 / KD.

[0067] Avidity is a measure of the strength of binding between an antibody and its associated antigen. Avidity is related to the affinity between an antigenic determinant and its antigen binding site on the antibody and the number of associated binding sites present on the antibody. Typically, an antibody will bind to an antigen with the following dissociation constant (KD): 10 -5 M to 10 -12 M or less, and preferably 10 -7 M to 10 -12 M or less, and more preferably 10 -8 M to 10 -12 M, and / or have a binding affinity of at least 10 7 M -1 , preferably at least 10 8 M -1 , more preferably at least 10 9 M -1 , such as at least 10 12 M -1 It is generally believed that any value greater than 10 -4 M of K D The value represents non-specific binding. Specific binding of an antibody to an antigen or antigenic determinant can be determined in any known suitable manner, including, for example, Scatchard analysis and / or competitive binding assays, such as radioimmunoassay (RIA), enzyme immunoassay (EIA), and sandwich competition assays, and different variations thereof known in the art.

[0068] The term "epitope" refers to the site on an antigen to which an antibody binds. An epitope can be formed by continuous amino acids or by non-continuous amino acids juxtaposed by the tertiary folding of one or more proteins. Epitopes formed by continuous amino acids (also referred to as linear epitopes) are usually retained in the exposure to denaturing solvents, while epitopes formed by tertiary folding (also referred to as conformational epitopes) are usually lost in the treatment of denaturing solvents. An epitope typically includes at least 3, more typically at least 5 or 8-10 amino acids in a unique spatial conformation. An epitope defines the minimum binding site of an antibody and is therefore a specific target of an antibody or its antigen-binding fragment.

[0069] As used herein, the term "sequence identity" refers to the extent to which two sequences (amino acids) have identical residues at identical positions after alignment. For example, "an amino acid sequence is X% identical to SEQ ID NO: Y" refers to the % identity of the amino acid sequence to SEQ ID NO: Y, and is described as X% of the residues in the amino acid sequence being identical to the residues of the sequence disclosed in SEQ ID NO: Y.

[0070] Such calculations are typically performed using computer programs. Exemplary programs for comparing and aligning sequence pairs include ALIGN (Myers and Miller, 1988), FASTA (Pearson and Lipman, 1988; Pearson, 1990), and gapped BLAST (Altschul et al., 1997), BLASTP, BLASTN, or GCG (Devereux et al., 1984).

[0071] In addition, when determining the degree of sequence identity between two amino acid sequences, the skilled person may consider so-called "conservative" amino acid substitutions, which can generally be described as amino acid substitutions in which an amino acid residue is replaced with another amino acid residue of similar chemical structure, which has little or substantially no effect on the function, activity or other biological properties of the polypeptide. Such conservative amino acid substitutions are well known in the art, for example from WO 04 / 037999, GB-A-2 357 768, WO 98 / 49185, WO 00 / 46383 and WO 01 / 09300; and the (preferred) types and / or combinations of such substitutions can be selected according to the relevant teachings from WO 04 / 037999 and WO 98 / 49185 and the further references cited therein.

[0072] Such conservative substitutions are preferably substitutions in which one amino acid from the following groups (a) to (e) is replaced by another amino acid residue from the same group: (a) small aliphatic, non-polar or weakly polar residues: Ala, Ser, Thr, Pro and Gly; (b) polar, negatively charged residues and their (uncharged) amides: Asp, Asn, Glu and Gln; (c) polar, positively charged residues: His, Arg and Lys; (d) large aliphatic, non-polar residues: Met, Leu, Ile, Val and Cys; and (e) aromatic residues: Phe, Tyr and Trp.

[0073] Particularly preferred conservative substitutions are as follows: Ala to Gly or to Ser; Arg to Lys; Asn to Gln or to His; Asp to Glu; Cys to Ser; Gln to Asn; Glu to Asp; Gly to Ala or to Pro; His to Asn or to Gln; Ile to Leu or to Val; Leu to Ile or to Val; Lys to Arg, to Gln or to Glu; Met to Leu, to Tyr or to Ile; Phe to Met, to Leu or to Tyr; Ser to Thr; Thr to Ser; Trp to Tyr; Tyr to Trp; and / or Phe to Val, to Ile or to Leu.

[0074] Any amino acid substitutions described herein applied to polypeptides may also be based on an analysis of the frequency of amino acid variations between homologous proteins from different species developed by Schulz et al., Principles of Protein Structure, Springer-Verlag, 1978, an analysis of structure-forming potential developed by Chou and Fasman, Biochemistry 13:211, 1974, and Adv. Enzymol., 47:45-149, 1978, and an analysis of protein hydrophobicity patterns developed by Eisenberg et al., Proc. Nat. Acad Sci. USA 81:140-144, 1984; Kyte & Doolittle, J Mol. Biol. 157:105-132, 1981, and Goldman et al., Ann. Rev. Biophys. Chem. 15:321-353, 1986, all of which are incorporated herein by reference in their entirety.

[0075] As used herein, the term "monoclonal antibody" refers to an antibody obtained from a substantially homogeneous antibody population. That is, except for a small amount of mutations that may occur naturally, each antibody constituting the population is identical. Monoclonal antibodies are highly specific and are directed against a single antigen. The term "monoclonal antibody" herein is not limited to antibodies produced by hybridoma technology, nor should it be construed as requiring antibodies produced by any particular method.

[0076] The term "bispecific antibody" in the context of the present invention is understood to mean an antibody having two different antigen binding regions defined by different antibody sequences. This can be understood as binding to different targets, but also includes binding to different epitopes of one target.

[0077] As used herein, the term "tumor-associated antigen" refers to an antigen that is differentially expressed in cancer cells compared to normal cells, and thus can be used to target cancer cells.

[0078] As used herein, the term "CD3" refers to a human CD3 protein complex having five peptide chains, γ chain, δ chain, ε chain, ζ chain and η chain, and associated with T cell receptor α and β chains to form a TCR-CD3 complex. The term includes any CD3 variants, subtypes and species homologs, which may be naturally expressed by cells including T cells, or expressed on cells transfected with genes or cDNAs encoding the above chains.

[0079] As used herein, the term "bispecific T cell engager" or "BiTE" refers to a polypeptide chain molecule having two antigen binding domains, one of which binds to a T cell antigen and the second binds to an antigen presented on the surface of a target cell (see, PCT Publication WO 05 / 061547; Baeuerle et al., 2008, Drugs of the Future 33:137-147; Bargou, et al., 2008, Science 321:974-977, which are incorporated herein by reference in their entirety). Thus, the BiTE of the present disclosure has an antigen binding region that binds to ENPP3 and a second antigen binding region directed to a T cell antigen.

[0080] As used herein, the term "vector" is intended to refer to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked.

[0081] As used herein, the term "host cell" refers to a cell into which an expression vector has been introduced.

[0082] The term "pharmaceutically acceptable" means that the carrier or adjuvant is compatible with the other ingredients of the composition and not substantially toxic to the recipient thereof, and / or such carrier or adjuvant is approved or approvable for inclusion in pharmaceutical compositions for parenteral administration to humans.

[0083] As used herein, the terms "treat", "treatment" and the like refer to the administration of an agent or the performance of a procedure for the purpose of obtaining an effect. These effects may be preventive in terms of preventing a disease or its symptoms in whole or in part, and / or may be therapeutic in terms of achieving a partial or complete cure of a disease and / or disease symptoms. As used herein, "treatment" may include the treatment of a disease or condition (e.g., cancer) in a mammal, particularly a human, and includes: (a) preventing the occurrence of a disease or disease symptom in a subject who may be susceptible to the disease (e.g., including a disease that may be associated with or caused by a primary disease) but has not yet been diagnosed with the disease; (b) inhibiting the disease, i.e., preventing its development; and (c) alleviating the disease, i.e., causing regression of the disease. Treatment may refer to any indicator of success in the treatment or improvement or prevention of cancer, including any objective or subjective parameter, such as a reduction in symptoms; relief; elimination or making the disease condition more tolerable to the patient; slowing the rate of deterioration or decline; or reducing the debilitation of the final node of deterioration. The treatment or improvement of symptoms is based on one or more objective or subjective parameters; including the results of a doctor's examination. Thus, the term "treatment" includes the administration of an antibody or composition or conjugate disclosed herein to prevent or delay, alleviate, or stop or inhibit the development of symptoms or conditions associated with a disease (e.g., cancer). The term "therapeutic effect" refers to the reduction, elimination or prevention of a disease, disease symptom, or disease side effect in a subject.

[0084] As used herein, the term "effective amount" refers to an amount that, when administered to a subject for treating a disease, is sufficient to effect treatment for the disease.

[0085] As used herein, the term "subject" refers to any mammalian subject for whom diagnosis, treatment, or therapy is desired. "Mammal" for therapeutic purposes refers to any animal classified as a mammal, including humans, livestock and farm animals, and laboratory, zoo, sports, or pet animals, such as dogs, horses, cats, cows, sheep, goats, pigs, mice, rats, rabbits, guinea pigs, monkeys, and the like.

[0086] In one aspect, the present disclosure provides an antibody or an antigen-binding fragment thereof that specifically binds to ENPP3, comprising a light chain variable region (VL) and a heavy chain variable region (VH), wherein VL comprises LCDR 1-3 having amino acid sequences as shown in SEQ ID NOs: 1-3, respectively, and VH comprises HCDR 1-3 having amino acid sequences as shown in SEQ ID NOs: 6-8, respectively.

[0087] In some embodiments, CDR sequences are defined according to the Kabat numbering system.

[0088] When the CDR sequences are defined according to the Kabat numbering system, the VL of the antibody disclosed herein comprises LCDR1, LCDR2 and LCDR3 having amino acid sequences as shown in SEQ ID NO: 1 (SGSSSNIGNNYVS), SEQ ID NO: 2 (DNNKRPS) and SEQ ID NO: 3 (GVWDSSLRAEL), respectively, and the VH of the antibody disclosed herein comprises HCDR1, HCDR2 and HCDR3 having amino acid sequences as shown in SEQ ID NO: 6 (NAWMS), SEQ ID NO: 7 (YISSSGSTIYYADSVKG) and SEQ ID NO: 8 (LAGPYYFDY), respectively.

[0089] In some embodiments of the antibodies or antigen-binding fragments thereof disclosed herein, VL comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:4, and VH comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:9.

[0090] In some embodiments, VL comprises a functional variant of the amino acid sequence as shown in SEQ ID NO: 4, which is formed by inserting, deleting and / or substituting one or more amino acids therein, provided that the functional variant retains the ability to bind to ENPP3. In some embodiments, VH comprises a functional variant of the amino acid sequence as shown in SEQ ID NO: 9, which is formed by inserting, deleting and / or substituting one or more amino acids therein, provided that the functional variant retains the ability to bind to ENPP3.

[0091] A functional variant comprises or consists of an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8% or at least 99.9% sequence identity with the amino acid sequence of the parent polypeptide. For example, a functional variant of SEQ ID NO:4 comprises or consists of an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8% or at least 99.9% sequence identity to SEQ ID NO:4. For example, a functional variant of SEQ ID NO:9 comprises or consists of an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8% or at least 99.9% sequence identity to SEQ ID NO:9.

[0092] In some embodiments, the functional variant of SEQ ID NO:4 comprises or consists of an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8% or at least 99.9% sequence identity with SEQ ID NO:4, and is formed by insertion, deletion and / or substitution of one or more amino acids in SEQ ID NO:4. In some embodiments, the functional variant of SEQ ID NO:9 comprises or consists of an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8% or at least 99.9% sequence identity with SEQ ID NO:9 and is formed by insertion, deletion and / or substitution of one or more amino acids in SEQ ID NO:9.

[0093] In the context of functional variants, the number of inserted, deleted and / or substituted amino acids is preferably no more than 40% of the total number of amino acids in the parent amino acid sequence, more preferably no more than 35%, more preferably 1% to 33%, and more preferably 5% to 30%, more preferably 10% to 25%, more preferably 15% to 20%. For example, the number of inserted, deleted and / or substituted amino acids can be 1 to 20, preferably 1 to 10, more preferably 1 to 7, still more preferably 1 to 5, and most preferably 1 to 2. In preferred embodiments, the number of inserted, deleted and / or substituted amino acids is 1, 2, 3, 4, 5, 6 or 7.

[0094] In some embodiments, insertions, deletions and / or substitutions may be made in the framework (FR) regions, such as in FR1, FR2, FR3 and / or FR4.

[0095] In some embodiments, the substitution of one or more amino acids can be a conservative substitution of one or more amino acids. Such conservative substitutions are preferably substitutions in which one amino acid in the following groups (a) to (e) is substituted by another amino acid residue in the same group: (a) small aliphatic, nonpolar or weakly polar residues: Ala, Ser, Thr, Pro and Gly; (b) polar, negatively charged residues and their (uncharged) amides: Asp, Asn, Glu and Gln; (c) polar, positively charged residues: His, Arg and Lys; (d) large aliphatic, nonpolar residues: Met, Leu, Ile, Val and Cys; and (e) aromatic residues: Phe, Tyr and Trp.

[0096] Particularly preferred conservative substitutions are as follows: Ala to Gly or to Ser; Arg to Lys; Asn to Gln or to His; Asp to Glu; Cys to Ser; Gln to Asn; Glu to Asp; Gly to Ala or to Pro; His to Asn or to Gln; Ile to Leu or to Val; Leu to Ile or to Val; Lys to Arg, to Gln or to Glu; Met to Leu, to Tyr or to Ile; Phe to Met, to Leu or to Tyr; Ser to Thr; Thr to Ser; Trp to Tyr; Tyr to Trp; and / or Phe to Val, to Ile or to Leu.

[0097] In a preferred embodiment, VL comprises the amino acid sequence shown in SEQ ID NO:4 and VH comprises the amino acid sequence shown in SEQ ID NO:9.

[0098] Based on the amino acid sequence of the constant region of the heavy chain of the antibody, immunoglobulin molecules can be divided into five classes (isotypes): IgA, IgD, IgE, IgG and IgM, and can be further divided into different subtypes, such as IgG1, IgG2, IgG3, IgG4, IgA1, IgA2, etc. Based on the amino acid sequence of the light chain, the light chain of the antibody can be classified as lambda (λ) chain and kappa (κ) chain. The antibodies disclosed herein can be any of the above classes or subtypes.

[0099] In some embodiments, the antibody can be an isotype selected from the group consisting of IgG, IgA, IgM, IgE and IgD. In some embodiments, the antibody can be a subtype selected from the group consisting of IgG1, IgG2, IgG3 and IgG4. In a preferred embodiment, the antibody is an IgG1 antibody.

[0100] The antibodies disclosed herein may be complete antibodies or antigen-binding fragments thereof. The antigen-binding fragment may be any fragment of an antibody that retains the ability to specifically bind to ENPP3. Examples of antigen-binding fragments include, but are not limited to: Fab fragments; F(ab')2 fragments; Fab' fragments; Fd fragments; Fd' fragments; Fv fragments; scFv fragments; dAb fragments; isolated complementary determining regions (CDRs); nanobodies; linear antibodies comprising a pair of tandem Fd fragments (VH-CH1-VH-CH1) and modified forms of any of the foregoing fragments that retain antigen-binding activity.

[0101] In some embodiments, the antigen binding fragment can be selected from the group consisting of Fab, Fab', F(ab')2, Fv, scFv and ds-scFv. In a preferred embodiment, the antigen binding fragment is Fab or ScFv. In another preferred embodiment, the antigen binding fragment is Fab.

[0102] In some embodiments, the antibody can be a monoclonal antibody. In some embodiments, the antibody comprises a light chain and a heavy chain, the light chain comprising an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 5, and the heavy chain comprising an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 10.

[0103] In some embodiments, the light chain comprises a functional variant of the amino acid sequence as shown in SEQ ID NO: 5, which is formed by inserting, deleting and / or substituting one or more amino acids therein, provided that the functional variant retains the ability to bind to ENPP3. In some embodiments, the heavy chain comprises a functional variant of the amino acid sequence as shown in SEQ ID NO: 10, which is formed by inserting, deleting and / or substituting one or more amino acids therein, provided that the functional variant retains the ability to bind to ENPP3.

[0104] For example, a functional variant of SEQ ID NO:5 comprises or consists of an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8% or at least 99.9% sequence identity to SEQ ID NO:5. For example, a functional variant of SEQ ID NO: 10 comprises or consists of an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8% or at least 99.9% sequence identity to SEQ ID NO: 10.

[0105] In some embodiments, the number of inserted, deleted and / or substituted amino acids is preferably no more than 40% of the total number of amino acids in the parent amino acid sequence, more preferably no more than 35%, more preferably 1% to 33%, and more preferably 5% to 30%, more preferably 10% to 25%, more preferably 15% to 20%. For example, the number of inserted, deleted and / or substituted amino acids can be 1 to 50, preferably 1 to 20, more preferably 1 to 10, and even more preferably 1 to 5. In preferred embodiments, the number of inserted, deleted and / or substituted amino acids is 1, 2, 3, 4, 5, 6 or 7.

[0106] In some embodiments, insertions, deletions and / or substitutions may be made in the framework (FR) regions, such as FR1, FR2, FR3 and / or FR4; and / or constant regions, such as CL, CH1, CH2 and / or CH3.

[0107] In some embodiments, the substitution of one or more amino acids can be a conservative substitution of one or more amino acids. Examples of conservative substitutions are described above.

[0108] In a preferred embodiment, the light chain comprises the amino acid sequence shown in SEQ ID NO:5 and the heavy chain comprises the amino acid sequence shown in SEQ ID NO:10.

[0109] In other embodiments, the antibody can be a bispecific antibody or a multispecific antibody. In some embodiments, the antibody is a bispecific antibody that further comprises a second antigen binding region that binds to a second antigen. In some embodiments, the second antigen can be a tumor-associated antigen or an immune cell antigen.

[0110] Many tumor-associated antigens related to specific cancers have been identified in the art. In some embodiments, tumor-associated antigens are antigens that can stimulate a significant tumor-specific immune response. Some of these antigens are encoded by normal cells, but are not necessarily expressed by normal cells. These antigens can be characterized as antigens that are usually silent (i.e., not expressed) in normal cells, antigens that are only expressed at certain stages of differentiation, and antigens expressed over time such as embryonic antigens and fetal antigens. Other cancer antigens are encoded by mutant cell genes such as oncogenes (e.g., activated ras oncogenes), suppressor genes (e.g., P53 mutants), and fusion proteins produced by internal deletions or chromosomal translocations. Other cancer antigens can be encoded by genes carried by viral genes such as RNA and DNA tumor viruses. Many other tumor-associated antigens and antibodies against them are known and / or commercially available, and can also be prepared by those skilled in the art.

[0111] Examples of tumor-associated antigens include, but are not limited to, 5T4, alpha-fetoprotein, CA-125, carcinoembryonic antigen, CD19, CD20, CD22, CD23, CD30, CD33, CD40, CD56, CD79, CD78, CD123, CD138, c-Met, CSPG4, IgM, C-type lectin-like molecule 1 (CLL-1), EGFR, EGFRvIII, epithelial tumor antigen, ERBB2, FLT3, folate binding protein, GD2, GD3, HIV-1 envelope glycoprotein gp41, HIV-1 envelope glycoprotein gpl20, melanoma-associated antigen, MUC-1, mutated p53, mutated ras, ROR1, GPC3, VEGFR2, and combinations thereof.

[0112] In some embodiments, the second antigen can be a T cell antigen. In some embodiments, the T cell antigen can be selected from the group consisting of free T cell receptor (TCR), CD3, CD4, CD8, CD16, CD25, CD28, CD38, CD44, CD62L, CD69, ICOS, 41-BB (CD137) and NKG2D or any combination thereof. In some embodiments, the T cell antigen is CD3, and the second antigen binding region is combined with any one of the gamma chains, delta chains, epsilon chains, zeta chains and n chains of CD3.

[0113] In some embodiments, the second antigen is CD3, and the second antigen binding region comprises VL and VH, wherein VL comprises LCDR 1-3 having the amino acid sequences shown in SEQ ID NOs: 11-13, respectively, and VH comprises HCDR 1-3 having the amino acid sequences shown in SEQ ID NOs: 16-18, respectively.

[0114] In some embodiments, the CDR sequence is defined according to the Kabat numbering system. When the CDR sequence defined by Kabat is used, the VL of the second antigen-binding region disclosed herein comprises LCDR1, LCDR2 and LCDR3 having amino acid sequences as shown in SEQ ID NO: 11 (RSSTGAVTTSNYAN), SEQ ID NO: 12 (GANKRAP) and SEQ ID NO: 13 (ALWYSNLWV), respectively, and the VH of the second antigen-binding region disclosed herein comprises HCDR1, HCDR2 and HCDR3 having amino acid sequences as shown in SEQ ID NO: 16 (GFTFNTY), SEQ ID NO: 17 (RSKYNNYA) and SEQ ID NO: 18 (HGNFGSSYVSYFAY), respectively.

[0115] In some embodiments, the second antigen binding region comprises a VL and a VH, wherein the VL comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:14, and the VH comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:19.

[0116] In some embodiments, VL comprises a functional variant of the amino acid sequence as shown in SEQ ID NO: 14, which is formed by inserting, deleting and / or substituting one or more amino acids therein, provided that the functional variant retains the ability to bind to CD3. In some embodiments, VH comprises a functional variant of the amino acid sequence as shown in SEQ ID NO: 19, which is formed by inserting, deleting and / or substituting one or more amino acids therein, provided that the functional variant retains the ability to bind to CD3.

[0117] For example, a functional variant of SEQ ID NO: 14 comprises or consists of an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8% or at least 99.9% sequence identity to SEQ ID NO: 14. For example, a functional variant of SEQ ID NO: 19 comprises or consists of an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8% or at least 99.9% sequence identity with SEQ ID NO: 19.

[0118] In some embodiments, the number of inserted, deleted and / or substituted amino acids is preferably no more than 40% of the total number of amino acids in the parent amino acid sequence, more preferably no more than 35%, more preferably 1% to 33%, and more preferably 5% to 30%, more preferably 10% to 25%, more preferably 15% to 20%. For example, the number of inserted, deleted and / or substituted amino acids can be 1 to 20, preferably 1 to 10, more preferably 1 to 7, still more preferably 1 to 5, and most preferably 1 to 2. In preferred embodiments, the number of inserted, deleted and / or substituted amino acids is 1, 2, 3, 4, 5, 6 or 7.

[0119] In some embodiments, insertions, deletions and / or substitutions may be made in the framework (FR) regions, such as in FR1, FR2, FR3 and / or FR4.

[0120] In some embodiments, the substitution of one or more amino acids can be a conservative substitution of one or more amino acids. Examples of conservative substitutions are described above.

[0121] In a preferred embodiment, the second antigen-binding region comprises VL and VH, wherein the VL comprises the amino acid sequence shown in SEQ ID NO:14, and the VH comprises the amino acid sequence shown in SEQ ID NO:19.

[0122] In some embodiments, the VL of the second antigen binding region is optionally linked to the C-terminus of the VL of an antibody that specifically binds to ENPP3 via a first linker, and the VH of the second antigen binding region is optionally linked to the C-terminus of the VH of an antibody that specifically binds to ENPP3 via a second linker, wherein the first linker and the second linker are the same or different.

[0123] In some embodiments, the first linker and the second linker each independently comprise an amino acid sequence selected from SEQ ID NO: 21 (GSGGGGSGGGGS) and SEQ ID NO: 22 (GSGGSGGGGSGGGGS). In some embodiments, the first linker comprises the amino acid sequence as shown in SEQ ID NO: 21 (GSGGGGSGGGGS), and the second linker comprises the amino acid sequence as shown in SEQ ID NO: 22 (GSGGSGGGGSGGGGS).

[0124] In some embodiments, the bispecific antibody comprises a light chain comprising an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:15, and a heavy chain comprising an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:20.

[0125] In some embodiments, the light chain comprises a functional variant of the amino acid sequence as shown in SEQ ID NO: 15, which is formed by inserting, deleting and / or substituting one or more amino acids therein, provided that the functional variant retains the ability to bind to ENPP3 and CD3. In some embodiments, the heavy chain comprises a functional variant of the amino acid sequence as shown in SEQ ID NO: 20, which is formed by inserting, deleting and / or substituting one or more amino acids therein, provided that the functional variant retains the ability to bind to ENPP3 and CD3.

[0126] For example, a functional variant of SEQ ID NO: 15 comprises or consists of an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8% or at least 99.9% sequence identity to SEQ ID NO: 15. For example, a functional variant of SEQ ID NO:20 comprises or consists of an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8% or at least 99.9% sequence identity with SEQ ID NO:20.

[0127] In some embodiments, the number of inserted, deleted and / or substituted amino acids is preferably no more than 40% of the total number of amino acids in the parent amino acid sequence, more preferably no more than 35%, more preferably 1% to 33%, and more preferably 5% to 30%, more preferably 10% to 25%, more preferably 15% to 20%. For example, the number of inserted, deleted and / or substituted amino acids can be 1 to 50, preferably 1 to 20, more preferably 1 to 10, and even more preferably 1 to 5. In preferred embodiments, the number of inserted, deleted and / or substituted amino acids is 1, 2, 3, 4, 5, 6 or 7.

[0128] In some embodiments, insertions, deletions and / or substitutions may be made in the framework (FR) regions, such as FR1, FR2, FR3 and / or FR4; and / or constant regions, such as CL, CH1, CH2 and / or CH3.

[0129] In some embodiments, the substitution of one or more amino acids can be a conservative substitution of one or more amino acids. Examples of conservative substitutions are described above.

[0130] In a preferred embodiment, the light chain comprises the amino acid sequence shown in SEQ ID NO:15 and the heavy chain comprises the amino acid sequence shown in SEQ ID NO:20.

[0131] In some embodiments, the bispecific antibody can be a bispecific T cell engager (BiTE). In some embodiments of the antibodies or antigen-binding fragments thereof disclosed herein, the bispecific antibody is in the form of HBiTE, as described in PCT Application No. PCT / US2018 / 016524 (which is incorporated herein by reference in its entirety). In HBiTE, the light chain includes an anti-target VL domain, an anti-CD3 VL-CL, and a monomeric human IgG1 Fc (e.g., mFc7.2) from the N-terminus to the C-terminus; and the heavy chain includes an anti-target VH domain, an anti-CD3 VH-CH1, and a monomeric human IgG1 Fc (e.g., mFc7.2) from the N-terminus to the C-terminus. Monomer Fc7.2 contains two amino acid mutations (T366L and Y407H) that can inhibit Fc homodimerization.

[0132] In another aspect, the present disclosure provides a bispecific antibody or an antigen-binding fragment thereof, comprising a first antigen-binding region comprising VL and VH that binds to ENPP3 and a second antigen-binding region comprising VL and VH that binds to CD3, wherein the VL of the first antigen-binding region comprises LCDR 1-3 having the amino acid sequences shown in SEQ ID NOs: 1-3, respectively, and the VH of the first antigen-binding region comprises HCDR 1-3 having the amino acid sequences shown in SEQ ID NOs: 6-8, respectively; and the VL of the second antigen-binding region comprises LCDR 1-3 having the amino acid sequences shown in SEQ ID NOs: 11-13, respectively, and the VH of the second antigen-binding region comprises HCDR 1-3 having the amino acid sequences shown in SEQ ID NOs: 16-18, respectively.

[0133] In some embodiments of the bispecific antibodies or antigen-binding fragments thereof disclosed herein, the VL of the first antigen-binding region comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:4, and the VH of the first antigen-binding region comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:9; and the VL of the second antigen-binding region comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:14, and the VH of the second antigen-binding region comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:19.

[0134] In some embodiments, the VL of the first antigen-binding region comprises a functional variant of the amino acid sequence as shown in SEQ ID NO: 4, which is formed by inserting, deleting and / or substituting one or more amino acids therein, provided that the functional variant retains the ability to bind to ENPP3. In some embodiments, the VH of the first antigen-binding region comprises a functional variant of the amino acid sequence as shown in SEQ ID NO: 9, which is formed by inserting, deleting and / or substituting one or more amino acids therein, provided that the functional variant retains the ability to bind to ENPP3. In some embodiments, the VL of the second antigen-binding region comprises a functional variant of the amino acid sequence as shown in SEQ ID NO: 14, which is formed by inserting, deleting and / or substituting one or more amino acids therein, provided that the functional variant retains the ability to bind to CD3. In some embodiments, the VH of the second antigen-binding region comprises a functional variant of the amino acid sequence as shown in SEQ ID NO: 19, which is formed by inserting, deleting and / or substituting one or more amino acids therein, provided that the functional variant retains the ability to bind to CD3.

[0135] Functional variants of SEQ ID NOs: 4, 9, 14 and 19 may be those as described above.

[0136] In a preferred embodiment, the VL of the first antigen-binding region comprises the amino acid sequence shown in SEQ ID NO:4 and the VH of the first antigen-binding region comprises the amino acid sequence shown in SEQ ID NO:9; and the VL of the second antigen-binding region comprises the amino acid sequence shown in SEQ ID NO:14 and the VH of the second antigen-binding region comprises the amino acid sequence shown in SEQ ID NO:19.

[0137] In some embodiments, the VL of the second antigen binding region is optionally connected to the C-terminus of the VL of the first antigen binding region via a first linker, and the VH of the second antigen binding region is optionally connected to the C-terminus of the VH of the first antigen binding region via a second linker, wherein the first linker and the second linker are the same or different. In some embodiments, the first linker and the second linker each independently comprise an amino acid sequence selected from SEQ ID NO: 21 (GSGGGGSGGGGS) and SEQ ID NO: 22 (GSGGSGGGGSGGGGS). In some embodiments, the first linker comprises an amino acid sequence as shown in SEQ ID NO: 21 (GSGGGGSGGGGS), and the second linker comprises an amino acid sequence as shown in SEQ ID NO: 22 (GSGGSGGGGSGGGGS).

[0138] In some embodiments, the bispecific antibody comprises a single polypeptide chain comprising a first antigen binding region and a second antigen binding region, and optionally an Fc region.

[0139] The Fc region can be of any isotype, including but not limited to IgG1, IgG2, IgG3, and IgG4, and can contain one or more mutations or modifications. In one embodiment, the Fc region is an IgG1 isotype or is derived therefrom, optionally with one or more mutations or modifications. In one embodiment, the Fc region is a human IgG1 Fc.

[0140] In one embodiment, the Fc region is defective in effector function. For example, the Fc region can be an IgG1 isotype, or a non-IgG1 type, such as IgG2, IgG3 or IgG4, which has been mutated so that the ability to mediate effector functions such as ADCC is reduced or even eliminated. Such mutations have been described, for example, in Dall'Acqua WF et al., J Immunol. 177 (2): 1129-1138 (2006) and Hezareh M, J Virol.; 75 (24): 12161-12168 (2001).

[0141] In one embodiment, the Fc region comprises a mutation that removes an Asn-linked glycosylation acceptor site or is otherwise manipulated to alter the glycosylation properties. For example, in an IgG1 Fc region, an N297Q mutation can be used to remove an Asn-linked glycosylation site. Thus, in a specific embodiment, the Fc region comprises an IgG1 sequence with an N297Q mutation.

[0142] In a further embodiment, the Fc region is glycoengineered to reduce fucose and thereby enhance ADCC, for example by adding compounds to the culture medium during antibody production, as described in US2009317869 or as described in van Berkel et al. (2010) Biotechnol. Bioeng. 105:350, or by using FUT8 knockout cells, for example as described in Yamane-Ohnuki et al. (2004) Biotechnol. Bioeng 87:614. Alternatively, one may use et al. (1999) Nature Biotech 17: 176 to optimize ADCC. In another embodiment, the Fc region is engineered to enhance complement activation, for example as described in Natsume et al. (2009) Cancer Sci. 100: 2411.

[0143] In some embodiments, the Fc region includes modifications or mutations that can inhibit Fc homodimerization. In some embodiments, the Fc region includes a variant of the human IgG1 Fc wild-type sequence. The variant may be included in amino acid substitutions at human IgG1 T366 and Y407 positions (Kabat numbering). Preferably, T366 is replaced by L (leucine). Preferably, Y407 is replaced by I (isoleucine), F (phenylalanine), L (leucine), M (methionine), H (histidine), K (lysine), S (serine), Q (glutamine), T (threonine), W (tryptophan), A (alanine), G (glycine) or N (asparagine). More preferably, Y407 is replaced by H. In one embodiment, T366 is replaced by L, and Y407 is replaced by H.

[0144] In some embodiments, the Fc region can be a monomeric human IgG1 Fc (e.g., mFc7.2), as described in PCT Application No. PCT / US2018 / 016524, which is incorporated herein by reference in its entirety.

[0145] In some embodiments, the bispecific antibody comprises a first polypeptide chain and a second polypeptide chain, wherein the first polypeptide chain comprises the VL of the first antigen-binding region and the VL of the second antigen-binding region, and optionally an Fc region; the second polypeptide chain comprises the VH of the first antigen-binding region and the VH of the second antigen-binding region, and optionally an Fc region. The Fc region may be those as described above.

[0146] In some embodiments, the first polypeptide chain further comprises a light chain constant region (CL). In some embodiments, the first polypeptide chain comprises a monomeric human IgG1 Fc as described above (e.g., mFc7.2). In some embodiments, the first polypeptide chain comprises, from N-terminus to C-terminus: a VL of a first antigen binding region, a VL of a second antigen binding region, a CL, and mFc7.2.

[0147] In some embodiments, the second polypeptide chain further comprises a heavy chain constant region (CH), such as CH1. In some embodiments, the second polypeptide chain comprises a monomeric human IgG1 Fc as described above (e.g., mFc7.2). In some embodiments, the second polypeptide chain comprises, from N-terminus to C-terminus: a VH of the first antigen binding region, a VH of the second antigen binding region, CH1, and mFc7.2.

[0148] In some embodiments, the bispecific antibody comprises a light chain comprising an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:15, and a heavy chain comprising an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:20.

[0149] In some embodiments, the light chain comprises a functional variant of the amino acid sequence as shown in SEQ ID NO: 15, which is formed by inserting, deleting and / or substituting one or more amino acids therein, provided that the functional variant retains the ability to bind to ENPP3 and CD3. In some embodiments, the heavy chain comprises a functional variant of the amino acid sequence as shown in SEQ ID NO: 20, which is formed by inserting, deleting and / or substituting one or more amino acids therein, provided that the functional variant retains the ability to bind to ENPP3 and CD3.

[0150] Functional variants of SEQ ID NOs: 15 and 20 may be those as described above.

[0151] In a preferred embodiment, the light chain comprises the amino acid sequence shown in SEQ ID NO:15 and the heavy chain comprises the amino acid sequence shown in SEQ ID NO:20.

[0152] In some embodiments, the bispecific antibody may be a bispecific T cell engager (BiTE), preferably a HBiTE as described above.

[0153] In yet another aspect, the present disclosure provides a nucleic acid comprising a nucleotide sequence encoding an antibody or antigen-binding fragment thereof disclosed herein or a bispecific antibody or antigen-binding fragment thereof disclosed herein.

[0154] In another aspect, the present disclosure provides a vector comprising a nucleic acid disclosed herein.

[0155] Any vector may be suitable for use in the present disclosure. In some embodiments, the vector is a viral vector. In some embodiments, the vector is a retroviral vector, a DNA vector, a murine leukemia virus vector, a SFG vector, a plasmid, an RNA vector, an adenoviral vector, a baculoviral vector, an Epstein Barr virus vector, a papovavirus vector, a vaccinia virus vector, a herpes simplex virus vector, an adenovirus-associated vector (AAV), a lentiviral vector, or any combination thereof. Suitable exemplary vectors include, for example, pBY, pGAR, pBABE-puro, pBABE-neo largeTcDNA, pBABE-hygro-hTERT, pMKO.1GFP, MSCV-IRES-GFP, pMSCV PIG (Puro IRES GFP empty plasmid), pMSCV-loxp-dsRed-loxp-eGFP-Puro-WPRE, MSCV IRES luciferase, pMIG, MDH1-PGK-GFP_2.0, TtRMPVIR, pMSCV-IRES-mCherry FP, pRetroX GFP T2A Cre, pRXTN, pLncEXP, and pLXIN-Luc.

[0156] The recombinant expression vector can be any suitable recombinant expression vector. Suitable vectors include vectors designed for propagation and amplification or for expression or both, such as plasmids and viruses. For example, vectors can be selected from pUC series (Fermentas Life Sciences, Glen Burnie, Md.), pBluescript series (Stratagene, LaJolla, Calif.), pET series (Novagen, Madison, Wis.), pGEX series (Pharmacia Biotech, Uppsala, Sweden) and pEX series (Clontech, Palo Alto, Calif.). Phage vectors such as λGT10, λGT11, λZapII (Stratagene), λEMBL4 and λNM1149 can also be used. Examples of plant expression vectors that can be used in the context of the present disclosure include pBI01, pBI101.2, pBI101.3, pBI121 and pBIN19 (Clontech). Examples of animal expression vectors that can be used in the context of the present disclosure include pcDNA, pEUK-Cl, pMAM, and pMAMneo (Clontech).

[0157] Recombinant expression vectors can be prepared using standard recombinant DNA techniques described in, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, 3rd ed., Cold Spring Harbor Press, Cold Spring Harbor, NY 2001; and Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Associates and John Wiley & Sons, NY, 1994. Circular or linear expression vector constructs can be prepared to contain replication system functions in prokaryotic or eukaryotic host cells. The replication system can be derived from, for example, ColE1, 2μ plasmid, λ, SV40, bovine papilloma virus, etc.

[0158] In another aspect, the present disclosure provides a host cell comprising a nucleic acid disclosed herein or a vector disclosed herein.

[0159] Any cell can be used as a host cell for nucleic acids or vectors disclosed herein. In some embodiments, the cell can be a prokaryotic cell, a fungal cell, a yeast cell, or a higher eukaryotic cell such as a mammalian cell. Suitable prokaryotic cells include, but are not limited to, true bacteria, such as gram-negative or gram-positive organisms, such as Enterobacteriaceae, such as Escherichia, such as Escherichia coli; Enterobacter; Erwinia; Klebsiella; Proteus; Salmonella, such as Salmonella typhimurium; Serratia, such as Serratia marcescens. marcescans and Shigella; Bacilli, such as Bacillus subtilis and Bacillus licheniformis; Pseudomonas, such as Pseudomonas aeruginosa; and Streptomyces. In some embodiments, the cell is a human cell. In some embodiments, the cell is an immune cell. In some embodiments, the host cell includes, for example, CHO cells, such as CHOS cells and CHO-K1 cells, or HEK293 cells, such as HEK293A, HEK293T, and HEK293FS.

[0160] In yet another aspect, the present disclosure provides a pharmaceutical composition comprising (i) an antibody or antigen-binding fragment thereof disclosed herein, or a bispecific antibody or antigen-binding fragment thereof disclosed herein; and (ii) a pharmaceutically acceptable carrier or excipient.

[0161] In some embodiments, carriers or excipients for use with the compositions disclosed herein include, but are not limited to, maleic acid, tartaric acid, lactic acid, citric acid, acetic acid, sodium bicarbonate, sodium phosphate, histidine, glycine, sodium chloride, potassium chloride, calcium chloride, zinc chloride, water, dextrose, N-methylpyrrolidone, dimethyl sulfoxide, N,N-dimethylacetamide, ethanol, propylene glycol, polyethylene glycol, diethylene glycol monoethyl ether, and the surfactant polyoxyethylene-sorbitan monooleate.

[0162] In some embodiments of the pharmaceutical composition disclosed herein, the pharmaceutical composition further comprises a second therapeutic agent. In some embodiments, the second therapeutic agent may be selected from antibodies, chemotherapeutic agents and small molecule drugs. In some embodiments, the second therapeutic agent may be selected from Bruton's tyrosine kinase (BTK) inhibitors, PI3K inhibitors, HDAC inhibitors, ERK inhibitors, MAPK inhibitors, PD-1 / PD-L1 inhibitors, LAG3 inhibitors, CTLA-4 inhibitors, TIGIT inhibitors, TIM3 inhibitors and glucocorticoids or any combination thereof.

[0163] In some embodiments, the therapeutic agent is a chemotherapeutic agent. Chemotherapeutic agents may include, for example, cytotoxic agents, antimetabolites (e.g., folic acid antagonists, purine analogs, pyrimidine analogs, etc.), topoisomerase inhibitors (e.g., camptothecin derivatives, anthraquinones, anthracyclines, epipodophyllotoxins, quinoline alkaloids, etc.), antimicrotubule agents (e.g., taxanes, vinca alkaloids), protein synthesis inhibitors (e.g., cephalotaxine, camptothecin derivatives, quinoline alkaloids), alkylating agents (e.g., alkyl sulfonates, aziridines, nitrogen mustards, nitrosoureas, platinum derivatives, triazenes, etc.), alkaloids, terpenoids, and kinase inhibitors.

[0164] In yet another aspect, the present disclosure provides a conjugate comprising an antibody or antigen-binding fragment thereof disclosed herein or a bispecific antibody or antigen-binding fragment thereof disclosed herein, and a chemical moiety conjugated thereto.

[0165] In some embodiments of the conjugates disclosed herein, the chemical moiety is selected from the group consisting of a therapeutic agent, a detectable moiety, and an immunostimulatory molecule.

[0166] In some embodiments, therapeutic agents include but are not limited to immunomodulators, radioactive compounds, enzymes (e.g., perforin), chemotherapeutic agents (e.g., cisplatin), or toxins. In some embodiments, therapeutic agents can be, for example, maytansine, geldanamycin, tubulin inhibitors such as tubulin binding agents (e.g., auristatins), or minor groove binding agents such as calicheamicin.

[0167] Other suitable therapeutic agents include, for example, small molecule cytotoxic agents, i.e., compounds with a molecular weight of less than 700 Daltons that have the ability to kill mammalian cells. Such compounds may also contain toxic metals that can have cytotoxic effects. In addition, it should be understood that these small molecule cytotoxic agents also include prodrugs, i.e., compounds that decompose or transform under physiological conditions to release cytotoxic agents. Examples of such agents include cisplatin, maytansine derivatives, rachelmycin, calicheamicin, docetaxel, etoposide, gemcitabine, ifosfamide, irinotecan, melphalan, mitoxantrone, sorfimer sodium photofrin II, temozolomide, topotecan, trimetreate glucuronate, auristatin E vincristine and doxorubicin; peptide cytotoxins, i.e., proteins or fragments thereof that have the ability to kill mammalian cells, such as ricin, diphtheria toxin, Pseudomonas bacterial exotoxin A, DNA enzymes and RNA enzymes; radionuclides, i.e., unstable isotopes of elements that decay with the simultaneous emission of one or more alpha or beta particles or gamma rays, such as iodine-131, rhenium-186, indium-111, yttrium-90, bismuth-210, bismuth-213, actinium-225 and astatine-213; chelating agents can be used to facilitate the binding of these radionuclides to the molecule or polymers thereof.

[0168] In some embodiments, the detectable moiety can be selected from the group consisting of biotin, streptavidin, enzymes or catalytically active fragments thereof, radionuclides, nanoparticles, paramagnetic metal ions, or fluorescent, phosphorescent or chemiluminescent molecules. Detectable moieties for diagnostic purposes include, for example, fluorescent labels, radioactive labels, enzymes, nucleic acid probes, and contrast agents.

[0169] In some embodiments, the immunostimulatory molecule is an immune effector molecule that stimulates an immune response. For example, the immunostimulatory molecule can be a cytokine such as IL-2 and IFN-γ, a chemokine such as IL-8, platelet factor 4, melanoma growth stimulating protein, a complement activator; a viral / bacterial protein domain, or a viral / bacterial peptide.

[0170] In another aspect, the present disclosure provides a method of treating cancer in a subject, the method comprising administering to the subject an effective amount of an antibody or antigen-binding fragment thereof disclosed herein, a bispecific antibody or antigen-binding fragment thereof disclosed herein, a pharmaceutical composition disclosed herein, or a conjugate disclosed herein.

[0171] In some embodiments of the methods disclosed herein, the cancer is an ENPP3-positive cancer. In some embodiments, the cancer can be selected from the group consisting of: mastocytosis, leukemia, liver cancer, colon cancer, rectal cancer, colorectal cancer, bile duct cancer, Wilms' tumor, pancreatic cancer, breast cancer, lung cancer, ovarian cancer, esophageal cancer, bladder cancer, prostate cancer, colorectal cancer, uterine cancer, cervical cancer, brain cancer, cervical cancer, gastric cancer, bile duct cancer, chondrosarcoma, kidney cancer, thyroid cancer, skin cancer, glioma, neuroblastoma, lymphoma and myeloma. Preferably, the cancer is selected from the group consisting of: mastocytosis, leukemia, kidney cancer (e.g., renal cell carcinoma), lung cancer, gastric cancer, ovarian cancer, breast cancer, pancreatic cancer, colon cancer, rectal cancer, colorectal cancer, bile duct cancer, liver cancer (e.g., hepatocellular carcinoma) and Wilms' tumor.

[0172] In some embodiments, the dosage administered to a subject may vary with the embodiment, the drug used, the method of administration, and the site and subject to be treated. However, the dosage should be sufficient to provide a therapeutic response. A clinician can determine the effective amount to be administered to a person or other subject to treat a medical condition. The exact amount required for effective treatment may depend on many factors, such as the activity of the antibody and the route of administration.

[0173] The dosage of the antibodies, compositions or conjugates described herein can be administered to a mammal once or in a series of sub-doses over an appropriate time period, for example, daily, semi-weekly, weekly, biweekly, semi-monthly, bimonthly, semi-annually or annually as needed. A dosage unit comprising an effective amount of an antibody, composition or conjugate can be administered in a single daily dose, or the total daily dose can be administered in two, three, four or more divided doses administered daily as needed.

[0174] Suitable modes of administration can be selected by medical practitioners. The route of administration can be parenteral administration, such as by injection, nasal administration, pulmonary administration or transdermal administration. Systemic or local administration can be performed by intravenous injection, intramuscular injection, intraperitoneal injection, subcutaneous injection. In some embodiments, the antibody, composition or conjugate is selected for parenteral delivery, for inhalation or for delivery through the digestive tract, such as oral administration. The dosage and method of administration can vary according to the weight, age, condition, etc. of the subject, and can be appropriately selected.

[0175] In some embodiments, the method further comprises administering to the subject a second therapeutic agent.In certain embodiments, an antibody, composition, or conjugate disclosed herein is administered prior to, substantially simultaneously with, or after administration of a second therapeutic agent.

[0176] In some embodiments, the second therapeutic agent is selected from antibodies, chemotherapeutic agents and small molecule drugs. In some preferred embodiments, the second therapeutic agent can be selected from Bruton's tyrosine kinase (BTK) inhibitors, PI3K inhibitors, HDAC inhibitors, ERK inhibitors, MAPK inhibitors, PD-1 / PD-L1 inhibitors, LAG3 inhibitors, CTLA-4 inhibitors, TIGIT inhibitors, TIM3 inhibitors and glucocorticoids or any combination thereof.

[0177] In some embodiments, the second therapeutic agent is a chemotherapeutic agent. Chemotherapeutic agents may include, for example, cytotoxic agents, antimetabolites (e.g., folic acid antagonists, purine analogs, pyrimidine analogs, etc.), topoisomerase inhibitors (e.g., camptothecin derivatives, anthraquinones, anthracyclines, epipodophyllotoxins, quinoline alkaloids, etc.), antimicrotubule agents (e.g., taxanes, vinca alkaloids), protein synthesis inhibitors (e.g., cephalotaxine, camptothecin derivatives, quinoline alkaloids), alkylating agents (e.g., alkyl sulfonates, aziridines, nitrogen mustards, nitrosoureas, platinum derivatives, triazenes, etc.), alkaloids, terpenoids, and kinase inhibitors.

[0178] In another aspect, the present disclosure provides a method for detecting EMPP3-positive cancer in a subject, the method comprising (i) contacting a sample obtained from the subject with an antibody or antigen-binding fragment thereof disclosed herein, a bispecific antibody or antigen-binding fragment thereof disclosed herein, or a conjugate disclosed herein; and (ii) detecting binding of the antibody or antigen-binding fragment thereof to ENPP3 in the sample.

[0179] In some embodiments, the antibody or its antigen binding fragment is connected to a detectable portion. The detectable portion can be selected from the group consisting of biotin, streptavidin, enzyme or its catalytically active fragment, radionuclide, nanoparticle, paramagnetic metal ion or fluorescent, phosphorescent or chemiluminescent molecules. Detectable portions for diagnostic purposes include, for example, fluorescent labels, radioactive labels, enzymes, nucleic acid probes and contrast agents.

[0180] In some embodiments, the cancer is an ENPP3-positive cancer. Preferably, the cancer is selected from the group consisting of mastocytosis, leukemia, kidney cancer (e.g., renal cell carcinoma), lung cancer, gastric cancer, ovarian cancer, breast cancer, pancreatic cancer, colon cancer, rectal cancer, colorectal cancer, bile duct cancer, liver cancer (e.g., hepatocellular carcinoma), and Wilms' tumor.

[0181] In another aspect, the disclosure provides a pharmaceutical package or kit comprising one or more containers containing one or more ingredients of a pharmaceutical composition as described herein, such as an antibody or antigen-binding fragment disclosed herein. Optionally, associated with such containers may be a notice in a form prescribed by a governmental agency regulating the manufacture, use or sale of drugs or biological products, which notice reflects the agency's approval of the manufacture, use or sale for human administration.

[0182] In a specific embodiment, the kit includes a first container containing an antibody or antigen-binding fragment disclosed herein. In a specific embodiment, the kit includes a first container, which is a vial containing a vacuum lyophilized sterile powder form of the antibody or antigen-binding fragment, and the kit also includes a second container, which includes a pharmaceutically acceptable fluid.

[0183] In a specific embodiment, provided herein is an injection device containing an antibody or antigen-binding fragment disclosed herein. In a specific embodiment, the injection device comprises an antibody in a sterile solution. In a specific embodiment, the injection device is a syringe.

[0184] In another aspect, the present disclosure provides a kit for detecting the presence of ENPP3 antigen in a sample, comprising an antibody or antigen-binding fragment thereof disclosed herein, a bispecific antibody or antigen-binding fragment thereof disclosed herein, or a conjugate disclosed herein. Preferably, the antibody or antigen-binding fragment thereof is linked to a detectable moiety. The detectable moiety can be selected from the group consisting of biotin, streptavidin, an enzyme or a catalytically active fragment thereof, a radionuclide, a nanoparticle, a paramagnetic metal ion, or a fluorescent, phosphorescent or chemiluminescent molecule. Detectable moieties for diagnostic purposes include, for example, fluorescent labels, radioactive labels, enzymes, nucleic acid probes, and contrast agents.

[0185] In another aspect, the present disclosure provides a use of an antibody or antigen-binding fragment thereof disclosed herein, a bispecific antibody or antigen-binding fragment thereof disclosed herein, a pharmaceutical composition disclosed herein, or a conjugate disclosed herein in the preparation of a medicament for treating cancer in a subject. In some embodiments, the cancer is an ENPP3-positive cancer.

[0186] In another aspect, the present disclosure provides an antibody or antigen-binding fragment thereof disclosed herein, a bispecific antibody or antigen-binding fragment thereof disclosed herein, a pharmaceutical composition disclosed herein, or a conjugate disclosed herein for use in treating cancer in a subject. In some embodiments, the cancer is an ENPP3-positive cancer.

[0187] In yet another aspect, the present disclosure provides use of an antibody or antigen-binding fragment thereof disclosed herein, a bispecific antibody or antigen-binding fragment thereof disclosed herein, or a conjugate disclosed herein in the preparation of a kit for detecting ENPP3-positive cancer in a subject.

[0188] In yet another aspect, the present disclosure provides an antibody or antigen-binding fragment thereof disclosed herein, a bispecific antibody or antigen-binding fragment thereof disclosed herein, or a conjugate disclosed herein for use in detecting an ENPP3-positive cancer in a subject.

[0189] In some embodiments of the uses disclosed herein, the ENPP3-positive cancer is preferably selected from the group consisting of mastocytosis, leukemia, kidney cancer (e.g., renal cell carcinoma), lung cancer, gastric cancer, ovarian cancer, breast cancer, pancreatic cancer, colon cancer, rectal cancer, colorectal cancer, bile duct cancer, liver cancer (e.g., hepatocellular carcinoma) and Wilms' tumor. Example

[0190] For the purpose of illustrating various embodiments of the present invention, the following examples are given, but are not intended to limit the present invention in any way. The present examples and the methods described herein currently represent preferred embodiments, are exemplary, and are not intended to be used as limitations on the scope of the present invention. Those skilled in the art will expect to be included in the changes and other uses contained in the spirit of the present invention limited by the scope of the claims.

[0191] Cell lines included HepG2 (human hepatoma cell line), LS174T (human colorectal cancer cell line), Jrukat (human lymphoma cell line), and SK-Nep-1 (human Wilms tumor cell line), all of which were purchased from the National Certified Cell Culture Collection.

[0192] Use of Lipofectamine TM LTX Reagent and PLUS TM Reagents (Thermo) and transfection-specific medium Opti-MEM TM I (Gibco), the commercial ENPP3 recombinant plasmid pCMV-human ENPP3 (Sino Biological) was transiently transfected into LS174T cells to generate the tumor cell line LS174T-ENPP3 that stably expresses ENPP3. Hygromycin B was supplemented to the cell culture and positive clones were selected. After 3-5 weeks, single positive clones were gradually isolated and verified by flow cytometry.

[0193] Human ENPP3 (CD203c) protein was purchased from ACROBiosystems. Anti-human IgG (γ-chain specific)-R-PE antibody, anti-human IgG (Fc specific)-peroxidase antibody and monoclonal anti- M2-peroxidase was purchased from Sigma. M13KO7 helper phage was purchased from Invitrogen. Dynabeads TM Myone TMStreptavidin T1 was purchased from Thermofisher Scientific, and PE anti-His tag antibody was purchased from BioLegend.

[0194] Example 1. Panning and screening of phage-displayed naive human Fab libraries for identification of ENPP3 antibodies

[0195] As previously described (Zhu et al., J Virol 2006, 80:891-899), two large (10-well) B cells containing peripheral blood B cells from approximately 30 healthy individuals were used. 11 ) phage display naive human Fab library to select with magnetic beads (Dynabeads TM Myone TM Streptavidin T1; ThermoFisher Scientific) conjugated antibody against recombinant human ENPP3 with the following modifications: 5, 1, 0.2 and 0.2 mg antigen were used in the first, second, third and fourth rounds of panning, respectively. After 4 rounds of bio-panning, strong positive signals were observed using polyclonal phage ELISA. The 4th round phage was subsequently tested for specific binding to ENPP3. A specific Fab clone was identified by monoclonal enzyme-linked immunosorbent assay (SemELISA) based on soluble expression and DNA sequencing analysis, named 3A10. The Fab clone has a lambda light chain.

[0196] The 3A10 Fab of hexa-histidine tag was expressed in Escherichia coli strain HB2151 and purified from the soluble part of the periplasm using Ni-NTA resin. ELISA was then performed using a standard protocol to measure the binding affinity to recombinant human ENPP3 (full-length extracellular domain). In brief, recombinant human ENPP3 (ACROBiosystems) was coated on a 96-well plate (Corning Inc.) with Corning EIA / RIA high binding at 200 ng per well, overnight at 4 ° C, and blocked with 3% skim milk in PBS (pH 7.4). Five times serial dilutions of antibodies were added accordingly, and then incubated at room temperature for 2 hours. The plate was washed with PBS containing 0.05% Tween 20. The bound antibody was detected by an anti-FLAG tag antibody (Sino Biological) conjugated with HRP. The assay was developed with TMB substrate (Solarbio) at room temperature, and the OD value was measured at 450 nm with an enzyme reader.

[0197] The results showed that the binding affinity of Fab 3A10 to human ENPP3 was 9.17 nM ( Figure 1), which is suitable for the development of therapeutic monoclonal antibodies and the construction of BiTE-type antibodies. In the following examples, the Fab 3A10 sequence is used for the construction of monoclonal antibodies and bispecific antibodies.

[0198] Example 2. Construction and characterization of anti-ENPP3 monoclonal antibodies

[0199] Fab clone 3A10 was used to construct a complete form of monoclonal antibody IgG1 (3A10 mAb) against human ENPP3. The heavy chain Fd fragment of 3A10 Fab was fused to the N-terminus of the human IgG1 Fc fragment. The light chain and heavy chain were constructed separately into the vector pBY. The construction and preliminary characterization of 3A10 mAb were performed as follows.

[0200] Cloning of anti-ENPP3 monoclonal antibodies

[0201] To generate anti-ENPP3 monoclonal antibody constructs, the following primers were used:

[0202] pBY-SP-FP-Not1:

[0203] 5'GAATGCGGCCGCAAACTACAAGACAGACTTGCAAAAGAAGGCATGCACAGCTCAGCACTGCTCTGTTG 3' (sense) (SEQ ID NO: 23);

[0204] BI-ENPP3-3A10-VH-FP:

[0205] 5'TCAGCACTGCTCTGTTGCCTGGTCCTCCTGACTGGGGTGAGGGC CGAGTGCAGCTGGTGGA 3' (sense) (SEQ ID NO: 24);

[0206] ENPP3-3A10-Mab-VH-RP-OL:

[0207] 5'CGGTGGGCATGTGTGAGTTTTGTCACAAGATTTGGGCTCAACTT TCT 3' (antisense) (SEQ IDNO: 25);

[0208] BI-ENPP3-3A10-VL-FP:

[0209] 5'TCAGCACTGCTCTGTTGCCTGGTCCTCCTGACTGGGGTGAGGGC CCAGTCTGTCGTGACGCAGC3' (sense) (SEQ ID NO: 26);

[0210] ENPP3-3A10-Mab-VL-RP-Xba1:

[0211] 5'CGATTCTAGAATCATGAACATTCTGTAGGGGCCACTGTCTTC 3' (antisense) (SEQ ID NO: 27);

[0212] FC-FP-OL:

[0213] 5'GACAAAACTCACACATGCCCACCG 3' (sense) (SEQ ID NO: 28);

[0214] Fc-RP-Xba1:

[0215] 5'CGATTCTAGAATCATTTACCCGGGGACAGGGAGAGGCT 3' (antisense) (SEQ ID NO: 29).

[0216] To generate the light chain, the light chain gene fragment was amplified from the anti-ENPP3 Fab 3A10 using the primer pair BI-ENPP3-3A10-VL-FP / ENPP3-3A10-Mab-VL-RP-Xba1. The gene fragment encoding the leader peptide that facilitates the expression of the target gene was fused to the 5' end of the light chain PCR fragment by overlapping PCR using the primer pair pBY-SP-FP-Not1 / ENPP3-3A10-Mab-VL-RP-Xba1. The PCR product was cloned into the pBY vector by using the restriction enzymes Not1 / Xba1.

[0217] To generate the heavy chain, the VH-CH1 gene fragment was amplified from the anti-ENPP3 Fab 3A10 using the primer pair BI-ENPP3-3A10-VH-FP / ENPP3-3A10-Mab-VH-RP-OL. The PCR product was fused to the 3' end of the signal peptide gene fragment by overlapping PCR using the primer pair pBY-SP-FP-Not1 / ENPP3-3A10-Mab-VH-RP-OL. The Fc domain was amplified from an unrelated human IgG1 containing a wild-type Fc gene sequence using the primer pair FC-FP-OL / Fc-RP-Xba1. To obtain the full-length heavy chain, the two gene fragments were fused together by overlapping PCR using the primer pair pBY-SP-FP-Not1 / Fc-RP-Xba1. The full-length heavy chain gene fragment was then cloned into the pBY plasmid via the Not1 and Xba1 restriction sites.

[0218] Protein expression, purification and preliminary characterization

[0219] Anti-ENPP3 3A10 mAb was expressed in 293FS cells. The plasmid and transfection agent PEI were mixed in a ratio of 1:3 and then added dropwise to the 293FS cell culture. The cells continued to grow for 5-7 days after transfection. The cell culture was harvested by centrifugation at 8000 rpm for 20 minutes. The culture supernatant containing the target protein was loaded onto a Gravity EshmunoA column (Merck) and purified according to the manufacturer's instructions.

[0220] The purified protein was subjected to SDS-PAGE. On non-reducing SDS-PAGE, 3A10 mAb showed an apparent molecular weight (aMW) of about 150 kDa. On reducing SDS-PAGE, the heavy chain and light chain had an apparent molecular weight of about 50 kDa and 25 kDa, respectively (data not shown).

[0221] The CDR sequences of 3A10 mAb according to the Kabat numbering system are shown in Table 1. The amino acid sequences of the light chain variable region (VL) and heavy chain variable region (VH) of 3A10 mAb are shown in Table 2. The complete light and heavy chain sequences of 3A10 mAb are shown in Table 3.

[0222] Table 1. CDR sequences of 3A10 mAb

[0223] LCDR1 SGSSSNIGNNYVS (SEQ ID NO: 1) LCDR2 DNNKRPS (SEQ ID NO: 2) LCDR3 GVWDSSLRAEL (SEQ ID NO: 3) HCDR1 NAWMS (SEQ ID NO:6) HCDR2 YISSSGSTIYYADSVKG(SEQ ID NO:7) HCDR3 LAGPYYFDY (SEQ ID NO: 8)

[0224] Table 2. VL and VH sequences of 3A10 mAbs

[0225]

[0226]

[0227] Table 3.3A10 mAb light and heavy chain sequences

[0228]

[0229] Example 3. Binding of anti-ENPP3 monoclonal antibodies to ENPP3

[0230] ELISA was performed according to standard protocols to determine the binding affinity of anti-ENPP3 3A10 mAb to recombinant human ENPP3 (AcroBiosystems). Briefly, recombinant human ENPP3 was coated on Corning EIA / RIA high binding 96-well plates (Corning Inc.) at a concentration of 100 ng per well, overnight at 4°C, and blocked with 3% skim milk in PBS (pH 7.4). Five-fold serial dilutions of the antibody were added and incubated at 37°C for 1 hour. The plates were washed with PBS containing 0.05% Tween 20. The bound antibodies were detected by anti-human IgG (Fc specific)-peroxidase antibody (Sigma). The assay was developed with TMB substrate (Solarbio) at room temperature and detected at 450 nm with a microplate reader. The half-maximal binding (EC) was calculated by fitting the data to the Langmuir adsorption isotherm. 50 ). The results are shown in Figure 2 middle.

[0231] The results showed that 3A10 mAb had an EC of 107.2 pM. 50 Binding to human ENPP3 indicated that 3A10 mAb had high binding affinity to human ENPP3.

[0232] Example 4. Binding of anti-ENPP3 monoclonal antibodies to cancer cell lines

[0233] To measure the ability of anti-ENPP3 3A10 mAb to bind to cell surface-associated ENPP3, flow cytometry was performed using ENPP3-positive cancer cell lines SK-Nep-1 and LS174T-ENPP3. 5 Cells were incubated with serial concentrations of antibodies on ice for 1 hour, and an IgG4 isotype antibody was used as a negative control. Cells were washed once with PBS containing 0.1% bovine serum albumin (PBSA) and resuspended in 100 μl PBSA. 1 μl of anti-human IgG (Fc specific)-FITC conjugate (Sigma) was then added and incubated for 30 minutes. Cells were washed once with PBSA and then used for flow cytometry analysis. Half maximal binding (EC) was calculated by fitting the data to the Langmuir adsorption isotherm. 50 ). The results are shown in Figure 3A and 3B middle.

[0234] The results showed that 3A10 mAb bound well to SK-Nep-1 and LS174T-ENPP3 cells, indicating that 3A10 mAb had good binding ability to ENPP3-positive tumor cell lines.

[0235] Example 5. Anti-ENPP3 monoclonal antibody-mediated ADCC killing of human cancer cell lines

[0236] To evaluate ADCC killing of 3A10 mAb, HepG2 cells were used as target cells and NK cells as effector cells. Frozen NK cells were thawed and cultured overnight in RPMI1640 complete medium containing 20% ​​FBS, 1% penicillin / streptomycin and 50 IU IL-2 at 37°C in a 5% CO2 incubator. Target HepG2 cells were prepared with complete medium at 1.5×10 5 cells / mL, and added to a 96-well plate at 100 μL / well and incubated overnight in a 37°C incubator supplemented with 5% CO2. The next day, a series of concentrations (200 μg / mL, 20 μg / mL, 0 μg / mL) of 3A10 mAb were prepared in complete medium, with IgG4 isotype antibody as a negative control. 100 μL of antibody solution was added to the 96-well plate containing target cells. NK cells were collected and diluted to 3×10 5 Cells / mL, then added to a 96-well plate at 100 μL / well. The plate was incubated at 37°C for 48 hours in a 5% CO2 incubator. The final concentrations of the antibody were 100 μg / mL, 10 μg / mL, and 0 μg / mL. After incubation for 48 hours, the medium was discarded and replaced with 100 μL / well of fresh complete medium containing 10% CCK8, and the plate was incubated at 37°C for 30 minutes. The OD value at 450nm was measured with an ELISA reader. The killing efficiency was calculated according to the following formula:

[0237] (OD 肿瘤+NK+0μg / mL mab -OD 肿瘤+NK+xμg / mL mab ) / OD 肿瘤+NK+0μg / mL mab ×100%,

[0238] Where x represents 10 or 100.

[0239] The ADCC killing results of 3A10 mAb on HepG2 cells are shown in Figure 4 The results showed that 3A10 mAb induced about 20% killing against tumor cells at 10 μg / mL and more than 36% killing against tumor cells at 100 μg / mL, while the control antibody IgG4 isotype did not induce any ADCC at the highest concentration of 100 μg / mL, indicating that ADCC was caused by the specific binding of 3A10 mAb to ENPP3-positive tumor cells HepG2 and the recruitment of NK cells through the Fc part of mAb. This indicates that 3A10 mAb has a significant ability to induce ADCC killing against ENPP3-positive tumor cells.

[0240] Example 6. Construction and characterization of anti-ENPP3 bispecific antibodies

[0241] Bispecific T cell engagers (BiTE) are a new type of bispecific antibodies that guide cytotoxic T cells to kill cancer cells by simultaneously binding tumor antigens and T cell antigens such as CD3 molecules on the surface of T cells. HBiTE as described in PCT application number PCT / US2018 / 16524 (which is incorporated herein by reference in its entirety) is a specific form of BiTE. HBiTE has a light chain and a heavy chain that form a heterodimer. The light chain includes an anti-target (e.g., tumor antigen) VL domain, an anti-CD3 VL-CL, and a monomeric human IgG1 Fc (e.g., mFc7.2) from the N-terminus to the C-terminus. The heavy chain includes an anti-target VH domain, an anti-CD3 VH-CH1, and a monomeric human IgG1 Fc (e.g., mFc7.2) from the N-terminus to the C-terminus. Monomer Fc7.2 contains two amino acid mutations (T366L and Y407H) that can inhibit Fc homodimerization. To generate ENPP3×CD3 HBiTE, the VL and VH domains of the above anti-ENPP3 antibody were fused to the N-terminus of the VL and VH domains of the anti-CD3 Fab via linkers GSGGGGSGGGGS (SEQ ID NO: 21) and GSGGSGGGSGGGGS (SEQ ID NO: 22), respectively. The anti-CD3 Fab was further fused to the N-terminus of mFc7.2. The light chain and heavy chain were constructed into a single vector pBY for expression in mammalian cells. The construction and preliminary characterization of a bispecific antibody targeting ENPP3 and CD3 (ENPP3×CD3 HBiTE based on 3A10) are as follows.

[0242] Cloning of bispecific antibodies targeting ENPP3 and CD3

[0243] To generate the bispecific antibody 3A10-based ENPP3×CD3 HBiTE construct, the following primers were used:

[0244] pBY-SP-FP-Not1:

[0245] 5'GAATGCGGCCGCAAACTACAAGACAGACTTGCAAAAGAAGGCATGCACAGCTCAGCACTGCTCTGTTG 3' (sense) (SEQ ID NO: 23);

[0246] BI-ENPP3-3A10-VH-FP:

[0247] 5'TCAGCACTGCTCTGTTGCCTGGTCCTCCTGACTGGGGTGAGGGC CGAGTGCAGCTGGTGGA 3' (sense) (SEQ ID NO: 24);

[0248] BI-ENPP3-3A10-VH-RP:

[0249] 5'ACCTCCGCCTGAACCCCCGGATCCTGAGGAGACGGTGACCAGG GTT3'(SEQ ID NO:30);

[0250] BI-ENPP3-3A10-VL-FP:

[0251] 5′ TCAGCACTGCTCTGTTGCCTGGTCCTCCTGACTGGGGTGAGGGC CCAGTCTGTCGTGACGCAGC3′(Unique)(SEQ ID NO:26);

[0252] BI-ENPP3-3A10-VL-RP:

[0253] 5'GCCAGAGCCACCTCCGCCGGATCCTAGGACGGTCACCTTGGTCC CT 3'(UN)(SEQ ID NO:31);

[0254] CD3FC-VH-FP-BamH1:

[0255] 5'GGATCCGGGGGTTCAGGCGGAGGTGGCTCTGG 3'(Unique)(SEQ ID NO:32);

[0256] CD3FC-VL-FP:

[0257] 5'GGATCCGGCGGAGGTGGCTCTGGC 3'(UN)(SEQ ID NO:33);

[0258] FC-RP-Xba1-DelK:

[0259] 5'TGATCTAGAATTAACCCGGAGACAGGGAGAGCTCT 3'(SEQ ID NO:34).

[0260] To generate bispecific antibodies, gene fragments of the VH and VL domains were amplified from 3A10 Fab using primer pairs BI-ENPP3-3A10-VH-FP / BI-ENPP3-3A10-VH-RP and BI-ENPP3-3A10-VL-FP / BI-ENPP3-3A10-VL-RP, respectively. The PCR products were fused to the 3' end of the signal peptide by overlapping PCR using primer pairs pBY-SP-FP-Not1 / BI-ENPP3-3A10-VH-RP and pBY-SP-FP-Not1 / BI-ENPP3-3A10-VL-RP, respectively. Based on the same HBiTE format, anti-CD3 hSP34 VL-CL and VH-CH1 fragments and the complete Fc were amplified from the pBY vector containing the CD3 bispecific antibody fragment using primer pairs CD3FC-VL-FP / FC-RP-Xba1-DelK and CD3FC-VH-FP-BamH1 / FC-RP-Xba1-DelK, respectively. To obtain the full-length light and heavy chains, the ENPP3 VL / VH fragment containing the signal peptide was fused to CD3 VL-CL-Fc / CD3 VH-CH1-Fc by overlap using primer pair pBY-SP-FP-Not1 / Fc-RP-XabI-DelK. The full-length light and heavy chain gene fragments were then cloned into two pBY plasmids via Not1 and Xba1 restriction sites. The 3A10-based ENPP3×CD3 HBiTE was called CMD016.

[0261] Protein expression, purification and preliminary characterization

[0262] Expression of CMD016 in 293FS. The plasmid and transfection agent PEI were mixed in a ratio of 1:3 and then added to the 293FS cell culture medium. The cells continued to grow for 5-7 days after transfection. The cell culture was harvested by centrifugation at 8000 rpm for 20 minutes. The culture supernatant containing the target protein was loaded onto a Gravity EshmunoA column (Merck) and purified according to the manufacturer's instructions.

[0263] The purified protein was subjected to SDS-PAGE. On non-reducing SDS-PAGE, CMD016 showed an apparent molecular weight (aMW) of about 120kDa. On reducing SDS-PAGE, heavy chain and light chain were close to each other, with an apparent molecular weight of about 62kDa (data not shown). The CDR sequences of CMD016 according to the Kabat numbering system are shown in Table 4. The amino acid sequences of the light chain variable region (VL) and the heavy chain variable region (VH) of CMD016 are shown in Table 5. The complete light chain and heavy chain sequences of CMD016 are shown in Table 6.

[0264] Table 4. CDR sequences of CMD016

[0265] LCDR1 for ENPP3 SGSSSNIGNNYVS (SEQ ID NO: 1) LCDR2 for ENPP3 DNNKRPS (SEQ ID NO:2) LCDR3 for ENPP3 GVWDSSLRAEL (SEQ ID NO: 3) Targeting HCDR1 of ENPP3 NAWMS (SEQ ID NO:6) Targeting HCDR2 of ENPP3 YISSSGSTIYYADSVKG(SEQ ID NO:7) Targeting HCDR3 of ENPP3 LAGPYYFDY (SEQ ID NO: 8) LCDR1 for CD3 RSSTGAVTTSNYAN (SEQ ID NO: 11) LCDR2 for CD3 GANKRAP (SEQ ID NO: 12) LCDR3 for CD3 ALWYSNLWV (SEQ ID NO: 13) Targeting HCDR1 of CD3 GFTFNTY (SEQ ID NO: 16) Targeting HCDR2 of CD3 RSKYNNYA (SEQ ID NO: 17) Targeting HCDR3 of CD3 HGNFGSSYVSYFAY (SEQ ID NO: 18)

[0266] Table 5. VL and VH sequences of CMD016

[0267]

[0268]

[0269] Table 6. Light chain and heavy chain sequences of CMD016

[0270]

[0271]

[0272] Example 7. Binding of bispecific antibodies to ENPP3 and CD3

[0273] To determine the binding affinity of the bispecific antibody CMD016 to ENPP3 and CD3, an ELISA experiment was performed using the coating protein of human ENPP3 or human CD3 as described in Example 3. The results are shown in Figure 5A-5B middle.

[0274] The results showed that CMD016 binds to human ENPP3 50 2.29nM( Figure 5A ), EC binding to human CD3 50 5.28nM( Figure 5B ). These results indicate that CMD016 can bind to ENPP3 and CD3 with high affinity.

[0275] Example 8. Binding of bispecific antibodies to cancer cell lines

[0276] To determine the binding affinity of the bispecific antibody CMD016 to cell surface-associated ENPP3 and CD3, flow cytometry was performed using the ENPP3-positive cancer cell line SK-Nep-1 and the CD3-positive Jurkat cell line. The experimental procedure was similar to that described in Example 4. The results are shown in Figure 6A-6B middle.

[0277] The results showed that CMD016 bound well to SK-Nep-1 and Jurkat cells, suggesting that CMD016 can bind to both cancer cells expressing ENPP3 and cells expressing CD3.

[0278] Example 9. Bispecific Antibody-Mediated Killing of Human Cancer Cell Lines

[0279] Bispecific T cell engagers can bind to tumor antigens and T cell antigens (e.g., CD3 molecules on the surface of T cells) at the same time, resulting in T cell aggregation and activation, ultimately leading to tumor cell killing. To evaluate the killing efficiency of the bispecific antibody CMD016, a tumor cell line LS174T-ENPP3 stably expressing ENPP3 was used as a target cell for CCK8 assay. The ENPP3 negative cell line LS174T was used as a negative control.

[0280] 3×10 4 LS174T-ENPP3 cells were seeded in 100 μl RPMI 1640 complete medium overnight. At the same time, frozen PBMCs were revived and seeded in 30 mL RPMI 1640 complete medium overnight. The next day, 1.5×10 5 PBMCs. Then, 50 μl of antibody (5-fold serial dilution starting from 4 μg / ml) was added to each well. After 48 hours of incubation, the medium was removed and 100 μl of RPMI 1640 complete medium containing 10% CCK8 was added and incubated in a CO2 incubator for 30 minutes. The cell killing activity was measured using a microplate reader according to the manufacturer's instructions.

[0281] The results are shown in Figure 7 The results showed that in the presence of CMD016 and PBMC, nearly 80% of LS174T-ENPP3 cells were killed. CMD016 kills LS174T-ENPP3 EC 50 The results showed that CMD016 had a strong killing ability against LS174T-ENPP3 cells stably expressing ENPP3, supporting its anti-tumor efficacy.

[0282] Example 10. Bispecific Antibody-Mediated Inhibition of Tumor Growth in Mice

[0283] Pharmacokinetic measurements

[0284] Three NOD / SCID mice were administered 300 μg CMD016 intravenously on day 0. Plasma samples were collected at 24, 48, 72, and 96 hours post-treatment and used to measure antibody serum concentrations by ELISA.

[0285] The results showed that the serum concentration of CMD016 gradually decreased but still maintained a high level until the end point. The calculated serum half-life (t 1 / 2 ) is about 115.39 hours ( Figure 8 ).

[0286] In vivo tumor growth inhibition

[0287] 2.5×10 6 Effector cells human PBMC and 2.5×10 6 Tumor cells LS174T-ENPP3 expressing ENPP3 were mixed and inoculated subcutaneously into the right abdomen of B-NDG mice. In the experimental groups, 33.3μg / kg (low-dose group), 100μg / kg (medium-dose group) and 300μg / kg (high-dose group) of CMD016 were injected intravenously into the mice. These mice were dosed twice a week. Mice in the negative control group were given PBS intravenously. The tumor volume and body weight of the mice were measured on days 0, 3, 6, 10, 13, and 21 after treatment. After three weeks of treatment, the mice were killed and the tumor weight was measured. The tumor growth inhibition rate was calculated by using the following formula:

[0288] (Average tumor weight of the control group - average tumor weight of the experimental group) / average tumor weight of the control group.

[0289] The results showed that CMD016 showed strong tumor growth inhibition in the low-dose group, medium-dose group and high-dose group ( Fig.9A The body weight of mice in each group did not change much ( Fig. 9B The low-dose group, the medium-dose group, and the high-dose group all showed a tumor growth inhibition rate of more than 95% ( Fig. 9C ), indicating that CMD016 has a significant anti-tumor effect in vivo.

[0290] Taken together, these results indicate that CMD016 has a long serum half-life and can specifically and effectively inhibit the growth of ENPP3-expressing tumor cells, suggesting its potential for treating ENPP3-positive cancers.

[0291] Although preferred embodiments of the present invention have been shown and described herein, it will be apparent to those skilled in the art that these embodiments are provided as examples only. Without departing from the present invention, those skilled in the art will appreciate that many variations, changes and substitutions may be employed. It should be understood that various alternatives to the embodiments described herein may be employed. The following claims are intended to define the scope of the present invention, and thus encompass methods and structures and their equivalents within the scope of these claims. Sequence Listing <110> Zhejiang Shimai Pharmaceutical Co., Ltd. <120> Antibodies against ENPP3 and uses thereof <130> C22W1970 <160> 34 <170> PatentIn Version 3.5 <210> 1 <211> 13 <212> PRT <213> Artificial sequence <220> <223> 3A10 mAb LCDR1 <400> 1 Ser Gly Ser Ser Ser Asn Ile Gly Asn Asn Tyr Val Ser 1 5 10 <210> 2 <211> 7 <212> PRT <213> Artificial sequence <220> <223> 3A10 mAb LCDR2 <400> 2 Asp Asn Asn Lys Arg Pro Ser 1 5 <210> 3 <211> 11 <212> PRT <213> Artificial sequence <220> <223> 3A10 mAb LCDR3 <400> 3 Gly Val Trp Asp Ser Ser Leu Arg Ala Glu Leu 1 5 10 <210> 4 <211> 110 <212> PRT <213> Artificial sequence <220> <223> 3A10 mAb VL <400> 4 Gln Ser Val Val Thr Gln Pro Pro Ser Val Ser Ala Ala Pro Gly Gln 1 5 10 15 Lys Val Thr Ile Ser Cys Ser Gly Ser Ser Ser Ser Asn Ile Gly Asn Asn 20 25 30 Tyr Val Ser Trp Tyr Gln Gln Leu Pro Gly Thr Ala Pro Lys Leu Leu 35 40 45 Ile Tyr Asp Asn Asn Lys Arg Pro Ser Gly Ile Pro Asp Arg Phe Ser 50 55 60 Gly Ser Lys Ser Gly Thr Ser Ala Thr Leu Gly Ile Asp Gly Leu Arg 65 70 75 80 Thr Gly Asp Glu Ala Glu Tyr Phe Cys Gly Val Trp Asp Ser Ser Leu 85 90 95 Arg Ala Glu Leu Phe Ala Gly Gly Thr Lys Val Thr Val Leu 100 105 110 <210> 5 <211> 216 <212> PRT <213> artificial sequence <220> <223> 3A10 mAb light chain <400> 5 Gln Ser Val Val Thr Gln Pro Pro Ser Val Ser Ala Ala Pro Gly Gln 1 5 10 15 Lys Val Thr Ile Ser Cys Ser Gly Ser Ser Ser Asn Ile Gly Asn Asn 20 25 30 Tyr Val Ser Trp Tyr Gln Gln Leu Pro Gly Thr Ala Pro Lys Leu Leu 35 40 45 Ile Tyr Asp Asn Asn Lys Arg Pro Ser Gly Ile Pro Asp Arg Phe Ser 50 55 60 Gly Ser Lys Ser Gly Thr Ser Ala Thr Leu Gly Ile Asp Gly Leu Arg 65 70 75 80 Thr Gly Asp Glu Ala Glu Tyr Phe Cys Gly Val Trp Asp Ser Ser Leu 85 90 95 Arg Ala Glu Leu Phe Ala Gly Gly Thr Lys Val Thr Val Leu Ser Gln 100 105 110 Pro Lys Ala Ala Pro Ser Val Thr Leu Phe Pro Pro Ser Ser Glu Glu 115 120 125 Leu Gln Ala Asn Lys Ala Thr Leu Val Cys Leu Ile Ser Asp Phe Tyr 130 135 140 Pro Gly Ala Val Thr Val Ala Trp Lys Ala Asp Ser Ser Pro Val Lys 145 150 155 160 Ala Gly Val Glu Thr Thr Thr Pro Ser Lys Gln Ser Asn Asn Lys Tyr 165 170 175 Ala Ala Ser Ser Tyr Leu Ser Leu Thr Pro Glu Gln Trp Lys Ser His 180 185 190 Lys Ser Tyr Ser Cys Gln Val Thr His Glu Gly Ser Thr Val Glu Lys 195 200 205 Thr Val Ala Pro Thr Glu Cys Ser 210 215 <210> 6 <211> 5 <212> PRT <213> Artificial sequence <220> <223> 3A10 mAb HCDR1 <400> 6 Asn Ala Trp Met Ser 1 5 <210> 7 <211> 17 <212> PRT <213> Artificial sequence <220> <223> 3A10 mAb HCDR2 <400> 7 Tyr Ile Ser Ser Ser Gly Ser Thr Ile Tyr Tyr Ala Asp Ser Val Lys 1 5 10 15 Gly <210> 8 <211> 9 <212> PRT <213> Artificial sequence <220> <223> 3A10 mAb HCDR3 <400> 8 Leu Ala Gly Pro Tyr Tyr Phe Asp Tyr 1 5 <210> 9 <211> 118 <212> PRT <213> Artificial sequence <220> <223> 3A10 mAb VH <400> 9 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asn Ala 20 25 30 Trp Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Tyr Ile Ser Ser Ser Gly Ser Thr Ile Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Leu Ala Gly Pro Tyr Tyr Phe Asp Tyr Trp Gly Gln Gly Thr 100 105 110 Leu Val Thr Val Ser Ser 115 <210> 10 <211> 448 <212> PRT <213> artificial sequence <220> <223> 3A10 mAb heavy chain <400> 10 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asn Ala 20 25 30 Trp Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Tyr Ile Ser Ser Ser Gly Ser Thr Ile Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Leu Ala Gly Pro Tyr Tyr Phe Asp Tyr Trp Gly Gln Gly Thr 100 105 110 Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val Phe Pro 115 120 125 Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala Leu Gly 130 135 140 Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp Asn 145 150 155 160 Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val Leu Gln 165 170 175 Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser Ser 180 185 190 Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys Pro Ser 195 200 205 Asn Thr Lys Val Asp Lys Lys Val Glu Pro Lys Ser Cys Asp Lys Thr 210 215 220 His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser 225 230 235 240 Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg 245 250 255 Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro 260 265 270 Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala 275 280 285 Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val 290 295 300 Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr 305 310 315 320 Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr 325 330 335 Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu 340 345 350 Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Thr Cys 355 360 365 Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser 370 375 380 Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp 385 390 395 400 Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser 405 410 415 Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala 420 425 430 Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys 435 440 445 <210> 11 <211> 14 <212> PRT <213> Artificial Sequence <220> <223> 3A10 HBiTE CD3 LCDR1 <400> 11 Arg Ser Ser Thr Gly Ala Val Thr Thr Ser Asn Tyr Ala Asn 1 5 10 <210> 12 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> 3A10 HBiTE CD3 LCDR2 <400> 12 Gly Ala Asn Lys Arg Ala Pro 1 5 <210> 13 <211> 9 <212> PRT <213> artificial sequence <220> <223> 3A10 HBiTE CD3 LCDR3 <400> 13 Ala Leu Trp Tyr Ser Asn Leu Trp Val 1 5 <210> 14 <211> 110 <212> PRT <213> artificial sequence <220> <223> 3A10 HBiTE CD3 VL <400> 14 Glu Ile Val Val Thr Gln Ser Pro Ala Thr Leu Ser Val Ser Pro Gly 1 5 10 15 Glu Arg Ala Thr Leu Ser Cys Arg Ser Ser Thr Gly Ala Val Thr Thr 20 25 30 Ser Asn Tyr Ala Asn Trp Val Gln Gln Lys Pro Gly Gln Ala Pro Arg 35 40 45 Gly Leu Ile Gly Gly Ala Asn Lys Arg Ala Pro Gly Val Pro Ala Arg 50 55 60 Phe Ser Gly Ser Leu Ser Gly Asp Glu Ala Thr Leu Thr Ile Ser Ser 65 70 75 80 Leu Gln Ser Glu Asp Phe Ala Val Tyr Tyr Cys Ala Leu Trp Tyr Ser 85 90 95 Asn Leu Trp Val Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys 100 105 110 <210> 15 <211> 559 <212> PRT <213> Artificial Sequence <220> <223> 3A10 HBiTE Light Chain <400> 15 Gln Ser Val Val Thr Gln Pro Pro Ser Val Ser Ala Ala Pro Gly Gln 1 5 10 15 Lys Val Thr Ile Ser Cys Ser Gly Ser Ser Ser Asn Ile Gly Asn Asn 20 25 30 Tyr Val Ser Trp Tyr Gln Gln Leu Pro Gly Thr Ala Pro Lys Leu Leu 35 40 45 Ile Tyr Asp Asn Asn Lys Arg Pro Ser Gly Ile Pro Asp Arg Phe Ser 50 55 60 Gly Ser Lys Ser Gly Thr Ser Ala Thr Leu Gly Ile Asp Gly Leu Arg 65 70 75 80 Thr Gly Asp Glu Ala Glu Tyr Phe Cys Gly Val Trp Asp Ser Ser Leu 85 90 95 Arg Ala Glu Leu Phe Ala Gly Gly Thr Lys Val Thr Val Leu Gly Ser 100 105 110 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Glu Ile Val Val Thr Gln 115 120 125 Ser Pro Ala Thr Leu Ser Val Ser Pro Gly Glu Arg Ala Thr Leu Ser 130 135 140 Cys Arg Ser Ser Thr Gly Ala Val Thr Thr Ser Asn Tyr Ala Asn Trp 145 150 155 160 Val Gln Gln Lys Pro Gly Gln Ala Pro Arg Gly Leu Ile Gly Gly Ala 165 170 175 Asn Lys Arg Ala Pro Gly Val Pro Ala Arg Phe Ser Gly Ser Leu Ser 180 185 190 Gly Asp Glu Ala Thr Leu Thr Ile Ser Ser Leu Gln Ser Glu Asp Phe 195 200 205 Ala Val Tyr Tyr Cys Ala Leu Trp Tyr Ser Asn Leu Trp Val Phe Gly 210 215 220 Gln Gly Thr Lys Leu Glu Ile Lys Arg Thr Val Ala Ala Pro Ser Val 225 230 235 240 Phe Ile Phe Pro Pro Ser Asp Glu Gln Leu Lys Ser Gly Thr Ala Ser 245 250 255 Val Val Cys Leu Leu Asn Asn Phe Tyr Pro Arg Glu Ala Lys Val Gln 260 265 270 Trp Lys Val Asp Asn Ala Leu Gln Ser Gly Asn Ser Gln Glu Ser Val 275 280 285 Thr Glu Gln Asp Ser Lys Asp Ser Thr Tyr Ser Leu Ser Ser Thr Leu 290 295 300 Thr Leu Ser Lys Ala Asp Tyr Glu Lys His Lys Val Tyr Ala Cys Glu 305 310 315 320 Val Thr His Gln Gly Leu Ser Ser Pro Val Thr Lys Ser Phe Asn Arg 325 330 335 Gly Glu Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser 340 345 350 Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg 355 360 365 Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro 370 375 380 Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala 385 390 395 400 Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val 405 410 415 Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr 420 425 430 Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr 435 440 445 Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu 450 455 460 Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Leu Cys 465 470 475 480 Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser 485 490 495 Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp 500 505 510 Ser Asp Gly Ser Phe Phe Leu His Ser Lys Leu Thr Val Asp Lys Ser 515 520 525 Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala 530 535 540 Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly 545 550 555 <210> 16 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> 3A10 HBiTE CD3 HCDR1 <400> 16 Gly Phe Thr Phe Asn Thr Tyr 1 5 <210> 17 <211> 8 <212> PRT <213> Artificial sequence <220> <223> 3A10 HBiTE CD3 HCDR2 <400> 17 Arg Ser Lys Tyr Asn Asn Tyr Ala 1 5 <210> 18 <211> 14 <212> PRT <213> Artificial sequence <220> <223> 3A10 HBiTE CD3 HCDR3 <400> 18 His Gly Asn Phe Gly Ser Ser Tyr Val Ser Tyr Phe Ala Tyr 1 5 10 <210> 19 <211> 125 <212> PRT <213> Artificial sequence <220> <223> 3A10 HBiTE CD3 VH <400> 19 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asn Thr Tyr 20 25 30 Ala Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Arg Ile Arg Ser Lys Tyr Asn Asn Tyr Ala Thr Tyr Tyr Ala Asp 50 55 60 Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asp Ser Lys Asn Thr 65 70 75 80 Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr 85 90 95 Tyr Cys Ala Arg His Gly Asn Phe Gly Ser Ser Tyr Val Ser Tyr Phe 100 105 110 Ala Tyr Trp Gly Gln Gly Thr Thr Val Thr Val Ser Ser 115 120 125 <210> 20 <211> 581 <212> PRT <213> Artificial Sequence <220> <223> 3A10 HBiTE Heavy Chain <400> 20 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asn Ala 20 25 30 Trp Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Tyr Ile Ser Ser Ser Gly Ser Thr Ile Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Leu Ala Gly Pro Tyr Tyr Phe Asp Tyr Trp Gly Gln Gly Thr 100 105 110 Leu Val Thr Val Ser Ser Gly Ser Gly Gly Ser Gly Gly Gly Gly Ser 115 120 125 Gly Gly Gly Gly Ser Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu 130 135 140 Val Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe 145 150 155 160 Thr Phe Asn Thr Tyr Ala Met Asn Trp Val Arg Gln Ala Pro Gly Lys 165 170 175 Gly Leu Glu Trp Val Ala Arg Ile Arg Ser Lys Tyr Asn Asn Tyr Ala 180 185 190 Thr Tyr Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp 195 200 205 Asp Ser Lys Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu 210 215 220 Asp Thr Ala Val Tyr Tyr Cys Ala Arg His Gly Asn Phe Gly Ser Ser 225 230 235 240 Tyr Val Ser Tyr Phe Ala Tyr Trp Gly Gln Gly Thr Thr Val Thr Val 245 250 255 Ser Ser Ala Ser Thr Lys Gly Pro Ser Val Phe Pro Leu Ala Pro Ser 260 265 270 Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala Leu Gly Cys Leu Val Lys 275 280 285 Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp Asn Ser Gly Ala Leu 290 295 300 Thr Ser Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu 305 310 315 320 Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser Ser Ser Leu Gly Thr 325 330 335 Gln Thr Tyr Ile Cys Asn Val Asn His Lys Pro Ser Asn Thr Lys Val 340 345 350 Asp Lys Lys Val Glu Pro Lys Ser Cys Pro Pro Cys Pro Ala Pro Glu 355 360 365 Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp 370 375 380 Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp 385 390 395 400 Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly 405 410 415 Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn 420 425 430 Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp 435 440 445 Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro 450 455 460 Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu 465 470 475 480 Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn 485 490 495 Gln Val Ser Leu Leu Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile 500 505 510 Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr 515 520 525 Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu His Ser Lys 530 535 540 Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys 545 550 555 560 Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu 565 570 575 Ser Leu Ser Pro Gly 580 <210> twenty one <211> 12 <212> PRT <213> Artificial sequence <220> <223> 3A10 HBiTE light chain connector <400> twenty one Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser 1 5 10 <210> twenty two <211> 15 <212> PRT <213> Artificial sequence <220> <223> 3A10 HBiTE rebinding adapter <400> twenty two Gly Ser Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser 1 5 10 15 <210> twenty three <211> 68 <212> DNA <213> Artificial sequence <220> <223> Primers <400> twenty three gaatgcggcc gcaaactaca agacagactt gcaaaagaag gcatgcacag ctcagcactg 60 ctctgttg 68 <210> twenty four <211> 62 <212> DNA <213> Artificial sequence <220> <223> Primers <400> twenty four tcagcactgc tctgttgcct ggtcctcctg actggggtga gggccgaggt gcagctggtg 60 62 <210> 25 <211> 47 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 25 cggtgggcat gtgtgagttt tgtcacaaga tttgggctca actttct 47 <210> 26 <211> 64 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 26 tcagcactgc tctgttgcct ggtcctcctg actggggtga gggcccagtc tgtcgtgacg 60 cagc 64 <210> 27 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 27 cgattctaga atcatgaaca ttctgtaggg gccactgtct tc 42 <210> 28 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> Primers <400> 28 gacaaaactc acacatgccc accg 24 <210> 29 <211> 38 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 29 cgattctaga atcatttacc cggggacagg gagaggct 38 <210> 30 <211> 68 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 30 gaatgcggcc gcaaactaca agacagactt gcaaaagaag gcatgcacag ctcagcactg 60 ctctgttg 68 <210> 31 <211> 46 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 31 gccagagcca cctccgccgg atcctaggac ggtcaccttg gtccct 46 <210> 32 <211> 32 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 32 ggatccgggg gttcaggcgg aggtggctct gg 32 <210> 33 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> Primers <400> 33 ggatccggcg gaggtggctc tggc 24 <210> 34 <211> 36 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 34 tgatctagaa ttaacccgga gacagggaga ggctct 36

Claims

1. An antibody or an antigen-binding fragment thereof that specifically binds to ENPP3, the antibody or the antigen-binding fragment thereof comprising a light chain variable region (VL) and a heavy chain variable region (VH), wherein the VL comprises LCDR 1-3 having amino acid sequences as shown in SEQ ID NOs: 1-3, respectively, and the VH comprises HCDR 1-3 having amino acid sequences as shown in SEQ ID NOs: 6-8, respectively.

2. An antibody or antigen-binding fragment thereof according to claim 1, wherein the VL comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:4, and the VH comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:

9.

3. The antibody or antigen-binding fragment thereof according to claim 2, wherein the VL comprises the amino acid sequence shown in SEQ ID NO:4 and the VH comprises the amino acid sequence shown in SEQ ID NO:

9.

4. The antibody or antigen-binding fragment thereof according to any one of claims 1 to 3, wherein the antibody is of an isotype selected from the group consisting of IgG, IgA, IgM, IgE and IgD.

5. The antibody or antigen-binding fragment thereof according to any one of claims 1 to 3, wherein the antibody belongs to a subtype selected from the group consisting of IgG1, IgG2, IgG3 and IgG4.

6. The antibody or antigen-binding fragment thereof according to any one of claims 1 to 5, wherein the antigen-binding fragment is selected from the group consisting of Fab, Fab', F(ab')2, Fv, scFv and ds-scFv.

7. The antibody or antigen-binding fragment thereof according to any one of claims 1 to 6, wherein the antibody is a monoclonal antibody.

8. An antibody or antigen-binding fragment thereof according to claim 7, wherein the antibody comprises a light chain and a heavy chain, wherein the light chain comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:5, and the heavy chain comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:

10.

9. The antibody or antigen-binding fragment thereof according to any one of claims 1 to 6, wherein the antibody is a bispecific antibody or a multispecific antibody.

10. The antibody or antigen-binding fragment thereof according to claim 9, wherein the antibody is a bispecific antibody further comprising a second antigen-binding region that binds to a second antigen.

11. The antibody or antigen-binding fragment thereof according to claim 10, wherein the second antigen is a tumor-associated antigen or an immune cell antigen.

12. The antibody or antigen-binding fragment thereof according to claim 11, wherein the second antigen is a T cell antigen.

13. The antibody or antigen-binding fragment thereof according to claim 12, wherein the T cell antigen is selected from the group consisting of T cell receptor (TCR), CD3, CD4, CD8, CD16, CD25, CD28, CD44, CD62L, CD69, ICOS, 41-BB (CD137) and NKG2D.

14. The antibody or antigen-binding fragment thereof according to claim 10, wherein the second antigen is CD3, and the second antigen-binding region comprises VL and VH, wherein the VL comprises LCDR 1-3 having the amino acid sequences shown in SEQ ID NOs: 11-13, respectively, and the VH comprises HCDR 1-3 having the amino acid sequences shown in SEQ ID NOs: 16-18, respectively.

15. An antibody or antigen-binding fragment thereof according to claim 14, wherein the second antigen-binding region comprises a VL and a VH, wherein the VL comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 14, and the VH comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:

19.

16. The antibody or antigen-binding fragment thereof according to claim 15, wherein the second antigen-binding region comprises VL and VH, the VL comprises the amino acid sequence shown in SEQ ID NO: 14, and the VH comprises the amino acid sequence shown in SEQ ID NO:

19.

17. The antibody or antigen-binding fragment thereof according to any one of claims 14 to 16, wherein the VL of the second antigen-binding region is optionally linked to the C-terminus of the VL of the antibody that specifically binds to ENPP3 via a first linker, and the VH of the second antigen-binding region is optionally linked to the C-terminus of the VH of the antibody that specifically binds to ENPP3 via a second linker, wherein the first linker and the second linker are the same or different.

18. The antibody or antigen-binding fragment thereof according to claim 17, wherein the first linker comprises the amino acid sequence shown in SEQ ID NO:21, and the second linker comprises the amino acid sequence shown in SEQ ID NO:

22.

19. The antibody or antigen-binding fragment thereof according to any one of claims 14 to 18, wherein the bispecific antibody comprises a light chain comprising an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 15, and a heavy chain comprising an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:

20.

20. The antibody or antigen-binding fragment thereof according to any one of claims 10 to 19, wherein the bispecific antibody is a bispecific T cell engager (BiTE).

21. A bispecific antibody or antigen-binding fragment thereof, comprising a first antigen-binding region comprising VL and VH that binds to ENPP3 and a second antigen-binding region comprising VL and VH that binds to CD3, wherein The VL of the first antigen-binding region comprises LCDRs 1-3 having amino acid sequences shown in SEQ ID NOs: 1-3, respectively, and the VH of the first antigen-binding region comprises HCDRs 1-3 having amino acid sequences shown in SEQ ID NOs: 6-8, respectively; and The VL of the second antigen-binding region comprises LCDR1-3 having the amino acid sequences shown in SEQ ID NOs: 11-13, respectively, and the VH of the second antigen-binding region comprises HCDR 1-3 having the amino acid sequences shown in SEQ ID NOs: 16-18, respectively.

22. The bispecific antibody or antigen-binding fragment thereof according to claim 21, wherein The VL of the first antigen binding region comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 4, and the VH of the first antigen binding region comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 9; and The VL of the second antigen-binding region comprises an amino acid sequence that has at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:14, and the VH of the second antigen-binding region comprises an amino acid sequence that has at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:

19.

23. The bispecific antibody or antigen-binding fragment thereof according to claim 22, wherein The VL of the first antigen-binding region comprises the amino acid sequence shown in SEQ ID NO:4, and the VH of the first antigen-binding region comprises the amino acid sequence shown in SEQ ID NO:9; and The VL of the second antigen-binding region comprises the amino acid sequence shown in SEQ ID NO:14, and the VH of the second antigen-binding region comprises the amino acid sequence shown in SEQ ID NO:

19.

24. A bispecific antibody or antigen-binding fragment thereof according to any one of claims 21 to 23, wherein the VL of the second antigen-binding region is optionally connected to the C-terminus of the VL of the first antigen-binding region via a first linker, and the VH of the second antigen-binding region is optionally connected to the C-terminus of the VH of the first antigen-binding region via a second linker, wherein the first linker and the second linker are the same or different.

25. The bispecific antibody or antigen-binding fragment thereof according to claim 24, wherein the first linker comprises the amino acid sequence shown in SEQ ID NO:21, and the second linker comprises the amino acid sequence shown in SEQ ID NO:

22.

26. The bispecific antibody or antigen-binding fragment thereof according to any one of claims 21 to 25, wherein the bispecific antibody comprises a light chain comprising an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 15, and a heavy chain comprising an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:

20.

27. The bispecific antibody or antigen-binding fragment thereof according to any one of claims 21 to 26, wherein the bispecific antibody is a bispecific T cell engager (BiTE).

28. A nucleic acid comprising a nucleotide sequence encoding the antibody or antigen-binding fragment thereof according to any one of claims 1 to 20 or the bispecific antibody or antigen-binding fragment thereof according to any one of claims 21 to 27.

29. A vector comprising a nucleic acid according to claim 28.

30. A host cell comprising a nucleic acid according to claim 28 or a vector according to claim 29.

31. A pharmaceutical composition comprising (i) an antibody or antigen-binding fragment thereof according to any one of claims 1 to 20, or a bispecific antibody or antigen-binding fragment thereof according to any one of claims 21 to 27; and (ii) a pharmaceutically acceptable carrier or excipient.

32. The pharmaceutical composition according to claim 31, further comprising a second therapeutic agent.

33. The pharmaceutical composition according to claim 32, wherein the second therapeutic agent is selected from the group consisting of an antibody, a chemotherapeutic agent and a small molecule drug.

34. A pharmaceutical composition according to claim 32 or 33, wherein the second therapeutic agent is selected from Bruton's tyrosine kinase (BTK) inhibitors, PI3K inhibitors, HDAC inhibitors, ERK inhibitors, MAPK inhibitors, PD-1 / PD-L1 inhibitors, LAG3 inhibitors, CTLA-4 inhibitors, TIGIT inhibitors, TIM3 inhibitors and glucocorticoids.

35. A conjugate comprising an antibody or antigen-binding fragment thereof according to any one of claims 1 to 20, or a bispecific antibody or antigen-binding fragment thereof according to any one of claims 21 to 27, and a chemical moiety conjugated thereto.

36. The conjugate according to claim 35, wherein the chemical moiety is selected from the group consisting of a therapeutic agent, a detectable moiety and an immunostimulatory molecule.

37. A method for treating cancer in a subject, the method comprising administering to the subject an effective amount of an antibody or antigen-binding fragment thereof according to any one of claims 1-20, a bispecific antibody or antigen-binding fragment thereof according to any one of claims 21-27, a pharmaceutical composition according to any one of claims 31-34, or a conjugate according to claim 35 or 36.

38. The method according to claim 37, wherein the cancer is an ENPP3-positive cancer.

39. The method according to claim 38, wherein the cancer is selected from the group consisting of mastocytosis, leukemia, renal cancer, lung cancer, gastric cancer, ovarian cancer, breast cancer, pancreatic cancer, colon cancer, colorectal cancer, bile duct cancer, liver cancer and Wilms' tumor.

40. The method according to any one of claims 37-39, further comprising administering to the subject a second therapeutic agent.

41. The method according to claim 40, wherein the second therapeutic agent is selected from the group consisting of an antibody, a chemotherapeutic agent, and a small molecule drug.

42. A method according to claim 40 or 41, wherein the second therapeutic agent is selected from Bruton's tyrosine kinase (BTK) inhibitors, PI3K inhibitors, HDAC inhibitors, ERK inhibitors, MAPK inhibitors, PD-1 / PD-L1 inhibitors, LAG3 inhibitors, CTLA-4 inhibitors, TIGIT inhibitors, TIM3 inhibitors and glucocorticoids.

Images