Application of combination of osimertinib and saquinavir in preparation of medicine for treating EGFR-TKI drug-resistant non-small cell lung cancer

Abstract

The invention provides application of osimertinib and saquinavir in preparation of a medicine for treating EGFR-TKI drug-resistant non-small cell lung cancer, and belongs to the technical field of biological medicine. According to the invention, osimertinib and saquinavir are combined for medication, the inhibition rate of EGFR-TKI resistant non-small cell lung cancer is obviously higher than that of single medication, the combined medication of osimertinib and saquinavir has a synergistic inhibition effect, and the inhibition efficiency is higher than that of osimertinib and rimonabant. The experimental result of the invention provides a theoretical basis for clinical drug combination of osimertinib and saquinavir and an effective scheme of NSCLC for treating EGFR-TKI drug resistance, and has a wide application prospect in the field of medicine and pharmacology.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to the use of osimertinib combined with saquinavir in the preparation of a drug for treating EGFR-TKI-resistant non-small cell lung cancer. Background Art

[0002] Non-small cell lung cancer (NSCLC) is a collection of all types of cancers originating from the lung epithelium except small cell lung cancer (SCLC). It is divided into three main subtypes according to different tissue structures: squamous cell carcinoma, adenocarcinoma, and large cell carcinoma. Epidermal growth factor receptor (EGFR) is a key factor controlling the growth and survival of epithelial cells. Its high expression or abnormal activation is associated with tumor progression and treatment resistance in a variety of cancers including non-small cell lung cancer (NSCLC). Therefore, it is often used in targeted therapy for epithelial malignancies.

[0003] Epidermal growth factor receptor inhibitor (EGFRi) is a small molecule inhibitor that blocks the kinase activity of EGFR by competing with ATP for the intracellular tyrosine kinase catalytic site of EGFR, thereby inhibiting the malignant proliferation of lung cancer cells. However, a large amount of clinical and experimental data show that after EGRFi treatment, most patients will develop acquired drug resistance.

[0004] Studies have shown that acquired T790M mutation is the most common cause of drug resistance in patients with advanced EGFR mutations, and most patients develop T790M mutations after first-line use of EGFRi. Currently, a variety of EGFR mutation-selective EGFRi have been developed to treat patients with acquired drug resistance due to T790M mutations, such as osimertinib (AZD9291). Osimertinib is a third-generation epidermal growth factor receptor tyrosine kinase inhibitor with a molecular formula of C 28 H 33 N 7 O 2 , the structural formula is as follows:

[0005]

[0006] However, despite the good initial response, patients treated with third-generation EGFR-TKIs still develop acquired resistance. Regarding the resistance to third-generation EGFR-TKIs, the secondary mutation of the EGFR gene in the secondary resistance mechanism that has been discovered is an important cause of resistance to third-generation EGFR (such as osimertinib). The potential resistance mutation sites discovered so far include C797S, L718, G796, L792, etc. In addition, compensatory activation of the bypass pathway can cause secondary resistance. For example, studies have found that MET gene amplification causes abnormal activation of AKT, promotes activation of the downstream mTOR pathway, and thus promotes tumor cell proliferation. In addition, abnormal upregulation of HER2, compensatory activation of the AXL pathway, and IGF1R-mediated AKT activation also play an important role in the secondary resistance of the third-generation EGFR. Although multiple resistance mechanisms have been discovered, the mechanism of secondary resistance to the third-generation EGFR in about one-third of cases is still unclear.

[0007] Based on the structure and activation mechanism of EGFR, the anti-NSCLC drugs targeting EGFR are mainly divided into two categories: monoclonal antibodies and small molecule kinase inhibitors. Among them, small molecule targeted drugs are mainly EGFR-TKI (EGFR tyrosine kinase inhibitors), and the mainstream drugs have developed to the third generation: the first generation erlotinib, gefitinib, etc., are aimed at the obvious driver mutations of EGFR, namely the deletion mutation of EGFR exon 19 (delE746-A750) and the point mutation of exon 21 (L858R); the second generation dacomitinib, afatinib, etc., because the efficacy has not been significantly improved compared with the first generation of drugs and the side effects are large, so they are not widely used in clinical practice; the third generation osimertinib (AZD9291), ametinib, ametinib, etc., are currently used as the first choice for selective treatment of EGFR sensitive mutations and T790M drug-resistant mutations NSCLC, using ATP analogs to block the phosphorylation of the intracellular domain to block the activation of the signaling pathway. The above TKI targeted therapies will become resistant after a "honeymoon period". Each generation of EGFR-TKI resistance has different mechanisms: the most common cause of resistance to first- and second-generation TKIs is T790M mutation (accounting for 50%); bypass amplification mainly based on MET and HER2; whether osimertinib is used as first-line or second-line, the drug resistance mechanism is mostly: MET amplification and C797S mutation. In addition, traditional chemotherapy, immunotherapy alone, and immunotherapy combined with chemotherapy and / or anti-angiogenic therapy are widely used in clinical research, but limited efficacy and safety issues have led to poor results.

[0008] Although the third-generation TKI (such as osimertinib) can partially solve (about 60%) the resistance problem of the first and second generation TKIs, resistance still occurs, and the mechanism is more complicated. Studies have shown that the resistance mechanism of the third-generation TKI can be generally divided into EGFR-dependent and EGFR-independent resistance. EGFR-dependent resistance refers to changes in the EGFR gene or protein itself (EGFR amplification, triple mutation, overexpression), which makes EGFR-TKIs unable to target and kill tumor cells. Among them, the incidence of C797S mutation is relatively low, accounting for only about 7% of all resistance mechanisms. EGFR-independent resistance is due to abnormal activation of carcinogenic pathways other than EGFR (histological transformation, bypass activation and downstream pathway changes), thereby achieving escape. Among them, MET amplification and MET protein overexpression are the most common resistance mechanisms in the bypass activation pathway, accounting for 15% of the resistance mechanisms. The MET gene, the full name of which is mesenchymal epithelial transition factor, encodes a synthetic protein c-Met, which is a receptor tyrosine kinase that binds to hepatocyte growth factor (HGF). HGF binds to the Sema domain of c-Met, causing dimerization and activation of c-Met, which then phosphorylates the tyrosine residues of multiple downstream proteins (such as Y1349 and Y1356), activating numerous downstream signaling pathways, such as PI3K-Akt, Ras-MAPK, STAT, and Wnt / β-catenin, thereby promoting cell proliferation, cell growth, cell migration, vascular invasion, and angiogenesis.

[0009] Since the probability of the human body developing drug resistance to a specific drug is high when a single drug is used, and the therapeutic effect is not ideal, anti-tumor drugs are often used in combination with antibodies, inhibitors, sensitizers, etc. in clinical practice to reduce the toxic and side effects of chemotherapy drugs and increase the anti-tumor effect of drugs. It has been reported that osimertinib and rimonabant are used in combination to treat non-small cell lung cancer. Summary of the invention

[0010] In view of this, the object of the present invention is to provide an application of osimertinib combined with saquinavir in the preparation of a drug for treating EGFR-TKI-resistant non-small cell lung cancer. The combined use of osimertinib and saquinavir has a significantly higher inhibition rate on EGFR-TKI-resistant non-small cell lung cancer than the use of either drug alone, and is higher than the inhibition efficiency of osimertinib and rimonabant.

[0011] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0012] The present invention provides an application of osimertinib combined with saquinavir in the preparation of a drug for treating epidermal growth factor receptor tyrosine kinase inhibitor-resistant non-small cell lung cancer.

[0013] Preferably, the epidermal growth factor receptor tyrosine kinase inhibitor-resistant non-small cell lung cancer is osimertinib-resistant non-small cell lung cancer.

[0014] Preferably, the molar ratio of osimertinib to saquinavir in the drug is 1:1-32.

[0015] Preferably, the drug further comprises a pharmaceutically acceptable carrier.

[0016] Preferably, the pharmaceutically acceptable carrier is a filler, a wetting agent, a binder, a disintegrant or a lubricant.

[0017] Preferably, the drug is in the form of oral tablets, granules, injections or capsules.

[0018] The present invention also provides a pharmaceutical composition for treating epidermal growth factor receptor tyrosine kinase inhibitor-resistant non-small cell lung cancer, the pharmaceutical composition comprising an effective dose of osimertinib and saquinavir.

[0019] Preferably, the molar ratio of osimertinib to saquinavir is 1:1-32.

[0020] Preferably, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier.

[0021] More preferably, the pharmaceutically acceptable carrier comprises a filler, a wetting agent, a binder, a disintegrant or a lubricant.

[0022] Compared with the prior art, the present invention has the following beneficial effects:

[0023] The present invention provides the use of osimertinib combined with saquinavir in the preparation of a drug for treating epidermal growth factor receptor tyrosine kinase inhibitor-resistant non-small cell lung cancer. Studies have shown that the inhibition rate of osimertinib combined with saquinavir on EGFR-TKI-resistant NSCLC cells is significantly higher than that of single drug use, and the combined use of the two has a synergistic inhibitory effect on EGFR-TKI-resistant NSCLC cells. Combined drug use has incomparable advantages over single drug use, and a smaller drug dose can achieve the therapeutic effect of single drug use, reduce the drug resistance of tumor cells, reduce the toxic and side effects caused by the drug, and has a broader application prospect. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 The proliferation inhibition rate of H1975 and EGFR (T790M / L858R / C797S) mutant cells with different concentrations of osimertinib combined with saquinavir and rimonabant;

[0025] Figure 2 is the proliferation inhibition rate of H1975 and EGFR (T790M / L858R / C797S) mutant cells by a fixed concentration of saquinavir combined with different concentrations of osimertinib;

[0026] Figure 3 The inhibition rate of proliferation of H1975 and EGFR (T790M / L858R / C797S) mutant cells by a fixed concentration of rimonabant combined with different concentrations of osimertinib;

[0027] Figure 4 This is the tumor morphology after saquinavir combined with osimertinib treatment;

[0028] Figure 5 This is the in vivo tumor growth curve after saquinavir combined with osimertinib treatment;

[0029] Figure 6 These are the results of the effect of saquinavir combined with osimertinib on in vivo tumor weight. DETAILED DESCRIPTION

[0030] The present invention provides an application of osimertinib combined with saquinavir in the preparation of a drug for treating epidermal growth factor receptor tyrosine kinase inhibitor-resistant non-small cell lung cancer. In the present invention, the epidermal growth factor receptor tyrosine kinase inhibitor-resistant non-small cell lung cancer is preferably osimertinib-resistant non-small cell lung cancer. In the present invention, saquinavir is an HIV protease inhibitor used for retrovirus research and is also an inhibitor of SARS-CoV 3CLpro. Saquinavir is a mature drug with relatively complete physicochemical parameters, pharmacokinetic and safety data. It has low toxicity to normal cells and good selectivity. The saquinavir molecular formula is C 38 H 50 N 6 O 5 , the structural formula is as follows:

[0031]

[0032] The test results of the present invention show that the combination of osimertinib and saquinavir can enhance the therapeutic effect of osimertinib, providing a basis for the new use of old drugs.

[0033] In the present invention, the molar ratio of osimertinib to saquinavir in the drug is preferably 1:1-32; the molar ratio is more preferably 1:4-18, and further preferably 1:6-10.

[0034] In the present invention, the drug also includes a pharmaceutically acceptable carrier. The present invention does not specifically limit the pharmaceutically acceptable carrier, and preferably includes but is not limited to a filler, a wetting agent, a binder, a disintegrant or a lubricant. The choice of the carrier should match the formulation form of the drug. The present invention does not specifically limit the formulation form of the drug, and it can be an oral tablet, granule, injection or capsule, etc. The present invention does not specifically limit the mode of administration, and injection, oral administration, application and the like can be conventionally selected according to the dosage form of the drug and actual needs.

[0035] The present invention also provides a pharmaceutical composition for treating epidermal growth factor receptor tyrosine kinase inhibitor-resistant non-small cell lung cancer, the pharmaceutical composition comprising an effective dose of osimertinib and saquinavir. In the present invention, the pharmaceutical composition further preferably comprises a pharmaceutically acceptable carrier; the pharmaceutically acceptable carrier includes but is not limited to a filler, a wetting agent, a binder, a disintegrant or a lubricant.

[0036] In the present invention, the molar ratio of osimertinib to saquinavir is preferably 1:1-32; the molar ratio is more preferably 1:4-18, and further preferably 1:6-10.

[0037] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0038] The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are commercially available products unless otherwise specified.

[0039] In the following examples, osimertinib was purchased from Selleck. Saquinavir was purchased from MCE. Rimonabant was purchased from MCE. Preparation of the cell culture medium: 500 mL of RPMI-1640 culture medium was divided into 45 mL portions in a clean bench, 5 mL of fetal bovine serum and 1% penicillin and streptomycin mixed antibiotics were added to each portion, and the mixture was stored in a 4°C refrigerator for later use.

[0040] Example 1

[0041] This example studies the inhibitory effect of osimertinib combined with saquinavir on the proliferation of osimertinib-resistant lung cancer NCI-H1975 and EGFR (T790M / L858R / C797S) mutant cells.

[0042] 1. Experimental materials

[0043] 1.1. NCI-H1975 cells were provided by the Chinese Academy of Sciences Stem Cell Bank. They are anchorage-dependent epithelial cells, and the growth medium is 1640 (containing 10% FBS). The adherent cells were cultured, grown, and proliferated to form a monolayer of cells. Lung adenocarcinoma H520 cells are EGFR protein-deficient cells, which were used to transfect EGFR (T790M / L858R / C797S) mutant plasmids. They are anchorage-dependent epithelial cells, and the growth medium is 1640 (containing 10% FBS). The adherent cells were cultured, grown, and proliferated to form a monolayer of cells.

[0044] The viral vector GV141 was purchased from Shanghai GeneChem Technology Co., Ltd.

[0045] 1.2. Construction of EGFR (T790M / L858R / C797S) mutant cells

[0046] (1) Using the GV141 plasmid as a vector and Takara's high-fidelity PCR amplification kit, the EGFR sequence with three mutation sites (the EGFR sequence with three mutation sites is the EGFR sequence GeneID: 1956NP_005219.2, where T at position 790 mutates to M, L at position 858 mutates to R, and C at position 797 mutates to S) was amplified, and restriction endonuclease sites (XhoI and KpnI) were introduced at both ends.

[0047] (2) Purification of target fragment: The PCR product was digested with XhoI and KpnI, and then the digestion product was recovered using the Kangwei Century Kit.

[0048] (3) Vector digestion and recovery: GV141 plasmid was digested with XhoI and KpnI, and the plasmid was recovered using the Biovix kit after 1% agarose gel electrophoresis.

[0049] (4) Ligation: The PCR digestion product and the plasmid digestion product were ligated with Takara's T4 DNA ligase at 4°C overnight, transformed into E. coli Dh5α competent cells, and then spread on LB solid culture medium containing 100 μg / mL ampicillin and cultured at 37°C overnight.

[0050] (5) Identification of transformants: Single colonies were picked and cultured overnight in LB liquid medium (containing 100 μg / mL ampicillin). Positive clones were initially screened by PCR, and positive plasmid GV141-EGFR (T790M / L858R / C797S) was extracted using a plasmid extraction kit; wherein, the forward primer of PCR was: GAGGACAGCATAGACGACA (SEQ ID NO. 1), and the reverse primer was: TTATTAGGAAAGGACAGTGGG (SEQ ID NO. 2).

[0051] (6) Plasmid sequencing identification: The positive plasmids were sent to Shanghai Bioengineering for sequencing. The sequencing results were compared by software to verify the correctness of the gene cloning.

[0052] (7) Plasmid transfection: The GV141 / Flag-EGFR (T790M / L858R / C797S) plasmid was transfected into H520 cells using liposome transfection reagent (purchased from Life Science). H520 cells themselves are EGFR protein-deficient cells and do not express EGFR. After 48 hours of transfection, they become exogenously constructed EGFR (T790M / L858R / C797S) 3 mutant (EGFR-3M) cells.

[0053] 2. Cell culture medium

[0054] 500 mL of RPMI-1640 culture medium was divided into 45 mL portions in a clean bench, 5 mL of fetal bovine serum and 1% penicillin and streptomycin mixed antibiotics were added to each portion, and the portions were stored in a 4°C refrigerator for later use.

[0055] 3. CCK8 method to determine cell proliferation inhibition rate

[0056] 3.1. Take NCI-H1975 and EGFR (T790M / L858R / C797S) mutant cells in the logarithmic growth phase and add 100 μL of culture medium to each well of a 96-well plate. 3 The cells were placed in a cell culture incubator for 24 h to allow the cells in the 96-well plate to adhere to the wall.

[0057] 3.2 Experimental and control group settings:

[0058] Experimental group 1 was added with different concentrations of osimertinib: 0.125, 0.25, 0.5, 1, 2, and 4 μmol / L (0.125, 0.25, 0.5, 1, 2, and 4 μmol of osimertinib per L of cell system, respectively);

[0059] Experimental group 2 was added with different concentrations of saquinavir 1.25, 2.5, 5, 10, 20, and 40 μmol / L (1.25, 2.5, 5, 10, 20, and 40 μmol of saquinavir per L of cell system, respectively);

[0060] Experimental group 3 was added with different concentrations of rimonabant 2, 4, 6, 8, 10, 20 μmol / L (2, 4, 6, 8, 10, 20 μmol of rimonabant per L of cell system, respectively);

[0061] Experimental group 4 was treated with different concentrations of combined drugs, including 0.125 μmol / L osimertinib + 1.25 μmol / L saquinavir (0.125 μmol of osimertinib and 1.25 μmol of saquinavir per L of cell system), 0.25 μmol / L osimertinib + 2.5 μmol / L saquinavir, 0.5 μmol / L osimertinib + 5 μmol / L saquinavir, 1 μmol / L osimertinib + 10 μmol / L saquinavir, 2 μmol / L osimertinib + 20 μmol / L saquinavir, and 4 μmol / L osimertinib + 40 μmol / L saquinavir.

[0062] Experimental group 5 was added with different concentrations of combined drugs, 0.125 μmol / L osimertinib + 2 μmol / L rimonabant (each L of cell system contained 0.125 μmol of osimertinib and 2 μmol of rimonabant), 0.25 μmol / L osimertinib + 4 μmol / L rimonabant, 0.5 μmol / L osimertinib + 6 μmol / L rimonabant, 1 μmol / L osimertinib + 8 μmol / L rimonabant, 2 μmol / L osimertinib + 10 μmol / L rimonabant, 4 μmol / L osimertinib + 20 μmol / L rimonabant;

[0063] The culture medium containing DMSO (less than 0.1%) was used as the control group; the culture medium was used as the blank group. After 48 hours of action, 10 μL CCK-8 solution was added to each well of each group, and after incubation for 2 hours, the OD value at a wavelength of 450 nm was detected by an ELISA instrument, and finally the cell proliferation rate after drug treatment was calculated by GraphPadPrism 8.0.

[0064] according to Figure 1 The experimental results show that after 48 hours of combined use of osimertinib and saquinavir or osimertinib and rimonabant on NCI-H1975 osimertinib-resistant cells, the inhibitory effect on cell proliferation was significantly enhanced with the increase of drug concentration, and the inhibitory effect on the proliferation of NCI-H1975 cells was concentration-dependent. This effect was also seen in EGFR (T790M / L858R / C797S) 3 mutant cells.

[0065] Example 2

[0066] This example studies the inhibitory effect of osimertinib combined with saquinavir on the proliferation of osimertinib-resistant lung cancer NCI-H1975 and EGFR (T790M / L858R / C797S) mutant cells.

[0067] 1. Experimental materials

[0068] 1.1. NCI-H1975 cells were provided by the Chinese Academy of Sciences Stem Cell Bank. They are anchorage-dependent epithelial cells, and the growth medium is 1640 (containing 10% FBS). The adherent cells were cultured, grown, and proliferated to form a monolayer of cells. Lung adenocarcinoma H520 cells are EGFR protein-deficient cells, which were used to transfect EGFR (T790M / L858R / C797S) mutant plasmids. They are anchorage-dependent epithelial cells, and the growth medium is 1640 (containing 10% FBS). The adherent cells were cultured, grown, and proliferated to form a monolayer of cells.

[0069] 1.2. The method for constructing EGFR (T790M / L858R / C797S) mutant cells is the same as in Example 1.

[0070] 2. Cell culture medium

[0071] The method for preparing the cell culture medium is the same as that in Example 1.

[0072] 3. CCK8 method to determine cell proliferation inhibition rate

[0073] The determination method is the same as in Example 1.

[0074] The experimental groups were set up as follows:

[0075] Experimental group 1 was added with different concentrations of osimertinib: 0.125, 0.25, 0.5, 1, 2, and 4 μmol / L (0.125, 0.25, 0.5, 1, 2, and 4 μmol of osimertinib per L of cell system, respectively);

[0076] In experimental group 2, different concentrations of osimertinib (0.125, 0.25, 0.5, 1, 2, and 4 μmol / L) were used in combination with saquinavir 4 μmol / L to act on NCI-H1975 cells.

[0077] According to Table 1 and Figure 2 The experimental results show that the inhibition rate of the combination of osimertinib and saquinavir on NCI-H1975 osimertinib-resistant cells is significantly higher than that of the single drug group. The IC 50 The value was 2.0158 μM, and the IC of osimertinib in the combination group 50 The value is 0.4931μM ( Figure 2 A). IC of osimertinib alone in H520+EGFR(T790M / L858R / C797S)3 mutant cells 50 The value was 3.1691 μM, and the IC of osimertinib in the combination group 50 The value is 0.9466μM ( Figure 2 B). That is, osimertinib combined with saquinavir has a synergistic inhibitory effect on NCI-H1975 and EGFR (T790M / L858R / C797S) 3 mutant cells.

[0078] Table 1 In vitro cytotoxicity of osimertinib combined with saquinavir on H1975 cells (n=3)

[0079] drug AZD9291 AZD9291+Saquinavir (4 μM) <![CDATA[H1975 / IC 50 ]]> 2.0158±1.4 0.4931±1.5 <![CDATA[H520+EGFR(T790M / L858R / C797S) / IC 50 ]]> 3.1691±1.6 0.9466±0.7

[0080] Note: IC 50 Half maximal inhibitory concentration refers to the concentration at which the drug inhibits biological activity by 50% under certain conditions.

[0081] Comparative Example 1

[0082] This comparative study investigated the inhibitory effect of osimertinib combined with rimonabant on the proliferation of osimertinib-resistant lung cancer NCI-H1975 and EGFR (T790M / L858R / C797S) mutant cells.

[0083] 1. Experimental materials

[0084] 1.1. NCI-H1975 cells were provided by the Chinese Academy of Sciences Stem Cell Bank. They are anchorage-dependent epithelial cells, and the growth medium is 1640 (containing 10% FBS). The adherent cells were cultured, grown, and proliferated to form a monolayer of cells. Lung adenocarcinoma H520 cells are EGFR protein-deficient cells, which were used to transfect EGFR (T790M / L858R / C797S) mutant plasmids. They are anchorage-dependent epithelial cells, and the growth medium is 1640 (containing 10% FBS). The adherent cells were cultured, grown, and proliferated to form a monolayer of cells.

[0085] 1.2. The method for constructing EGFR (T790M / L858R / C797S) mutant cells is the same as that in Example 1.

[0086] 2. Cell culture medium

[0087] The method for preparing the cell culture medium is the same as that in Example 1.

[0088] 3. CCK8 method to determine cell proliferation inhibition rate

[0089] The determination method is the same as in Example 1.

[0090] The experimental groups were set up as follows:

[0091] Experimental group 1 was added with different concentrations of osimertinib: 0.125, 0.25, 0.5, 1, 2, and 4 μmol / L (0.125, 0.25, 0.5, 1, 2, and 4 μmol of osimertinib per L of cell system, respectively);

[0092] In experimental group 2, different concentrations of osimertinib (0.125, 0.25, 0.5, 1, 2, and 4 μmol / L) were used in combination with 6 μmol / L of rimonabant to act on NCI-H1975 and EGFR (T790M / L858R / C797S) mutant cells.

[0093] according to Figure 3 The experimental results in Table 2 show that the inhibition rate of the combination of osimertinib and rimonabant on NCI-H1975 osimertinib-resistant cells was significantly higher than that of the single drug group. The IC 50 The value was 2.3709 μM, and the IC of osimertinib in the combination group 50 The value is 1.9832μM ( Figure 3 A). IC of osimertinib alone in H520+EGFR(T790M / L858R / C797S)3 mutant cells 50 The value was 2.9857 μM, and the IC of osimertinib in the combination group 50 The value is 2.0354μM ( Figure 3 B). That is, osimertinib combined with rimonabant has a synergistic inhibitory effect on NCI-H1975 and EGFR (T790M / L858R / C797S) 3 mutant cells.

[0094] Table 2 In vitro cytotoxicity of osimertinib combined with rimonabant on H1975 cells (n=3)

[0095] drug AZD9291 AZD9291+Rimonabant (6μM) <![CDATA[H1975 / IC 50 ]]> 2.3709±1.7 1.8832±1.1 <![CDATA[H520+EGFR(T790M / L858R / C797S) / IC 50 ]]> 2.9857±2.0 2.0354±2.8

[0096] Note: IC 50 Half maximal inhibitory concentration refers to the concentration at which the drug inhibits biological activity by 50% under certain conditions.

[0097] According to the results of Example 2 and Comparative Example 1, osimertinib combined with saquinavir has a better inhibitory effect on NCI-H1975 cells, and is superior to the combined effect of rimonabant.

[0098] Example 3

[0099] This example studies the effect of saquinavir combined with osimertinib in inhibiting tumor proliferation activity in vivo

[0100] In this example, nude mouse tumor bearing experiment was used to determine the in vivo anti-tumor activity of saquinavir: H1975 cells were inoculated subcutaneously in the right axilla of balb / c nude mice, and the tumors were grown to 100 mm. 3 The animals were then randomly divided into a blank control group and a treatment group. Treatment group 1 was given osimertinib 5 mg / kg, administered orally once every 2 days, 0.1 mL each time. Treatment group 2 was given osimertinib 5 mg / kg, and 5 mg / kg saquinavir 0.2 mL was intraperitoneally injected once every 2 days. The blank control group was injected with an equal volume of normal saline. After administration, the body weight and tumor volume of the mice were measured daily, and the anti-tumor effect of the compound was dynamically observed. After 7 doses, the mice were killed, the tumor mass was surgically removed and weighed, and the relative tumor volume V (mm 3 ).

[0101] Figure 4 To investigate the in vivo antitumor activity of osimertinib alone and osimertinib combined with saquinavir. Figure 5 is the anti-tumor growth curve of H1975 in vivo, Figure 6 Figure 2 is a graph of H1975 tumor weight in vivo. Figures 4 to 6 As shown, osimertinib combined with saquinavir can more significantly inhibit the growth of H1975 tumor cells in nude mice and has good in vivo antitumor activity.

[0102] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. The application of osimertinib combined with saquinavir in the preparation of drugs for the treatment of non-small cell lung cancer resistant to epidermal growth factor receptor tyrosine kinase inhibitors.

2. The use according to claim 1, characterized in that: The epidermal growth factor receptor tyrosine kinase inhibitor-resistant non-small cell lung cancer is osimertinib-resistant non-small cell lung cancer.

3. The use according to claim 1, characterized in that: The molar ratio of osimertinib to saquinavir in the drug is 1:1-32.

4. The use according to claim 1, characterized in that: The medicament further includes a pharmaceutically acceptable carrier.

5. The use according to claim 1, characterized in that: The pharmaceutically acceptable carrier includes a filler, a wetting agent, a binder, a disintegrant or a lubricant.

6. The use according to claim 1, characterized in that: The drug is in the form of oral tablets, granules, injections or capsules.

7. A pharmaceutical composition for treating epidermal growth factor receptor tyrosine kinase inhibitor-resistant non-small cell lung cancer, characterized in that: The pharmaceutical composition comprises an effective dose of osimertinib and saquinavir.

8. The pharmaceutical composition according to claim 7, characterized in that The molar ratio of osimertinib to saquinavir is 1:1-32.

9. The pharmaceutical composition according to claim 7, characterized in that The pharmaceutical composition also includes a pharmaceutically acceptable carrier.

10. The pharmaceutical composition according to claim 9, characterized in that The pharmaceutically acceptable carrier includes a filler, a wetting agent, a binder, a disintegrant or a lubricant.

Images