Lentiviral vectors for delivery of PKLR to treat pyruvate kinase deficiency

Abstract

The present disclosure provides polynucleotide cassettes, expression vectors, and methods for expressing genes in mammalian cells to provide gene therapy against pyruvate kinase deficiency.

Description

[0001] This application is a divisional application. The application number of the parent application is 201880064224.5, the application date is October 16, 2018, and the name of the invention is “Lentiviral vector for delivering PKLR to treat pyruvate kinase deficiency”.

[0002] CROSS-REFERENCE TO RELATED APPLICATIONS

[0003] This application claims priority to U.S. Provisional Application No. 62 / 573,037, filed on October 16, 2017, which is incorporated herein by reference in its entirety.

[0004] Instructions for electronically submitted text documents

[0005] The sequence listing associated with this application is provided in text format in lieu of a paper copy and is incorporated into this specification by reference. The name of the text file containing the sequence listing is ROPA_004_01WO_SeqList_ST25.txt. The text file is 29KB, created on October 15, 2018 and submitted electronically via EFS-Web. Technical Field

[0006] The present invention relates to gene therapy for pyruvate kinase deficiency. Background Art

[0007] Pyruvate kinase deficiency (PKD) is a monogenic metabolic disease caused by mutations in the PKLR gene that results in hemolytic anemia with variable symptoms and can be fatal in the neonatal period. The recessive genetic characteristics of PKD and its curative treatment by allogeneic bone marrow transplantation provide an ideal scenario for the development of gene therapy approaches.

[0008] Among many other hereditary enzyme defects affecting red blood cells, pyruvate kinase deficiency (PKD) is the most common disease causing chronic non-spherocytic hemolytic anemia (CNSHA) (Zanella et al., 2007). The onset and severity of PKD vary greatly, and range from mild to severe neonatal anemia, which can be fatal in childhood in the most serious cases (Pissard et al., 2006). Low-frequency growth retardation, fetal hydrops and neonatal death (Gilsanz et al., 1993) have also been reported. It is estimated that the PKD prevalence is 1:20,000 (Beutler et al., 2000) in the general Caucasian population, and so far, more than 195 different mutations have been identified in the PKLR gene (http: / / www.lovd.nl / pklr).

[0009] Allogeneic bone marrow transplantation (BMT) has been successfully used to cure severe PKD patients (Tanphaichitr et al., 2000), but the low availability of tissue compatible donors and the severe complications associated with BMT in these patients (i.e., graft-versus-host disease, opportunistic infections, etc.) make regular blood transfusions and splenectomy the main treatment options for most severe forms of PKD (Zanella et al., 2005), thereby significantly increasing patient morbidity and mortality (Hilgard et al., 2005). The limited efficacy and side effects of treatment options for severe PKD patients and its recessive genetic characteristics make PKD a suitable disease for treatment by gene therapy.

[0010] PKD is caused by a defect in the pyruvate kinase (PK) enzyme, which catalyzes the final ATP-generating reaction of the glycolytic pathway in all cells (Zanella, 2005). In mature erythrocytes, PK becomes essential (Kanno et al., 1992) because RBCs express only the R-type-specific isoform (RPK) due to regulation of the erythroid-specific alternative promoter of the PKLR locus (Noguchi et al., 1987). Therefore, any loss of RPK activity will impair RBC metabolism and lifespan (Zanella, 2005), leading to CNSHA.

[0011] One promising approach to treat and prevent genetic and other diseases and disorders is to deliver therapeutic agents with gene therapy vectors. Currently, viral vectors show the greatest efficiency in gene transfer, and for the correction of genetic diseases requiring sustained gene expression, vectors based on herpes viruses, retroviruses, lentiviruses, adenoviruses, or AAV are desirable due to the integrative nature of the viral life cycle.

[0012] Gene therapy for monogenic diseases, specifically those affecting the hematopoietic system, has provided compelling evidence that gene correction of autologous hematopoietic stem cells (HSCs) is an alternative therapeutic option to allogeneic HSCT, thereby avoiding its major complications (Cartier et al., 2009; Cavazzana-Calvo et al., 2010; Cartier et al., 2012; Aiuti et al., 2013; Biffi et al., 2013). Gene correction of diseases affecting erythrocytes, such as β-thalassemia and sickle cell disease, has been addressed in animal models (Pestina et al., 2009; Breda et al., 2012) and humans (Cavazzana-Calvo et al., 2010). However, gene therapy approaches for inherited erythroid metabolic defects, such as PKD, remain limited.

[0013] The feasibility of HSC gene therapy for PKD has been demonstrated in experimental models of mouse (Tani et al., 1994; Meza et al., 2009) and canine PKD deficiency (Trobridge et al., 2012), suggesting that the level of donor chimerism or genetically modified cells is a critical point to achieve effective correction of the hemolytic phenotype (Richard et al., 2004), given the selective advantage of lacking genetically corrected HSCs. Previous work with PKD mouse models showed that retrovirally derived human RPK expression was able to fully correct the PKD phenotype when more than 25% of the genetically corrected cells were transplanted (Meza et al., 2009). A similar therapeutic threshold of corrected cells was recently reported for a PKD Basenji dog infused in vivo with HSCs corrected with expandable and foamy vectors (Trobridge et al., 2012).

[0014] There are still many challenges in designing polynucleotide boxes and expression vectors for gene therapy. A major challenge is to obtain sufficient expression of the transgene in the target cell. An unmet need that has long existed in the art is the sufficiently robust expression of the transgene after gene transfer. In some cases, the efficacy of certain vectors (e.g., plasmid DNA vectors) requires more effective expression. In other cases, it is desirable to allow more effective gene expression cassettes with less therapeutic doses, which have more favorable safety characteristics or less invasive administration routes.

[0015] When using gamma-retroviral (γ-RV) vectors, high levels of transgene expression can be achieved due to the fact that therapeutic transgene expression is regulated by its long terminal repeats (LTRs). However, the first clinical trials based on this type of vector raised safety concerns, as several patients developed unexpected leukemias (Hacein-Bey-Abina et al., 2008). The strong promoter activity of LTRs can affect the regulation of surrounding genes by activating proto-oncogene promoters or by repressing tumor suppressor genes, leading to insertional mutagenesis (Ott et al., 2006; Howe et al., 2008; Stein et al., 2010; Braun et al., 2014). These findings highlight the need to use safer and more effective vectors than γ-RV vectors for PKD gene therapy. Summary of the invention

[0016] In one embodiment, the present invention provides an expression cassette, the expression cassette comprising a polynucleotide sequence, the polynucleotide sequence comprising: a) a promoter sequence; b) a sequence encoding a gene product; and c) a ribonucleic acid (RNA) export signal, wherein the promoter sequence is operably linked to the sequence encoding a pyruvate kinase polypeptide, and optionally, wherein a)-c) are present in the expression cassette in a 5' to 3' order. In certain embodiments, the promoter is a phosphoglycerate kinase (PGK) promoter. In some embodiments, the gene product is a therapeutic gene product. In some embodiments, the therapeutic gene product is a pyruvate kinase (PK) polypeptide, optionally a pyruvate kinase, liver and erythrocyte (PKLR) polypeptide. In certain embodiments, the sequence encoding the gene product is codon optimized. In some embodiments, the sequence encoding the gene product is a codon optimized version of human pyruvate kinase cDNA, and the human pyruvate kinase cDNA has at least 85% identity with SEQ ID NO: 8. In certain embodiments, the RNA export signal is a mutated woodchuck hepatitis virus post-transcriptional regulatory element (wPRE).

[0017] In certain embodiments, the mutated wPRE is a chimeric wPRE comprising a sequence having at least 80% identity to SEQ ID NO: 24. In some embodiments, the expression cassette further comprises one or more enhancer sequences. In some embodiments, the expression cassette further comprises a polypurine tract (PPT) or a polyadenylation (polyA) signal sequence. In some embodiments, the expression cassette further comprises one or more of the following sequences: i) a packaging signal sequence; ii) a truncated Gag sequence; iii) a Rev response element (RRE); iv) a central polypurine tract (cPPT); v) a central terminal sequence (CTS); and vi) an upstream sequence element (USE), optionally from Simian Virus 40 (SV40-USE). In some embodiments, the expression cassette further comprises 5' and 3' long terminal repeat (LTR) sequences.

[0018] In a related embodiment, the present invention provides a recombinant gene delivery vector comprising an expression cassette disclosed herein. In certain embodiments, the recombinant gene delivery vector is a virus or a viral vector. In certain embodiments, the virus or viral vector is a lentivirus (LV).

[0019] In another related embodiment, the invention provides a cell comprising an expression cassette or gene delivery vector disclosed herein. In some embodiments, the cell is a blood cell. In some embodiments, the cell is an erythroid cell. In some embodiments, the cell is a bone marrow cell, such as a lineage-depleted bone marrow cell. In some embodiments, the cell is a hematopoietic stem cell. In some embodiments, the cell is a CD34+ hematopoietic stem cell. In some embodiments, the cell is a committed hematopoietic erythroid progenitor cell.

[0020] In yet another related embodiment, the present invention provides a pharmaceutical composition comprising a pharmaceutically acceptable excipient and a recombinant gene delivery vector or cell disclosed herein.

[0021] In another embodiment, the invention provides a method for treating or preventing a disease or condition in a subject in need thereof, the method comprising providing an expression cassette, a gene delivery vector or a pharmaceutical composition disclosed herein to the subject. In one embodiment, the disease or condition is PKD, and the gene product is a PK polypeptide, optionally a PKLR polypeptide. In certain embodiments, the pharmaceutical composition comprises the recombinant gene delivery vector. In other embodiments, the pharmaceutical composition comprises the cell. In one embodiment, the cell is autologous to the subject.

[0022] In a related embodiment, the present invention provides a method for expressing a transgene in an erythroid cell, the method comprising contacting one or more erythroid cells with an effective amount of a recombinant viral vector, wherein the vector comprises a human PGK promoter, a codon-optimized version of a human PKLR cDNA transgene, and a mutated wPRE, wherein upon contacting, PKLR is expressed at a detectable level in the one or more erythroid cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] The novel features of the present disclosure are particularly set forth in the appended claims. A better understanding of the features and advantages of the present invention will be obtained by reference to the following detailed description setting forth illustrative embodiments in which the principles of the invention are utilized, and in the accompanying drawings:

[0024] Figure 1 Depicted is a scheme reflecting the location of the different elements present in the backbone of an illustrative LV vector.

[0025] Figure 2ASchematic representation of illustrative self-inactivating (SIN) LV vectors used throughout the gene therapy experiments, carrying the human PGK promoter regulating expression of the EGFP transgene in a control vector (upper panel) or expression of a codon-optimized PKLR gene cDNA sequence (coRPK) in a therapeutic gene (lower panel).

[0026] Figure 2B Schematic diagram of the gene therapy protocol performed to address the function of the developed PGK-coRPK LV vector.

[0027] Figures 3A-3D Depicted are data showing correction of the PKD phenotype in the peripheral blood of primary recipients after gene correction. Figure 3A and 3B RBC and reticulocyte levels in healthy (black bars, n=5) and PKD anemic mice (grey bars, n=6) and PKD anemic mice transplanted with EGFP (white bars, n=9) or coRPK transduced cells (dotted bars, n=17) are shown, respectively. Data are expressed as mean ± SEM and analyzed by nonparametric Kruskal-Wallis test. Figure 3C The flow cytometry strategy used to detect biotin-labeled RBCs over time is shown. Figure 3D RBC survival kinetics of healthy (black line, n=2), anemic (grey line, n=2) and genetically corrected mice (discontinuous line, n=4) are shown. Data are expressed as mean ± SEM and analyzed by two-way ANOVA test. Healthy, non-transplanted control mice; PKD, non-transplanted PKD mice; coRPK, PKD mice expressing a therapeutic transgene.

[0028] Figures 4A-4C Multilineage hematopoietic reconstitution in secondary transplanted mice is shown. Figure 4A is a diagram of the flow cytometry strategy used to identify different hematopoietic lineages by labeling with CD3-PE, B220-PE, B220-PECy5, Gr1-biotin, and Mac1-biotin antibodies plus SAV-PE-Cy5. Figure 4B Representative dot plots are depicted, and Figure 4C Depicted are the percentages of each lineage in PB at day 140 post-transplantation. Bars represent mean percentages ± SEM of healthy (n=2, black bars) and PKD mouse (n=2, gray bars) controls and secondary transplanted mice expressing the coRPK therapeutic transgene (n=4, dashed bars).

[0029] Figures 5A-5D Correction of the PKD phenotype in secondary transplanted mice is depicted. Figure 5AShown are brilliant cresyl blue staining of blood smears from non-transplanted mice and secondary recipients to identify the reticulocyte population (blue). Figure 5B It is a flow cytometric analysis of reticulocyte levels in peripheral blood. Figure 5C represents the RBC percentage, and Figure 5D Reticulocyte percentages in secondary transplanted mice expressing the coRPK transgene (barred lines, n=4), healthy mice (black bars, n=3), and anemic control mice (grey bars, n=3) are shown. Data are expressed as mean ± SEM and analyzed by nonparametric two-tailed Mann-Whitney test.

[0030] Figures 6A-6C Quantification of proviral integration is shown. Fig. 6A The vector copy number per cell in BM CFU from a single transplanted mouse at days 120 to 170 after transplantation is shown. Also shown are the percentages of transduction and chimerism. Figure 6B Proviral copy numbers in cells from different hematopoietic compartments are shown. Bars represent mean ± SEM of different groups of transplanted mice. Figure 6C Shown are the kinetics of proviral integration in BM cells from single transplanted EGFP-expressing mice (grey lines) and mice carrying the coRPK transgene (black lines).

[0031] Figures 7A-7C Depicted is the normalization of erythroid differentiation pattern in genetically corrected mice. Fig. 7A Shown are the percentages of different erythroid subsets in the bone marrow and spleen at 140 days after transplantation. Figure 7B Representative dot plots of the flow cytometry strategy used are depicted. The expression intensity of CD71 and Ter119 markers allowed the identification of four erythroid subsets: Cluster I: Early proerythroid cells (Ter119 med CD71 高 ), Group II: basophilic erythroblasts (Ter119 高 CD71 高 ), Group III: late basophilic and polychromatic erythroblasts (Ter119 高 CD71 med ) and group IV: normochromic erythroblasts, reticulocytes and mature erythrocytes (Ter119 高 CD71 低 ). Figure 7CPlasma Epo levels measured by ELISA in non-transplanted and transplanted mice are shown. Points represent values ​​for individual mice. Lines represent mean ± SEM and were analyzed by nonparametric Kruskal-Wallis test. Healthy, non-transplanted control mice; PKD, non-transplanted PKD mice; EGFP, PKD mice expressing EGFP transgene; coRPK, PKD mice expressing therapeutic transgene.

[0032] Figures 8A-8B Hematopoietic progenitor cell assays in control mice and mice transplanted with transduced cells are shown. Data show hematopoietic progenitor cell assays in control mice and mice transplanted with transduced cells ... Fig. 8A ) and bone marrow ( Figure 8B ) of the total CFU. Points represent the number of colonies per mouse analyzed, and lines represent the mean ± SEM of each group. Data were statistically analyzed by nonparametric Kruskal-Wallis test.

[0033] Figures 9A-9C Shown is the reversal of splenomegaly and organ pathology in gene-corrected mice 140 days after transplantation. Fig. 9A A picture of a representative spleen is shown, and Fig. 9B The ratio of spleen weight to total body weight from primary and secondary transplanted PKD mice is shown. Points represent values ​​for individual mice. Lines represent mean ± SEM for each group. Data were analyzed by nonparametric Kruskal-Wallis test. Fig. 9C Histological studies of spleens and livers from primary transplanted PKD mice are shown. The first and second columns show representative tissue sections of the spleen and liver stained with hematoxylin-eosin and photographed under an optical microscope using 4× and 10× objectives, respectively. Arrows point to clusters of erythroid cells indicating extramedullary erythropoiesis. The third column shows Prussian blue staining (Fe) of liver sections to detect iron deposits indicated by arrows. The photograph was taken with a 20× objective. A group of images is shown in Figure 7. Second-generation coRPK, second-generation recipient.

[0034] Figures 10A-10G Metabolic profiles in RBC samples from mice transplanted with genetically modified cells are depicted. Significant metabolic profile changes in healthy and transplanted mice were analyzed by comparison with PKD animals in two independent experiments. Fig. 10A A heat map of the entire RBC obtained by non-targeted profiling is shown, with higher and lower metabolite levels represented in red and blue, respectively. The listed metabolites have at least one comparison that is significant using the following criteria: absolute fold change > 1.5; minimum signal > 2000; adjusted p-value < 0.01. Black boxes highlight clusters of metabolite changes with different profiles between groups. Fig. 10B , 10C10D and 10D depict ATP, ADP and pyruvate levels in RBCs, respectively, as measured by non-targeted profiling, compared to PKD mice at 140 days post-transplantation. Assay 1: healthy mice (black bars) n=1, PKD (grey bars) n=1, hPGK-EGFP (white bars) n=2, hPGK-coRPK (crossed bars) n=3. Assay 2: healthy mice n=2, PKD n=2, hPGK-EGFP n=6, hPGK-coRPK n=10. Fig.10E , 10F and 10G depict RBC-targeted metabolic profiles of a selected number of metabolites involved in the glycolytic pathway (PEP, 3-phosphoglycerate, and D-lactate, respectively) at 280 days after transplantation. Points represent values ​​for individual mice. Lines represent mean ± SEM and were analyzed by nonparametric Kruskal-Wallis test. Assay 2: healthy mice n=7, PKD n=5, hPGK-EGFP n=3, hPGK-coRPK n=5.

[0035] Figures 11A-11C Pyruvate kinase activity, hexokinase activity, and the ratio of pyruvate kinase to hexokinase enzyme activity in RBCs from control mice and mice transplanted with transduced cells are depicted, respectively. RBCs were purified from blood samples by cellulose columns to avoid contamination with leukocyte PK activity, and enzyme activity was evaluated. Black bars, healthy mice (n=2); white bars, mice transplanted with cells transduced with an EGFP-expressing vector (n=3); dashed bars, mice transplanted with cells transduced with a coRPK-expressing vector (n=3). The checkered bars represent values ​​from healthy volunteers (n=1). The data represent the mean ± SEM of each group.

[0036] Figures 12A-12D Shown is the non-targeted metabolic profile in WBC samples from mice transplanted with genetically modified cells. Fig. 12A Principal component analysis of non-targeted metabolic profiles in RBCs (red dots; left and center) and WBCs (blue dots; clusters on the right) in control and transplanted mice. Fig. 12B , 12C and 12D depict ATP, ADP, and pyruvate levels in WBC compared to PKD mice, respectively. Assay 1: healthy mice (black bars) n=1, PKD (grey bars) n=1, hPGK-EGFP (white bars) n=2, hPGK-coRPK (dotted bars) n=3. Assay 2: healthy mice n=2, PKD n=2, hPGK-EGFP n=6, hPGK-coRPK n=10. Data represent mean ± SEM for each group and were analyzed by nonparametric Kruskal-Wallis test.

[0037] Fig.13 Shown is a gel image of the LAM-PCR product generated by the Tsp509I enzyme for samples collected from all mice at different time points and tissues. The vector integration site is identified by the LAM-PCR amplification of the 3' vector LTR-genome connection. The MultiNA automation system was used to generate a pattern characterized by several bands. The Tsp509I internal control band (IC) derived from the vector backbone is indicated with an arrow.

[0038] Fig.14 Shown is the gel image of the LAM-PCR product generated by the HpyCH4IV5 enzyme for the samples collected from all mice at different time points and tissues.The vector integration site is identified by the LAM-PCR amplification of 3' vector LTR-genome connection.The MultiNA automation system was used to generate the pattern characterized by several bands.The HpyCH4IV5 IC derived from the vector backbone is indicated with an arrow.

[0039] Fig.15 Depicts the overall scheme of the analysis of integration site mapping in mice transplanted with genetically modified hematopoietic progenitor cells. Bone marrow and white blood cell samples from transplanted mice belonging to two independent experiments (Table 3) and collected at different time points after transplantation were analyzed according to the indicated pipeline as described in the Supplementary Methods.

[0040] Figures 16A-16B The distribution of LV integration along the genome of transplanted mice is shown. Fig.16A Depicted are the integration site (IS) frequency distributions around the transcription start site (TSS) of the nearest RefSeq gene spanning 500 Kb upstream and downstream of the TSS. The top number is the number of IS detected for all samples and time points. Fig. 16B The chromosomal distribution of LV integration sites in transplanted mice expressing the EGFP transgene (black bars) or the coRPK therapeutic transgene (grey bars) is depicted, showing no skew toward any particular chromosome.

[0041] Figures 17A-17C The clonal abundance analysis of coRPK-LV transduced cells is shown. The dot plots represent the clonal abundance analysis of coRPK-LV transduced cells from assay 1 ( Fig.17A ) and determination 2( Fig. 17B and 17C ) in each mouse. The relative percentage of each IS (y-axis) is related to the total number of sequence reads obtained in each dataset. BM, bone marrow; PB, peripheral blood; coRPK1-14, mice transplanted with hematopoietic cells transduced with therapeutic vectors.

[0042] Fig.18Represents tracked shared integrations between primary and secondary recipient mice carrying the therapeutic PGK-coRPK LV vector. Integrations detected in any organ, at any time, in either mouse were pooled. Secondary recipients received pooled BM from transplanted mice coRPK11 to 14. The remaining IS detected were detected in primary or secondary recipients. The numbers in the boxes show a representative percentage of the corresponding integration in the mentioned mouse. In addition to the ≥5% filter applied to the integration analysis, all integrations with sequence counts <3 were eliminated.

[0043] Fig.19 The clonal abundance analysis of EGFP-LV transduced cells is shown. The dot plots represent the clonal abundance of pooled integrations in the bone marrow of each mouse. The relative percentage (y-axis) of each IS is related to the total number of sequence reads obtained in each dataset. Similar to the co-RPK transduced cells (Figure 17), this figure shows that the vast majority of transplanted mice show a polyclonal pattern of hematopoietic repopulation.

[0044] Fig. 20 Depicted LV genomic integration map. Gene ontology (GO) analysis was performed on samples from transplanted mice using GREAT software. All integrations retrieved from this study (N=2220) show over-representation of gene functions indicated on the left side of the figure. In order to address the question of whether the most abundant integration is enriched in a specific gene category, all ISs with relative sequence counts greater than 5% of the entire data set were selected (as shown in Figure 17), thereby showing GO gene categories that are not over-represented.

[0045] Fig.21 A schematic diagram of the PGK-coRPK LV lentiviral vector is depicted.

[0046] Fig. 22 A diagram of the plasmid (CPcoRPKW-17) comprising the PGK-coRPK LV lentiviral vector is depicted.

[0047] Figures 23A-23F The nucleotide sequence of the PGK-coRPK LV lentiviral vector is represented with annotations to show the locations of various functional elements.

[0048] Figures 24A-24B The mechanism of action of the PGK-coRPK LV lentiviral vector is depicted. Fig.24A It is depicted that ectopic expression of the PGK-coRPKLV vector rescues the wild-type phenotype of PKD erythrocytes, which otherwise cannot produce functional RPK protein to generate sufficient energy to carry out their functions. Fig. 24B A gene therapy strategy for PKD patients based on the expression of RPK-deficient CD34 with PGK-coRPK LV lentiviral vector is shown.+ In vitro transduction of hematopoietic progenitor cells and subsequent transplantation into patients. The developed PGK-coRPK LV lentiviral vector carrying the therapeutic human PKLR gene cDNA will integrate into the patient's CD34 + These genetically corrected cells are then infused back into the patient, where they will produce RBCs expressing the therapeutic transgene and, therefore, functional RPK protein that will correct the PKD pathological phenotype. Figure modified from the Boston Children's Hospital blog. DETAILED DESCRIPTION

[0049] definition

[0050] As used herein, "vector" refers to a macromolecule or an association of macromolecules that includes or is associated with a polynucleotide and can mediate the delivery of the polynucleotide to a cell. Illustrative vectors include, for example, plasmids, viral vectors, liposomes, and other gene delivery vehicles.

[0051] The term "LV" is an abbreviation for lentivirus, and may refer to the virus itself or to its derivatives. The term encompasses all subtypes and naturally occurring and recombinant forms, unless otherwise required.

[0052] As used herein, the term "gene" or "coding sequence" refers to an in vitro or in vivo nucleotide sequence that encodes a gene product. In some cases, a gene is composed of or substantially composed of a coding sequence, which is a sequence that encodes a gene product. In other cases, a gene includes other non-coding sequences. For example, a gene may or may not include regions before and after the coding region, for example, 5' non-translated (5'UTR) or "leader" sequence and 3'UTR or "tail" sequence, and insertion sequences (introns) between each coding segment (exon).

[0053] As used herein, "therapeutic gene" refers to a gene that, when expressed, confers a beneficial effect on the cell or tissue in which the therapeutic gene is present or on the mammal in which the gene is expressed. Examples of beneficial effects include improving the signs or symptoms of a condition or disease, preventing or inhibiting a condition or disease, or conferring a desired characteristic. Therapeutic genes include genes that correct genetic defects in cells or mammals.

[0054] As used herein, a transgene is a gene delivered to a cell by a vector.

[0055] As used herein, the term "gene product" refers to the desired expression product of a polynucleotide sequence such as a polypeptide, peptide, protein, or interfering RNA including short interfering RNA (siRNA), miRNA, or small hairpin RNA (shRNA).

[0056] As used herein, the terms "polypeptide", "peptide" and "protein" refer to polymers of amino acids of any length. The terms also encompass modified amino acid polymers; for example, disulfide bond formation, glycosylation, lipidation, phosphorylation or conjugation with a labeling component.

[0057] "Comprising" means that the listed elements are essential to, e.g., the composition, method, kit, etc., but that other elements may be included to form, e.g., the composition, method, kit, etc. within the scope of the claim. For example, an expression cassette "comprising" a gene encoding a therapeutic polypeptide operably linked to a promoter is an expression cassette that may contain other elements in addition to the gene and the promoter, such as polyadenylation sequences, enhancer elements, other genes, linker domains, etc.

[0058] "Consisting essentially of" means limiting the scope of, for example, a composition, method, kit, etc., to specific materials or steps that do not substantially affect one or more basic and novel characteristics of, for example, a composition, method, kit, etc. For example, an expression cassette "consisting essentially of" a gene encoding a therapeutic polypeptide operably linked to a promoter and a polyadenylation sequence may contain additional sequences, such as linker sequences, as long as they do not substantially affect the transcription or translation of the gene. As another example, a variant or mutant polypeptide fragment "consisting essentially of" a recited sequence has an amino acid sequence of the recited sequence, based on the full-length original polypeptide at the boundaries of the sequence plus or minus about 10 amino acid residues, such as 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 residue less than the recited binding amino acid residues or 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 residues more than the recited binding amino acid residues, the amino acid sequence being derived from the full-length original polypeptide.

[0059] "Consisting of" means excluding any element, step or ingredient not specified in the claim from the composition, method or kit. For example, an expression cassette "consisting of a gene encoding a therapeutic polypeptide operably linked to a promoter and post-transcriptional regulatory elements" consists only of a promoter, a polynucleotide sequence encoding a therapeutic polypeptide, and post-transcriptional regulatory elements. As another example, a polypeptide "consisting of a listed sequence" contains only the listed sequence.

[0060] As used herein, "expression vector" encompasses vectors, such as plasmids, mini-rings, viral vectors, liposomes, etc., as discussed above or as known in the art, which vectors include polynucleotides encoding the gene product of interest, and affect the expression of the gene product in the expected target cell. Expression vectors also include control elements operably connected to the coding region to promote the expression of the gene product in the target. Control elements (e.g., promoters, enhancers, UTRs, miRNA targeting sequences, etc.) and combinations of one or more genes operably connected thereto for expression are sometimes referred to as "expression cassettes." Many such control elements are known and available in the art or can be easily constructed by components available in the art.

[0061] As used herein, "promoter" encompasses the DNA sequence that guides the binding of RNA polymerase and thus promotes RNA synthesis, i.e., the minimum sequence that is sufficient for direct transcription. Promoter and corresponding protein or polypeptide expression can be ubiquitous, which means that there is strong activity or cell type specificity, tissue specificity or species specificity in a wide range of cells, tissues and species. Promoter can be "constitutive" (meaning continuous activity) or "inducible" (meaning that the promoter can be activated or inactivated by the presence or absence of biological factors or non-biological factors). Also included in the nucleic acid construct of the present invention or the vector is an enhancer sequence, which may or may not be adjacent to the promoter sequence. The enhancer sequence affects promoter-dependent gene expression and can be located in the 5' or 3' district of the native gene.

[0062] As used herein, "enhancer" encompasses cis-acting elements that stimulate or inhibit transcription of adjacent genes. Enhancers that inhibit transcription are also referred to as "silencers." Enhancers can act at a distance of several thousand base pairs (kb) downstream of the coding sequence and the transcribed region in either orientation (i.e., can be associated with the coding sequence).

[0063] As used herein, "termination signal sequence" encompasses any genetic element that causes RNA polymerase to terminate transcription, such as, for example, a polyadenylation signal sequence.

[0064] As used herein, the term "operably linked" or "operably connected" refers to the juxtaposition of genetic elements (e.g., promoters, enhancers, termination signal sequences, polyadenylation sequences, etc.) wherein the elements are in a relationship that allows them to operate in the intended manner. For example, a promoter is operably linked to a coding region if the promoter helps initiate transcription of the coding sequence. Intervening residues may exist between the promoter and the coding region as long as this functional relationship is maintained.

[0065] As used herein, the term "heterologous" refers to an entity that is derived from a genotypically different entity from the rest of the entity to which it is being compared. For example, a polynucleotide introduced by genetic engineering techniques into a plasmid or vector derived from a different species is a heterologous polynucleotide. As another example, a promoter that is removed from the native coding sequence of the promoter and operably linked to a coding sequence that is not naturally linked to the promoter is a heterologous promoter. Thus, for example, an LV vector comprising a heterologous nucleic acid encoding a heterologous gene product is an LV vector comprising a nucleic acid that is not normally contained in a naturally occurring wild-type LV, and the encoded heterologous gene product is a gene product that is not normally encoded by a naturally occurring wild-type LV.

[0066] The term "endogenous" as used herein with respect to a nucleotide molecule or gene product refers to a nucleic acid sequence (eg, a gene or genetic element) or a gene product (eg, RNA, protein) that is naturally present in or associated with a host virus or cell.

[0067] As used herein, the term "native" refers to a nucleotide sequence (eg, gene) or gene product (eg, RNA, protein) that exists in a wild-type virus or cell.

[0068] As used herein, the term "variant" refers to a mutant of a reference polynucleotide or polypeptide sequence, such as a native polynucleotide or polypeptide sequence, i.e., having less than 100% sequence identity with the reference polynucleotide or polypeptide sequence. In other words, the variant of the polynucleotide sequence includes at least one nucleotide difference (e.g., nucleotide substitution, nucleotide insertion, or nucleotide deletion) relative to the reference polynucleotide sequence (e.g., a native polynucleotide sequence). The variant of the polypeptide sequence includes at least one amino acid difference (e.g., amino acid substitution, amino acid insertion, amino acid deletion) relative to the reference polypeptide sequence (e.g., a native polypeptide sequence). For example, a variant can be a polynucleotide having 70% or higher sequence identity with a full-length native polynucleotide sequence, such as 75%, 80% or higher identity with a full-length native polynucleotide sequence, such as 85%, 90% or 95% or higher, such as 98% or 99% identity. As another example, a variant can be a polypeptide having 70% or higher sequence identity with a full-length native polypeptide sequence, for example, 75%, 80% or higher identity, such as 85%, 90%, or 95% or higher, such as 98% or 99% identity with a full-length native polypeptide sequence. A variant can also comprise a variant fragment of a reference such as a native sequence that shares 70% or higher sequence identity with a fragment of a reference such as a native sequence, for example, 75%, 80% or higher identity, such as 85%, 90%, or 95% or higher, such as 98% or 99% identity with a native sequence.

[0069] As used herein, the terms "biological activity" and "biologically active" refer to the activity attributed to a specific biological element in a cell. For example, the "biological activity" of an "immunoglobulin," "antibody," or a fragment or variant thereof refers to the ability to bind to an antigenic determinant and thereby promote immune function. As another example, the biological activity of a polypeptide or its functional fragment or variant refers to the ability of a polypeptide or its functional fragment or variant to achieve its natural function, such as binding, enzymatic activity, etc. As a third example, the biological activity of a gene regulatory element (e.g., a promoter, an enhancer, a Kozak sequence, etc.) refers to the ability of a regulatory element or its functional fragment or variant to regulate (i.e., promote, enhance, or activate) the translation of the expression of a gene to which it is operably connected, respectively.

[0070] As used herein, the term "administering" or "introducing" refers to delivering a vector expressing a recombinant protein to a cell, a cell of a subject and / or an organ or a subject. Such administration or introduction may occur in vivo, in vitro or ex vivo. A vector for expressing a gene product may be introduced into a cell by transfection, which generally means inserting heterologous DNA into a cell by physical means (e.g., calcium phosphate transfection, electroporation, microinjection, or lipofection); infection, which generally means introduction by an infectious agent, i.e., a virus; or transduction, which generally means stable infection of cells with a virus or transfer of genetic material from one microorganism to another microorganism by a viral agent (e.g., a bacteriophage).

[0071] "Transformation" is usually used to refer to bacteria that include heterologous DNA or cells such as tumor cells that express oncogenes and have switched to a continuous growth mode. The vector used to "transform" cells can be a plasmid, virus or other vehicle.

[0072] Typically, cells are referred to as "transduced," "infected," "transfected," or "transformed," depending on the method used to administer, introduce, or insert heterologous DNA (i.e., vector) into the cells. The terms "transduction," "transfection," and "transformation" may be used interchangeably herein, regardless of the method of introducing heterologous DNA.

[0073] As used herein, the term "host cell" refers to a cell that has been transduced, infected, transfected or transformed with a vector. The vector can be a plasmid, a viral particle, a bacteriophage, etc. The culture conditions (such as temperature, pH, etc.) are those previously used with the host cell selected for expression, and will be apparent to those skilled in the art. It should be understood that the term "host cell" refers to the original transduced, infected, transfected or transformed cell and its progeny.

[0074] The terms "treatment" and "treating" and the like are generally used herein to mean obtaining a desired pharmacological and / or physiological effect. The effect may be preventive in terms of preventing a disease or its symptoms in whole or in part, such as reducing the likelihood of the disease or its symptoms occurring in a subject, and / or may be therapeutic in terms of partially or completely curing a disease and / or adverse reactions caused by the disease. As used herein, "treatment" covers any treatment of a disease in a mammal, and includes: (a) preventing the disease from occurring in a subject who may be prone to the disease but has not yet been diagnosed with the disease; (b) inhibiting the disease, i.e., preventing its development; or (c) alleviating the disease, i.e., causing the disease to regress. The therapeutic agent may be administered before, during, or after the onset of the disease or injury. Special attention is paid to the treatment of a developing disease, wherein the treatment stabilizes or reduces the patient's undesirable clinical symptoms. Ideally, such treatment is performed before the function of the affected tissue is completely lost. Ideally, the subject therapy will be administered during the symptomatic phase of the disease and in some cases after the symptomatic phase of the disease.

[0075] The terms "individual," "host," "subject," and "patient" are used interchangeably herein and refer to mammals, including but not limited to: humans and non-human primates, including apes and humans; mammalian sport animals (e.g., horses); mammalian farm animals (e.g., sheep, goats, etc.); mammalian pets (dogs, cats, etc.); and rodents (e.g., mice, rats, etc.).

[0076] The terms used herein are only for the purpose of describing specific embodiments and are not intended to limit the present invention. As used herein, unless the context clearly indicates otherwise, the singular forms "a / an" and "the" are intended to also include the plural forms. In addition, where the terms "including", "include", "having", "has", "with" or variations thereof are used in the specific embodiments and / or claims, such terms are intended to be inclusive in a manner similar to the term "comprising".

[0077] The term "about" or "approximately" means that a particular value is within an acceptable error range as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, i.e., on the limitations of the measurement system. For example, according to the practice in the art, "about" can mean within 1 or more than 1 standard deviation. Alternatively, "about" can mean a range of up to 20%, preferably up to 10%, more preferably up to 5%, and still more preferably up to 1% of a given value. Alternatively, particularly for biological systems or processes, the term can mean within an order of magnitude of a value, preferably within 5-fold and more preferably within 2-fold. When describing specific values ​​in the application and claims, unless otherwise indicated, it should be assumed that the term "about" means within an acceptable error range for the specific value.

[0078] Unless otherwise indicated, all terms used herein have the same meanings as understood by one skilled in the art, and the practice of the present invention will employ conventional techniques of microbiology and recombinant DNA techniques, which are within the knowledge of one skilled in the art.

[0079] The practice of the present invention employs, unless otherwise indicated, conventional techniques of cell biology, molecular biology (including recombinant techniques), microbiology, biochemistry, and immunology, which are within the skills of the skilled artisan. Such techniques are fully explained in the literature, such as Molecular Cloning: A Laboratory Manual, 2nd edition (Sambrook et al., 1989); Oligonucleotide Synthesis (MJ Gait, ed., 1984); Animal Cell Culture (RI Freshney, ed., 1987); Methods in Enzymology (Academic Press, Inc.); Handbook of Experimental Immunology (DM Weir and CC Blackwell, eds.); Gene Transfer Vectors for Mammalian Cells (JM Miller and MP Calos, eds., 1987); Current Protocols in Molecular Biology (FM Ausubel et al., eds., 1987); Polymerase Chain Reaction (PCR: The Polymerase Chain Reaction). Reaction" (Mullis et al., 1994); Current Protocols in Immunology (JE Coligan et al., 1991), each of which is incorporated herein by reference.

[0080] In certain embodiments, the disclosure provides polynucleotides, polynucleotide boxes and expression vectors for expressing genes in cells. Pharmaceutical compositions and methods for using any compositions to promote gene expression in cells (e.g., in individuals) are also provided, such as to treat or prevent a disease. After reading the details of the compositions and methods described more fully below, these and other purposes, advantages and features of the present invention will become apparent to those skilled in the art.

[0081] The present invention relates generally to the fields of molecular biology and virology, and in particular to gene expression cassettes and vectors comprising the same for delivering nucleic acid fragments encoding selected therapeutic constructs (including, for example, peptides, polypeptides, ribozymes and catalytic RNA molecules) to selected cells and tissues of vertebrates. In particular, these gene constructs can be used to develop gene therapy vectors, including, for example, LV vectors for treating mammalian and, in particular, human diseases, disorders and functional disorders.

[0082] The disclosed compositions can be used in a variety of investigative, diagnostic and therapeutic schemes, including the prevention and treatment of a variety of human diseases. Various compositions and methods of the invention are described below.

[0083] Although specific compositions and methods are exemplified herein, it should be understood that any of a number of alternative compositions and methods are applicable and suitable for use in practicing the present invention. It should also be understood that the expression constructs and methods of the present invention can be evaluated using standard procedures in the art.

[0084] In certain embodiments, methods and compositions are provided for preparing gene therapy vector compositions (e.g., viral vectors) comprising these gene expression cassettes for preparing medicaments useful for central and targeted gene therapy of diseases, conditions, and disorders in animals, and specifically humans.

[0085] In some embodiments, the present invention provides a gene therapy for PKD based on a LV vector carrying a PGK eukaryotic promoter that drives PKLR cDNA expression. This therapeutic vector can be used to transduce hematopoietic stem cells (HSC), which can then be transplanted into a subject. Ectopic RPK expression normalizes the erythroid compartment, thereby correcting the blood phenotype and restoring organ pathology. Metabolomics studies have shown that in the absence of metabolic disorders in leukocytes, the glycolytic pathway in RBCs derived from genetically corrected PKDHSCs is functionally corrected. Analysis of the LV IS in the genome of transplanted hematopoietic cells showed that there was no evidence of genotoxicity in any of the transplanted animals. Overall, these results emphasize the therapeutic potential of the PGK-coRPK LV vector and provide high expectations for gene therapy for PKD and other erythroid metabolic genetic diseases.

[0086] In certain embodiments, the present invention provides a RPK LV vector for gene correction of PKD. Genetic modification of murine PKD-HSC with this vector can effectively correct the hemolytic phenotype and RBC metabolite profile of transplanted PKD mice. No evidence of leukocyte metabolic disorders and genetic toxicity derived from vector integration was observed, thereby supporting the therapeutic potential of the PGK-coRPKLV vector. In general, the results provide encouraging evidence for the feasibility of gene therapy for PKD using LV designed for clinical application.

[0087] Certain embodiments of the present invention include a self-inactivating (SIN) LV vector expressing a codon-optimized version of the human PLKR gene. The expression vector includes a promoter region, a coding sequence, and post-transcriptional regulatory elements.

[0088] Certain embodiments of the polynucleotide cassette of the present invention include a promoter region, which includes a promoter sequence or a functional fragment thereof. In one embodiment, the promoter is a human PGK promoter.

[0089] Some embodiments of the present invention include polynucleotide cassettes for enhancing expression of pyruvate kinase (e.g., human PLKR gene). In some embodiments, the polynucleotide cassette includes a codon-optimized version of human PKLR cDNA (coRPK) to increase mRNA stability during transcription. For optimization, one can use Software was used to increase the GC content and remove cryptic splice sites to avoid transcriptional silencing and thus increase transgene expression. The coRPK optimized sequence showed 80.4% homology with the human PKLR gene, while the amino acid sequence of the protein did not change. Alternatively, any optimization method known in the art can be used.

[0090] In some embodiments, the polynucleotide box includes an RNA export signal downstream of the second enhancer. The RNA export signal may include a wPRE sequence. In some embodiments, a mutant wPRE lacking any residual open reading frame (Schambach, Bohne et al., 2006) is also included to improve the expression level and stability of the therapeutic gene. The term "RNA export signal" may refer to any of the "post-transcriptional regulatory elements" known in the art. The terms "RNA export signal" and "post-transcriptional regulatory element" and the like are used interchangeably herein, as they are commonly used in the field of vector technology and development. Exemplary RNA export signals or post-transcriptional regulatory elements used in some embodiments of the present disclosure include, but are not limited to, hepatitis B virus post-transcriptional regulatory elements (HBVPRE) or constitutive transport elements (CTEs) derived from different simian retroviruses, including simian retrovirus type 1 (SRV-1) and simian retrovirus type 2 (SRV-2) and Mason-Pfizer (MPV). The following documents provide post-transcriptional regulatory elements: U.S. Patent No. 6,136,597; Donello et al., J. Virol. 72:5085-92 (1998); Hlavaty et al., Virology 341:1-11 (2005); and Oh et al., Retrovirology 4:38 (2007). Zanta-Boussif et al., Gene Therapy 16:605-19 (2009) provide additional alternative wPRE sequences. The disclosures of the foregoing references are incorporated herein by reference in their entirety.

[0091] In some aspects of the invention, a gene delivery vector is provided, comprising a polynucleotide cassette of the invention. In some embodiments, the gene delivery vector is a LV.

[0092] In some aspects of the invention, a pharmaceutical composition is provided, comprising a polynucleotide cassette of the invention and a pharmaceutical excipient. In some embodiments, the pharmaceutical composition comprises a gene delivery vector of the invention and a pharmaceutical excipient.

[0093] In some aspects of the present invention, methods for expressing transgenes in mammalian cells are provided. In certain embodiments, the method comprises contacting one or more mammalian cells with an effective amount of a polynucleotide box of the present invention or a gene delivery vector of the present invention, wherein the transgene is expressed at a detectable level in one or more mammalian cells. In certain embodiments, the method comprises contacting one or more mammalian cells with an effective amount of a polynucleotide box of the present invention or a gene delivery vector of the present invention, wherein the transgene is expressed at a therapeutic level in one or more mammalian cells. In certain embodiments, the method is performed in vitro. In other embodiments, the method is performed in vivo.

[0094] In some aspects of the invention, methods for treating or preventing a disease or condition in a mammal in need of treatment or prevention of the disease or condition are provided. In some embodiments, the method comprises administering to the mammal an effective amount of a pharmaceutical composition of the invention, wherein the coding sequence encodes a therapeutic gene product.

[0095] Composition

[0096] In some aspects of the present disclosure, compositions for expressing a transgene in one or more eukaryotic cells are provided. In some aspects, the eukaryotic cells are mammalian cells. In some aspects, the mammalian cells are hematopoietic stem cells. In some embodiments, the cells are bone marrow cells, such as lineage-depleted bone marrow cells. In some aspects, the mammalian cells are committed hematopoietic erythroid progenitor cells.

[0097] In some embodiments of the present disclosure, the composition is a polynucleotide box. A "polynucleotide box" refers to a polynucleotide sequence that includes two or more functional polynucleotide sequences that are usually operably linked to each other, such as regulatory elements, translation initiation sequences, coding sequences, and / or termination sequences, etc. Similarly, a "polynucleotide box for expressing a transgene in a mammalian cell" refers to a combination of two or more functional polynucleotide sequences (e.g., promoters, enhancers, 5'UTRs, translation initiation sequences, coding sequences, and / or termination sequences, etc.) that promote expression of a transgene in a cell.

[0098] In some embodiments, the polynucleotide cassettes of the present disclosure provide enhanced expression of transgenes in mammalian cells. As used herein, "expression of a transgene" or "expressing a transgene" refers to the transcription of a transgene into messenger RNA (mRNA) by a host cell and the translation of the mRNA into a polypeptide (i.e., a transgene product). Thus, expression of a transgene can be measured at the mRNA level (i.e., by sequence-specific quantification of mRNA levels in a cell) or at the polypeptide level (i.e., by measuring the level of a polypeptide gene product using Western blotting, enzyme-linked immunosorbent assay (ELISA), immunofluorescence microscopy or other methods of quantifying specific polypeptides). As shown in the working examples of the present disclosure, the inventors have discovered a plurality of polynucleotide elements, i.e., improved elements compared to those known in the art, which provide enhanced expression of transgenes in mammalian cells individually and synergistically. In certain embodiments, the arrangement of two or more functional polynucleotide sequences within a polynucleotide cassette of the present disclosure provides enhanced expression of a transgene in a mammalian cell. "Enhanced" refers to an increase, enhancement or greater expression of a transgene in a cell carrying a polynucleotide cassette of the present disclosure relative to a transgene operably linked to, for example, comparable regulatory elements known in the art. In other words, the transgene expression from the polynucleotide cassette of the present disclosure is increased, enhanced or stronger relative to the expression from the polynucleotide cassette of the present disclosure that does not include one or more optimized elements (i.e., a reference control). In certain embodiments, the enhanced expression is specific to or limited to one or more desired cell types.

[0099] For example, expression of a transgene in a cell comprising a polynucleotide cassette comprising a promoter disclosed herein can be enhanced, strengthened, or increased compared to expression of the transgene in a cell carrying a transgene operably linked to a different promoter, such as known in the art. As another example, expression of a transgene in a cell comprising a polynucleotide cassette comprising an enhancer sequence disclosed herein can be enhanced, or increased, strengthened, or stronger than expression of the transgene in a cell carrying a transgene operably linked to a different enhancer sequence.

[0100] Without wishing to be bound by theory, it is believed that the enhanced expression of transgenic in the cell is due to the faster accumulation of the gene product in the cell or the more stable gene product in the cell. Therefore, the enhanced transgenic expression by the polynucleotide box of the present disclosure can be observed in a variety of ways. For example, by comparing with the observed expression when the transgenic is operably connected to, for example, comparable regulatory elements known in the art, the time of transgenic expression detected after the contact of the polynucleotide box with the cell is earlier, for example, early 2 days, early 7 days, early 2 weeks, early 3 weeks, early 4 weeks, early 8 weeks, early 12 weeks or longer, enhanced expression can be observed. Enhanced expression can also be observed in the form of increased amount of the gene product of each cell. For example, the amount of the gene product of each mammalian cell may increase by 2 times or more times, for example, increase by 3 times or more times, increase by 4 times or more times, increase by 5 times or more times or increase by 10 times or more times. Enhanced expression can also be observed in the form of increased amount of transgenic mammalian cells carried by the polynucleotide box that can express a detectable level. For example, the number of mammalian cells expressing detectable levels of the transgene may be increased by 2-fold or more, such as by 3-fold or more, by 4-fold or more, by 5-fold or more, or by 10-fold or more.

[0101] As another example, compared to conventional polynucleotide cassettes, the polynucleotides of the present invention can promote detectable levels of transgenes in a greater percentage of cells; for example, when conventional cassettes can promote detectable levels of transgene expression in, for example, less than 5% of cells in a region, the polynucleotides of the present invention promote detectable levels of expression in 5% or more of cells in the region; for example, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 40% or more, 45% or more, in some cases 50% or more, 55% or more; 60% or more, 65% or more, 70% or more, 75% or more (e.g., 80% or more, 85% or more, 90% or more or 95% or more) of the cells contacted will express detectable levels of gene products. Enhanced expression can also be observed in the form of changes in cell viability and / or function.

[0102] The polynucleotide box of the present disclosure generally includes a promoter region. Any suitable promoter region or promoter sequence therein can be used in the subject polynucleotide box, as long as the promoter region promotes the expression of the coding sequence in eukaryotic cells. In certain embodiments, the promoter region promotes the expression of the coding sequence in mammalian cells. In some cases, the promoter is a ubiquitous promoter, i.e., a promoter that is active in a wide range of cells, tissues, and species. In other cases, the promoter is a human PGK promoter.

[0103] Promoter and enhancer elements can be tissue-specific or stage-specific. For example, a tissue-specific promoter or enhancer preferentially drives expression (or high levels of expression) in one or more specific cell types. Examples of cell types include, but are not limited to, hematopoietic stem cells, long-term hematopoietic stem cells, short-term hematopoietic stem cells, multipotent progenitor cells, hematopoietic CD34+ cells, and any differentiated subpopulation cluster within the CD34+ group. Stage-specific promoters or enhancers preferentially drive expression (or high levels of expression) at one or more specific stages of the cell cycle or development. These include, but are not limited to, the β-globin locus control region, the spectrin promoter, and erythroid-specific promoters.

[0104] In some embodiments, the polynucleotides include one or more enhancers. Enhancers are nucleic acid elements known in the art that enhance transcription and can be located anywhere associated with the gene it regulates, such as upstream, downstream, within introns, etc. Any enhancer element can be used in the polynucleotide cassettes and gene therapy vectors of the present disclosure, as long as it enhances the expression of a gene when used in combination with a promoter.

[0105] The coding sequence to be expressed in the cell can be any polynucleotide sequence, for example, a gene or cDNA encoding a gene product, such as a polypeptide or a therapeutic agent based on RNA (siRNA, antisense, ribozyme, shRNA, etc.). The coding sequence can be heterologous to a promoter sequence, and the promoter sequence is operably connected to the coding sequence, i.e., not naturally operably associated with it. Alternatively, the coding sequence can be endogenous to the promoter sequence, and the promoter sequence is operably connected to the coding sequence, i.e., essentially associated with the promoter. The gene product can act on mammalian cells internally, or can act externally, for example, it may be secreted. For example, when the transgenic is a therapeutic gene, the coding sequence can be any gene encoding a desired gene product or its functional fragment or variant, and the desired gene product or its functional fragment or variant can be used as a therapeutic agent for treating a disease or illness. In each preferred embodiment, the transgenic encodes human PKLR.

[0106] In one embodiment of the present invention, the transgenic coding sequence is modified or "codon optimized" to enhance expression by replacing infrequently expressed codons with more frequently expressed codons. The coding sequence is a part of the mRNA sequence that encodes the amino acid for translation. During the translation process, each of the 61 trinucleotide codons is translated into one of the 20 amino acids, resulting in degeneracy or redundancy in the genetic code. However, different cell types and different animal species utilize tRNAs (each carrying an anticodon) that encode the same amino acid at different frequencies. When the gene sequence contains codons that are infrequently expressed by the corresponding tRNA, the ribosomal translation mechanism may slow down, thereby hindering effective translation. Expression can be improved by "codon optimization" of a specific species, in which the coding sequence is changed to encode the same protein sequence, while using codons that are highly expressed and / or used by highly expressed human proteins (Cid-Arregui et al., 2003; Journal of Virology 77:4928). In one aspect of the invention, the coding sequence of the transgene is modified to replace a codon that is infrequently expressed in a mammal or primate with a codon that is frequently expressed in a primate. For example, in some embodiments, the coding sequence encoded by the transgene encodes a polypeptide having at least 85% sequence identity, such as at least 90% sequence identity, such as at least 95% sequence identity, at least 98% identity, at least 99% identity to a polypeptide encoded by a sequence disclosed above or herein, wherein at least one codon of the coding sequence has a higher tRNA frequency in humans than the corresponding codon in the sequence disclosed above or herein.

[0107] In further embodiments of the invention, the transgenic coding sequence is modified to enhance expression by terminating or removing an open reading frame (ORF) that does not encode the desired transgene. An open reading frame (ORF) is a nucleic acid sequence that follows a start codon and does not contain a stop codon. An ORF can be in a forward or reverse orientation and can be "in frame" or "out of frame" compared to the gene of interest. Such an open reading frame has the potential to be expressed in an expression cassette next to the gene of interest and may cause undesirable side effects. In one aspect of the invention, the coding sequence of the transgenic has been modified to remove the open reading frame by further altering codon usage. This is achieved by eliminating the start codon (ATG) and introducing a stop codon (TAG, TAA or TGA) in a reverse orientation or out of frame of the ORF, while retaining the amino acid sequence and maintaining highly utilized codons in the gene of interest (i.e., avoiding codons with a frequency <20%). In the present invention, the transgenic coding sequence can be optimized by codon optimization and removal of non-transgenic ORFs or using both techniques simultaneously. It will be apparent to one of ordinary skill in the art that it is preferred to remove or minimize non-transgenic ORFs after codon optimization in order to remove ORFs introduced during codon optimization.

[0108] The RRE sequence improves the efficiency of gene transfer. In specific embodiments of any of the expression cassettes and gene delivery vectors described herein, the RRE sequence comprises or consists of the following sequence or a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identity to the following sequence:

[0109] AGGAGCTTTGTTCCTTGGGTTCTTGGGAGCAGCAGGAAGCACTATGGGCGCAGCGT

[0110] CAATGACGCTGACGGTACAGGCCAGACAATTATTGTCTGGTATAGTGCAGCAGCAG

[0111] AACAATTTGCTGAGGGCTATTGAGGCGCAACAGCATCTGTTGCAACTCACAGTCTG

[0112] GGGCATCAAGCAGCTCCAGGCAAGAATCCTGGCTGTGGAAAGATACCTAAAGGATCAACAGCTCCT (SEQ ID NO: 1).

[0113] The retroviral leader contains a packaging signal (Ψ) that is involved in packaging the retroviral genome into the viral capsid. LV vectors are thought to require approximately 300 bp of the Gag gene in this region. Currently, this Gag sequence has been reduced to only 40 bp ( Figure 1 In specific embodiments of any of the expression cassettes and gene delivery vectors described herein, the ψ sequence is an HIV-1 ψ sequence, or the ψ sequence comprises or consists of the following sequence, or a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identical to the following sequence: CTCTCTCGACGCAGGACTCGGCTTGCTGAAGCGCGCACGGCAAGAGGCGAGGGGC GGCGACTGGTGAGTACGCCAAAAATTTTGACTAGCGGAGGCTAGAAGGAGAGAGA TGGGTGCGAGAGCGTC (SEQ ID NO: 2).

[0114] In specific embodiments of any of the expression cassettes and gene delivery vectors described herein, the truncated HIV-1 5'LTR comprises or consists of the following sequence, or a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identical to the following sequence:

[0115] GGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAA

[0116] CCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCG

[0117] TCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCA (SEQ ID NO: 3).

[0118] In specific embodiments of any of the expression cassettes and gene delivery vectors described herein, the HIV-1 self-inactivating 3'LTR comprises or consists of the following sequence, or a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identical to the following sequence:

[0119] TGGAAGGGCTAATTCACTCCCAACGAAGACAAGATCTGCTTTTTGCTTGTACTGGGT

[0120] CTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCA

[0121] CTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTG

[0122] TTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCA (SEQ ID NO: 4).

[0123] In specific embodiments of any of the expression cassettes and gene delivery vectors described herein, the human cytomegalovirus (CMV) immediate early promoter comprises or consists of the following sequence, a functional fragment thereof, or a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identical to the following sequence: GTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCT (SEQ ID NO: 5).

[0124] cPPT, which promotes nuclear translocation of the pre-integration complex, together with CTS, which is involved in the separation of reverse transcriptase, is believed to improve viral titers (Zennou et al., 2000; Follenzi et al., 2000). In specific embodiments of any of the expression cassettes and gene delivery vectors described herein, the central polypurine tract and central termination sequence (cPPT / CTS) of HIV-1 comprises or consists of the following sequence, a functional fragment thereof, or a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identity to the following sequence:

[0125] TTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAAAGAATAGTAGAC

[0126] ATAATAGCAACAGACATACAAACTAAAGAATTACAAAAACAAATTACAAAAATTCA AAATTTT (SEQ ID NO: 6).

[0127] In specific embodiments of any of the expression cassettes and gene delivery vectors described herein, the human phosphoglycerate kinase 1 (hPGK) promoter comprises or consists of the following sequence, a functional fragment thereof, or a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity thereto: GGGGTTGGGGTTGCGCCTTTTCCAAGGCAGCCCTGGGTTTGCGCAGGGACGCGGCTGCTCTGGGCGTGGTTCCGGGAAACGCAGCGGCGCCGACCCTGGGTCTCGCACATTCTTCACGTCCGTTCGCAGCGTCACCCGGATCTTCGCCGCTACCCTTGTGGGCCCCCCGGCGACGCTTCCTGCTCCGCCCCTAAGTCGGG AAGGTCCTTGCGGTTCGCGGCGTGCCGGACGTGACAAACGGAAGCCGCACGTCTCACTAGTACCCTCGCAGACGGACAGCGCCAGGGAGCAATGGCAGCGCGCCGACCGCGATGGGCTGTGGCCAATAGCGGCTGCTCAGCAGGGCGCGCCGAGAG CAGCGGCCGGGAAGGGGCGGTGCGGGAGGCGGGGTGTGGGGCGGTAGTGTGGGCCCTGTTCCTGCCCGCGCGGTGTTCCCGCATTCTGCAAGCCTCCGGAGCGCACGTCGGCAGTCGGCTCCCTCGTTGACCGAATCACCGACCTCTCTCCCCAG(SEQ ID NO:7).

[0128]

[0129] In specific embodiments of any of the expression cassettes and gene delivery vectors described herein, the human CMV enhancer comprises or consists of the following sequence, a functional fragment thereof, or a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identical to the following sequence:

[0130] GACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGGTCATTAGTTCATAGC

[0131] CCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCG

[0132] CCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCA

[0133] ATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTG

[0134] GCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGT

[0135] AAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATG (SEQ ID NO: 9).

[0136] In specific embodiments of any of the expression cassettes and gene delivery vectors described herein, the Simian Virus 40 (SV40) poly(A) signal comprises or consists of the following sequence, a functional fragment thereof, or a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identical to the following sequence: AACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCA CAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGT ATCTTA (SEQ ID NO: 10).

[0137] In specific embodiments of any of the expression cassettes and gene delivery vectors described herein, the SV40 origin of replication comprises or consists of the following sequence, a functional fragment thereof, or a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identical to the following sequence:

[0138] ATCCCGCCCCTAACTCCGCCCAGTTCCCGCCATTCTCCGCCCCATGGCTGACTAATTT

[0139] TTTTTATTTATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCC (SEQ ID NO: 11).

[0140] In specific embodiments of any of the expression cassettes and gene delivery vectors described herein, the cPPT present in any of the expression cassettes or gene delivery vectors described herein comprises or consists of the following sequence: TTTAAAAGAAAAGGGGGGATTGGGGGGT (SEQ ID NO: 12), or a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identical to SEQ ID NO: 12.

[0141] In some embodiments of any of the expression cassettes and gene delivery vectors described herein, the dNEF signal present in any of the expression cassettes or gene delivery vectors described herein comprises or consists of the sequence: GAATTCGAGCTCGGTACCTTTAAGACCAATGACTTACAAGGCAGCTGTAGATCTTAG CCACTTTTTAAAAGAAAAGGGGGGAC (SEQ ID NO: 13), or a sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identical to SEQ ID NO: 13.

[0142] In specific embodiments of any of the expression cassettes and gene delivery vectors described herein, the NeoR / KanR sequence present in any of the expression cassettes or gene delivery vectors described herein comprises or consists of the following sequence: (SEQ ID NO: 14), or a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identical to SEQ ID NO: 14.

[0143] In some embodiments of any of the expression cassettes and gene delivery vectors described herein, the rrnG terminator (transcription terminator from the E. coli ribosomal RNA rrnG operon (Albrechtsen et al., 1991)) present in any of the expression cassettes or gene delivery vectors described herein comprises or consists of the following sequence: GCATTGGCGCAGAAAAAAATGCCTGATGCGACGCTGCGCGTCTTATACTCCCACATATGCCAGATTCAGCAACGGATACGGCTTCCCCAACTTGCCCACTTCCATACGTGTCCT CCTTACCAGAAATTTATCCTTAA (SEQ ID NO: 15), or a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO: 15.

[0144] In some embodiments of any of the expression cassettes and gene delivery vectors described herein, the ori (high copy number ColE1 / pMB1 / pBR322 / pUC origin of replication) present in any of the expression cassettes or gene delivery vectors described herein comprises or consists of the following sequence:

[0145] TTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCT

[0146] ACCACGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAAC

[0147] TGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGG

[0148] CCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTT

[0149] ACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGAC

[0150] GATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTTCGTGCACAG

[0151] CCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATG

[0152] AGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGCAGGTATCCGGTAAGCGGC

[0153] AGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATC

[0154] TTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAA (SEQ ID NO: 16), or a sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identical to SEQ ID NO: 16.

[0155] In some embodiments of any of the expression cassettes and gene delivery vectors described herein, the CAP binding site present in any of the expression cassettes or gene delivery vectors described herein comprises or consists of the following sequence: TAATGTGAGTTAGCTCACTCAT (SEQ ID NO: 17), or a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identical to SEQ ID NO: 17.

[0156] In some embodiments of any of the expression cassettes and gene delivery vectors described herein, the E. coli lac promoter present in any of the expression cassettes or gene delivery vectors described herein comprises or consists of the following sequence: TTTACACTTTATGCTTCCGGCTCGTATGTTG (SEQ ID NO: 18), or a sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identical to SEQ ID NO: 18.

[0157] In some embodiments of any of the expression cassettes and gene delivery vectors described herein, the lac operator present in any of the expression cassettes or gene delivery vectors described herein comprises or consists of the sequence: TTGTGAGCGGATAACAA (SEQ ID NO: 19), or a sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identical to SEQ ID NO: 19.

[0158] In some embodiments of any of the expression cassettes and gene delivery vectors described herein, the T3 promoter (promoter of bacteriophage T3 RNA polymerase) present in any of the expression cassettes or gene delivery vectors described herein comprises or consists of the following sequence: AATTAACCCTCACTAAAGG (SEQ ID NO:20), or a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identical to SEQ ID NO:20.

[0159] In some embodiments of any of the expression cassettes and gene delivery vectors described herein, the CMV enhancer present in any of the expression cassettes or gene delivery vectors described herein comprises or consists of the following sequence: GACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATG (SEQ ID NO: 21), or a sequence similar to SEQ ID NO: 22. NO:21 has a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identical.

[0160] In some embodiments of any of the expression cassettes and gene delivery vectors described herein, the T7 promoter (promoter of bacteriophage T7 RNA polymerase) present in any of the expression cassettes or gene delivery vectors described herein comprises or consists of the following sequence: CCTATAGTGAGTCGTATTA (SEQ ID NO: 22), or a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identical to SEQ ID NO: 22.

[0161] In some embodiments of any of the expression cassettes and gene delivery vectors described herein, the f1 ori (f1 phage origin of replication) present in any of the expression cassettes or gene delivery vectors described herein comprises or consists of the following sequence:

[0162] ACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTG

[0163] ACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTTCGCTTTCTTCCCTTCCTTTC

[0164] TCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGGCTCCCTTTAGGGT

[0165] TCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTT

[0166] CACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCA

[0167] CGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGG

[0168] TCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATT (SEQ ID NO:23), or a sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identical to SEQ ID NO:23.

[0169] In some embodiments, the polynucleotide box of the present invention further includes an RNA export signal. Exemplary RNA export signals include, but are not limited to, wPRE. By increasing RNA stability in a transgenic, promoter, and vector-independent manner, wPRE significantly increases transgenic expression in target cells (Zuffrey et al., 1999). However, it can express a truncated 60 amino acid protein derived from the WHV X gene involved in liver cancer (Kingsman et al., 2005). Therefore, most preclinical programs and clinical trials include mutated versions of the wPRE element (Zanta-Boussif et al., 2009). On the other hand, in inhibiting transcriptional readthrough, the use of two SV40-USE elements in the SIN-LV vector is considered to be more effective than the wPRE sequence (Schambach et al., 2007). More specifically, the wPRE disclosed herein is a chimeric wPRE that carries 589 nucleotides (nucleotides 1-589) from a modified WPRE by Axel Schambach (WO 2008136670 A2; [5]) and 88 nucleotides (nucleotides 590-677) from a previous wPRE (Zuffrey et al., 1999). The data disclosed herein show that this chimeric wPRE performs better than the previous wPRE. The chimeric wPRE sequence includes the following sequence:

[0170] CGAGCATCTTACCGCCATTTATTCCCATATTTGTTCTGTTTTTCTTGATTTGGGTATAC

[0171] ATTTAAATGTTAATAAAACAAAATGGTGGGGCAATCATTTACATTTTTAGGGATATGT

[0172] AATTACTAGTTCAAGGTGTATTGCCACAAGACAAACATGTTAAGAAACTTTCCCGTTA

[0173] TTTACGCTCTGTTCCTGTTAATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACT

[0174] GATATTCTTAACTATGTTGCTCCTTTTACGCTGTGTGGATATGCTGCTTTAATGCCTCT

[0175] GTATCATGCTATTGCTTCCCGTACGGCTTCGTTTTCTCCTCCTTGTATAAATCCTGGT

[0176] TGCTGTCTCTTTATGAGGAGTTGTGGCCCGTTGTCCGTCAACGTGGCGTGGTGTGCT

[0177] CTGTTGTTTGCTGACGCAACCCCCACTGGCTGGGGCATTGCCACCACCTGTCAACTC

[0178] CTTTCTGGGACTTTCGCTTCCCCCTCCCGATCGCCACGGCAGAACTCATCGCCGCC

[0179] TGCCTTGCCCGCTGCTGGACAGGGGCTAGGTTGCTGGGCACTGATAATTCCGTGGTG

[0180] TTGTCGGGGAAGGGCCTGCTGCCGGCTCTGCGGCCTCTTCCGCGTCTTCGCCTTCGCCCTCAGACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGCCTG (SEQ ID NO: 24).

[0181] In particular embodiments of any of the expression cassettes and gene delivery vectors described herein, the wPRE sequence comprises or consists of the sequence of SEQ ID NO:24, or a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identical to the sequence of SEQ ID NO:24.

[0182] CGAGCATCTTACCGCCATTTATTCCCATATTTGTTCTGTTTTTCTTGATTTGGGTATAC

[0183] ATTTAAATGTTAATAAAACAAAATGGTGGGGCAATCATTTACATTTTTAGGGATATGT

[0184] AATTACTAGTTCAAGGTGTATTGCCACAAGACAAACATGTTAAGAAACTTTCCCGTTA

[0185] TTTACGCTCTGTTCCTGTTAATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACT

[0186] GATATTCTTAACTATGTTGCTCCTTTTACGCTGTGTGGATATGCTGCTTTAATGCCTCT

[0187] GTATCATGCTATTGCTTCCCGTACGGCTTCGTTTTCTCCTCCTTGTATAAATCCTGGT

[0188] TGCTGTCTCTTTATGAGGAGTTGTGGCCCGTTGTCCGTCAACGTGGCGTGGTGTGCT

[0189] CTGTTGTTTGCTGACGCAACCCCCACTGGCTGGGGCATTGCCACCACCTGTCAACTC

[0190] CTTTCTGGGACTTTCGCTTCCCCCTCCCGATCGCCACGGCAGAACTCATCGCCGCC

[0191] TGCCTTGCCCGCTGCTGGACAGGGGCTAGGTTGCTGGGCACTGATAATTCCGTGGTG

[0192] TTGTCGGGGAAGGGCCTGCTGCCGGCTCTGCGGCCTCTTCCGCGTCTTCGCCTTCGCCCTCAGACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGCCTG (SEQ ID NO: 24)

[0193] Other combinations of elements as disclosed herein or as known in the art will be readily apparent to those of ordinary skill in the art.

[0194] Additionally, as will be appreciated by one of ordinary skill in the art, the polynucleotide cassette may optionally contain other elements including, but not limited to, restriction sites to facilitate cloning and regulatory elements for use in particular gene expression vectors.

[0195] In some aspects of the invention, the subject polynucleotide cassettes are used to deliver genes to animal cells, e.g., to determine the effects of genes on cell viability and / or function, to treat cell disorders, etc. Thus, in some aspects of the invention, compositions for expressing transgenes in mammalian cells are provided as gene delivery vectors, wherein the gene delivery vectors include the polynucleotide cassettes of the present disclosure.

[0196] The gene delivery vector of the present disclosure encompasses any convenient gene therapy vector found to be used to deliver a polynucleotide sequence to a mammalian cell. For example, the vector may include a single-stranded nucleic acid or a double-stranded nucleic acid, such as a single-stranded DNA or a double-stranded DNA. For example, the gene delivery vector may be a DNA, such as a naked DNA, such as a plasmid, a mini-circle, etc. The vector may include a single-stranded RNA or a double-stranded RNA, including a modified form of RNA. In another example, the gene delivery vector may be an RNA, such as an mRNA or a modified mRNA.

[0197] As another example, the gene delivery vector can be a viral vector derived from a virus, such as an adenovirus, an adeno-associated virus, a LV, a herpes virus, an alpha virus, or a retrovirus, such as Moloney murine leukemia virus (M-MuLV), Moloney murine sarcoma virus (MoMSV), Harvey murine sarcoma virus (HaMuSV), murine mammary tumor virus (MuMTV), Gibbon ape leukemia virus (GaLV), feline leukemia virus (FLV), foamy virus, Friend murine leukemia virus, murine stem cell virus (MSCV), or Rous sarcoma virus (RSV). Although embodiments covering the use of LV are described in more detail below, it is expected that one of ordinary skill in the art will appreciate that similar knowledge and techniques in the art can also be used for non-LV gene therapy vectors.

[0198] In some embodiments, the gene delivery vector is a self-limiting LV. In some embodiments, the gene delivery vector is a self-inactivating LV. In some embodiments, the gene delivery vector is a non-integrating LV. In a specific embodiment of any one of the expression cassettes and gene delivery vectors described herein, the self-limiting LV ( Fig. 22 and 23) comprising or consisting of the following sequence or a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identical to the following sequence:

[0199] GTGTTTAAACCTAGATATTGATAGTCTGATCGGTCAACGTATAATCGAGTCCTAGCTT

[0200] TTGCAAACATCTATCAAGAGACAGGATCAGCAGGAGGCTTTCGCATGATTGAACAA

[0201] GATGGATTGCACGCAGGTTCTCCGGCGGCTTGGGTGGAGAGGCTATTCGGCTATGAC

[0202] TGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCA

[0203] GGGGCGTCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAACTGC

[0204] AAGACGAGGCAGCGCGGCTATCGTGGCTGGCGACGACGGGCGTTCCTTGCGCGGCT

[0205] GTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCC

[0206] GGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGC

[0207] TGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCATTCGACCACCA

[0208] AGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGATC

[0209] AGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAG

[0210] GCTCAAGGCGTCTATGCCCGACGGCGAGGATCTCGTCGTGACCCACGGCGATGCCT

[0211] GCTTGCCGAATATCATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCC

[0212] GTCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTG

[0213] AAGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTTGTGCTTTACGGTATCGCCGCGC

[0214] CCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGACCGATTCT

[0215] AGGTGCATTGGCGCAGAAAAAAATGCCTGATGCGACGCTGCGCGTCTTATACTCCC

[0216] ACATATGCCAGATTCAGCAACGGATACGGCTTCCCCAACTTGCCCACTTCCATACGT

[0217] GTCCTCCTTACCAGAAATTTATCCTTAACGATCGGACGGGGAGTCAGGCAACTATGG

[0218] ATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAAC

[0219] TGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTT

[0220] AAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGT

[0221] GAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTG

[0222] AGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACC

[0223] AGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGG

[0224] CTTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCA

[0225] CCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACC

[0226] AGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGAT

[0227] AGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCC

[0228] CAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAG

[0229] AAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAG

[0230] GGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTT

[0231] TATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGT

[0232] CAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTG

[0233] GCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGG

[0234] ATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCG

[0235] AGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCC

[0236] TCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTG

[0237] GAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCAC

[0238] CCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATA

[0239] ACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCGCGCAATTAACCC

[0240] TCACTAAAGGGAACAAAAGCTGGAGCTGCAAGCTTGGCCATTGCATACGTTGTATC

[0241] CATATCATAATATGTACATTTATATTGGCTCATGTCCAACATTACCGCCATGTTGACATT

[0242] GATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATAT

[0243] ATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAAC

[0244] GACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGG

[0245] ACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTA

[0246] CATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGC

[0247] CCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACAT

[0248] CTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGG

[0249] CGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAAT

[0250] GGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTC

[0251] CGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCA

[0252] GAGCTCGTTTAGTGAACCGGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGC

[0253] TCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGC

[0254] TTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGAC

[0255] CCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTGGCGCCCGAACAGGGACTTGAAAG

[0256] CGAAAGGGAAACCAGAGGAGCTCTCTCGACGCAGGACTCGGCTTGCTGAAGCGCG

[0257] CACGGCAAGAGGCGAGGGGCGGCGACTGGTGAGTACGCCAAAAATTTTGACTAGC

[0258] GGAGGCTAGAAGGAGAGAGATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAGAA

[0259] TTAGATCGCGATGGGAAAAAATTCGGTTAAGGCCAGGGGGAAAGAAAAAATATAAA

[0260] TTAAAACATATAGTATGGGCAAGCAGGGAGCTAGAACGATTCGCAGTTAATCCTGGC

[0261] CTGTTAGAAACATCAGAAGGCTGTAGACAAATACTGGGACAGCTACAACCATCCCT

[0262] TCWAVESTRAWACTTTATTTATTATTATATATATTHEWACCCTCTATTGT

[0263] GTGCATCAAAGGATAGAGATAAAAGACACCAAGGAAGCTTTAGAGATAGAGG

[0264] AAGAGCAAAACAAAAGTAAGCACCGCACAGCAAGCGGCCGCTGATCTTCAGAC

[0265] CTGGAGGAGATGAGGGACAATGGAGAGTGAATTATATATATAAAGTAG

[0266] TAAAATTGAACCATTAGGAGTGCACCCAAGGCAAAGGAGAGTGGTGCA

[0267] GAGAAAAAAGAGCAGTGGGAATAGGAGCTTTGTTCCTTGGGTTCTTGGGAGCA

[0268] GCAGGAAGCACTATGGGGCCAGCGTCAATGACGCTGACGGTACAGGCCAGACAATT

[0269] ATTGTCTGGTATAGTGCAGCAGCAGAACAATTTGCTGAGGGCTATTGAGGGCCAAC

[0270] AGCATCTGTTGCAACTCACAGTCTGGGGCATCAAGCAGCTCCAGGCAAGAATCCCTG

[0271] GCTGTGGAAAGATACCTAAAGGATCAACAGCTCCTGGGGATTTGGGGTTGCTCTGG

[0272] AAAACTCATTTGCACCACTGCTGTGCCTTGGAATGCTAGTTGGAGTAATAAATCTCT

[0273] GGAACATTTGGAATCACACACGACCTGGATGGAGTGGGAGAGAATTAACAATT

[0274] ACACAAGCTTAATACACTCCTTAATTGAAGAATCGCAAAACCAGCAAGAAAAGAAT

[0275] GAACAAGAATTATTGGAATTAGATAAATGGGCAAGTTTGTGGAATTGGTTTAACATA

[0276] ACAAATTGGCTGTGGTTATAAAATTATTCATAATGATAGTAGGAGGCTTGGTAGGTT

[0277] TAAGAATAGTTTTTGCTGTACTTTCTATAGTGAATAGAGTTAGGCAGGGATATTCACC

[0278] ATTATCGTTTCAGACCCACCTCCCAACCCCGAGGGGACCCGACAGGCCCGAAGGAA

[0279] TAGAAGAAGGTGGAGAGAGAGACAGAGACAGATCCATTCGATTAGTGAACGG

[0280] ATCTCGACGGTATCGGTTAACTTTTAAAAAAAAGGGGGGGATTGGGGGGTACAGTG

[0281] CAGGGAAAGAATAGTGACATAATAGCAACAGACATACAAACTAAAGATTACAA

[0282] AAACAAATTCAAAAAATTCAAAATTTATCGATCACGAGACTAGCCTCGAGAAGCTT

[0283] GATATCGAATTCCACGGGGTTGGGGTTGCGCCTTTTCCAAGGCAGCCCTGGGTTTGC

[0284] GCAGGGACGCGGCTGCTCTGGGCGTGGTTCCGGGAAACGCAGCGGCGCCGACCCT

[0285] GGGTCTCGCACATTCTTCACGTCCGTTCGCAGCGTCACCCGGATCTTCGCCGCTACC

[0286] CTTGTGGGCCCCCCGGCGACGCTTCCTGCTCCGCCCCTAAGTCGGGAAGGTTCCTT

[0287] GCGGTTCGCGGCGTGCCGGACGTGACAAACGGAAGCCGCACGTCTCACTAGTACCC

[0288] TCGCAGACGGACAGCGCCAGGGAGCAATGGCAGCGCGCCGACCGCGATGGGCTGT

[0289] GGCCAATAGCGGCTGCTCAGCAGGGCGCGCCGAGAGCAGCGGCCGGGAAGGGGCG

[0290] GTGCGGGAGGCGGGGTGTGGGGCGGTAGTGTGGGCCCTGTTCCTGCCCGCGCGGT

[0291] GTTCCGCATTCTGCAAGCCTCCGGAGCGCACGTCGGCAGTCGGCTCCCTCGTTGAC

[0292] CGAATCACCGACCTCTCTCCCCAGGGGGATCCGTCGACACCGGTGCCACCATGAGC

[0293] ATCCAGGAAAATATCAGCTCTCTGCAGCTGCGGTCCTGGGTGTCCAAGAGCCAGAG

[0294] AGACCTGGCCAAGAGCATCCTGATCGGAGCCCCTGGCGGACCAGCCGGATACCTGA

[0295] GAAGGGCTAGCGTGGCCCAGCTGACCCAGGAACTGGGCACCGCCTTTTTCCAGCAG

[0296] CAGCAGCTGCCAGCCGCCATGGCCGACACCTTTCTGGAACACCTGTGCCTGCTGGA

[0297] CATCGACTCTGAGCCCGTGGCCGCCAGAAGCACCAGCATCATTGCCACCATCGGCC

[0298] CTGCCAGCAGAAGCGTGGAGCGGCTGAAAGAGATGATCAAGGCCGGCATGAATATC

[0299] GCCCGGCTGAACTTCTCCCACGGCAGCCACGAGTACCACGCAGAGAGCATTGCCAA

[0300] CGTCCGGGAGGCCGTGGAGAGCTTTGCCGGCAGCCCCCTGAGCTACAGACCCGTG

[0301] GCCATTGCCCTGGACACCAAGGGCCCCGAGATCAGAACAGGAATTCTGCAGGGAG

[0302] GGCCTGAGAGCGAGGTGGAGCTGGTGAAGGGCAGCCAAGTGCTGGTGACCGTGGA

[0303] CCCCGCCTTCAGAACCAGAGGCAACGCCAACACAGTGTGGGTGGACTACCCCAAC

[0304] ATCGTGCGGGTGGTGCCTGTGGGCGGCAGAATCTACATCGACGACGGCCTGATCAG

[0305] CCTGGTGGTGCAGAAGATCGGACCTGAGGGCCTGGTGACCCAGGTCGAGAATGGC

[0306] GGCGTGCTGGGCAGCAGAAAGGGCGTGAATCTGCCAGGCGCCCAGGTGGACCTGC

[0307] CTGGCCTGTCTGAGCAGGACGTGAGAGACCTGAGATTTGGCGTGGAGCACGGCGT

[0308] GGACATCGTGTTCGCCAGCTTCGTGCGGAAGGCCTCTGATGTGGCCGCCGTGAGAG

[0309] CCGCTCTGGGCCCTGAAGGCCACGGCATCAAGATCATCAGCAAGATCGAGAACCAC

[0310] GAGGGCGTGAAGCGGTTCGACGAGATCCTGGAAGTGTCCGACGGCATCATGGTGGC

[0311] CAGAGGCGACCTGGGCATCGAGATCCCCGCCGAGAAGGTGTTCCTGGCCCAGAAA

[0312] ATGATGATCGGACGGTGCAACCTGGCCGGCAAACCTGTGGTGTGCGCCACCCAGAT

[0313] GCTGGAAAGCATGATCACCAAGCCCAGACCCACCAGAGCCGAGACAAGCGACGTG

[0314] GCCAACGCCGTGCTGGATGGCGCTGACTGCATCATGCTGTCCGGCGAGACAGCCAA

[0315] GGGCAACTTCCCCGTGGAGGCCGTGAAGATGCAGCACGCCATTGCCAGAGAAGCC

[0316] GAGGCCGCCGTGTACCACCGGCAGCTGTTCGAGGAACTGCGGAGAGCCGCCCCTCT

[0317] GAGCAGAGATCCCACCGAAGTGACCGCCATCGGAGCCGTGGAAGCCGCCTTCAAG

[0318] TGCTGCGCCGCTGCAATCATCGTGCTGACCACCACAGGCAGAAGCGCCCAGCTGCT

[0319] GTCCAGATACAGACCCAGAGCCGCCGTGATCGCCGTGACAAGATCCGCCCAGGCCG

[0320] CTAGACAGGTCCACCTGTGCAGAGGCGTGTTCCCCCTGCTGTACCGGGAGCCTCCC

[0321] GAGGCCATCTGGGCCGACGACGTGGACAGACGGGTGCAGTTCGGCATCGAGAGCG

[0322] GCAAGCTGCGGGGCTTCCTGAGAGTGGGCGACCTGGTGATCGTGGTGACAGGCTG

[0323] GCGGCCTGGCAGCGGCTACACCAACATCATGAGGGTGCTGTCCATCAGCTGACCGC

[0324] GGTCTAGAGGATCCCCCGGGCTGCAGGAATTCGAGCATCTTACCGCCATTTATTCCC

[0325] ATATTTGTTCTGTTTTTCTTGATTTGGGTATACATTTAAATGTTAATAAAACAAAATGG

[0326] TGGGGCAATCATTTACATTTTTAGGGATATGTAATTACTAGTTCAGGTGTATTGCCAC

[0327] AAGACAAACATGTTAAGAAACTTTCCCGTTATTTACGCTCTGTTCCTGTTAATCAAC

[0328] CTCTGGATTACAAAATTTGTGAAAGATTGACTGATATTCTTAACTATGTTGCTCCTTTT

[0329] ACGCTGTGTGGATATGCTGCTTTAATGCCTCTGTATCATGCTATTGCTTCCCGTACGG

[0330] CTTTCGTTTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATGAGGAGTTGTG

[0331] GCCCGTTGTCCGTCAACGTGGCGTGGTGTGCTCTGTGTTTGCTGACGCAACCCCCA

[0332] CTGGCTGGGGCATTGCCACCACCTGTCAACTCCTTTCTGGGACTTTCGCTTTCCCCC

[0333] TCCCGATCGCCACGGCAGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGG

[0334] GCTAGGTTGCTGGGCACTGATAATTCCGTGGTGTTGTCGGGGAAGGGCCTGCTGCC

[0335] GGCTCTGCGGCCTCTTCCGCGTCTTCGCCTTCGCCCTCAGACGAGTCGGATCTCCCT

[0336] TTGGGCCGCCTCCCCGCCTGGAATTCGAGCTCGGTACCTTTAAGACCAATGACTTAC

[0337] AAGGCAGCTGTAGATCTTAGCCACTTTTTAAAAGAAAAGGGGGGACTGGAAGGGCT

[0338] AATTCACTCCCAACGAAGACAAGATCTGCTTTTTGCTTGTACTGGGTCTCTCTGGTT

[0339] AGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGC

[0340] CTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACT

[0341] CTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTA

[0342] GTAGTTCATGTCATCTTATTATTCAGTATTTATAACTTGCAAAGAAATGAATATCAGAG

[0343] AGTGAGAGGAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATC

[0344] ACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAAC

[0345] TCATCAATGTATCTTATCATGTCTGGCTCTAGCTATCCCGCCCCTAACTCCGCCCATCC

[0346] CGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTT

[0347] TATTTATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTATTCCAGAAGTAGTGAGG

[0348] AGGCTTTTTTGGAGGCCTAGGGACGTACCCAATTCGCCCTATAGTGAGTCGTATTAC

[0349] GCGCGCTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTAC

[0350] CCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGA

[0351] GGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGGACG

[0352] CGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACC

[0353] GCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCG

[0354] CCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCC

[0355] GATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCAC

[0356] GTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGT

[0357] TCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCT

[0358] ATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATCGTTCCCTCAGGACGTC (SEQ ID NO: 25).

[0359] In specific embodiments of the expression cassettes described herein, the expression comprises or consists of the following sequence or a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identical to the following sequence:

[0360] GGGGTTGGGGTTGCGCCTTTTCCAAGGCAGCCCTGGGTTTGCGCAGGGACGCGGCT

[0361] GCTCTGGGCGTGGTTCCGGGAAACGCAGCGGCGCCGACCCTGGGTCTCGCACATTC

[0362] TTCACGTCCGTTCGCAGCGTCACCCGGATCTTTCGCCGCTACCCTTGTGGGCCCCCCG

[0363] GCGACGCTTCCTGCTCCGCCCCTAAGTCGGGAAGGTTCCTTGCGGTTCGCGGCGTG

[0364] CCGGACGTGACAAACGGAAGCCGCACGTCTCACTAGTACCCTCGCAGACGGACAG

[0365] CGCCAGGGAGCAATGGCAGCGCGCCGACCGCGATGGGCTGTGGCCAATAGCGGCT

[0366] GCTCAGCAGGGCGCGCCGAGAGCAGCGGCCGGGAAGGGGCGGTGCGGGAGGCGG

[0367] GGTGTGGGGCGGTAGTGTGGGCCCTGTTCCTGCCCGCGCGGTGTTCCGCATTCTGC

[0368] AAGCCTCCGGAGCGCACGTCGGCAGTCGGCTCCCTCGTTGACCGAATCACCGACCT

[0369] CTCTCCCCAGGGGGATCCGTCGACACCGGTGCCACCATGAGCATCCAGGAAAATAT

[0370] CAGCTCTCTGCAGCTGCGGTCCTGGGTGTCCAAGAGCCAGAGAGACCTGGCCAAG

[0371] AGCATCCTGATCGGAGCCCCTGGCGGACCAGCCGGATACCTGAGAAGGGCTAGCGT

[0372] GGCCCAGCTGACCCAGGAACTGGGCACCGCCTTTTTCCAGCAGCAGCAGCTGCCA

[0373] GCCGCCATGGCCGACACCTTTCTGGAACACCTGTGCCTGCTGGACATCGACTCTGA

[0374] GCCCGTGGCCGCCAGAAGCACCAGCATCATTGCCACCATCGGCCCTGCCAGCAGAA

[0375] GCGTGGAGCGGCTGAAAGAGATGATCAAGGCCGGCATGAATATCGCCCGGCTGAAC

[0376] TTCTCCCACGGCAGCCACGAGTACCACGCAGAGAGCATTGCCAACGTCCGGGAGGC

[0377] CGTGGAGAGCTTTGCCGGCAGCCCCCTGAGCTACAGACCCGTGGCCATTGCCCTGG

[0378] ACACCAAGGGCCCCGAGATCAGAACAGGAATTCTGCAGGGAGGGCCTGAGAGCGA

[0379] GGTGGAGCTGGTGAAGGGCAGCCAAGTGCTGGTGACCGTGGACCCCGCCTTCAGA

[0380] ACCAGAGGCAACGCCAACACAGTGTGGGTGGACTACCCCAACATCGTGCGGGTGG

[0381] TGCCTGTGGGCGGCAGAATCTACATCGACGACGGCCTGATCAGCCTGGTGGTGCAG

[0382] AAGATCGGACCTGAGGGCCTGGTGACCCAGGTCGAGAATGGCGGCGTGCTGGGCA

[0383] GCAGAAAGGGCGTGAATCTGCCAGGCGCCCAGGTGGACCTGCCTGGCCTGTCTGA

[0384] GCAGGACGTGAGAGACCTGAGATTTGGCGTGGAGCACGGCGTGGACATCGTGTTC

[0385] GCCAGCTTCGTGCGGAAGGCCTCTGATGTGGCCGCCGTGAGAGCCGCTCTGGGCCC

[0386] TGAAGGCCACGGCATCAAGATCATCAGCAAGATCGAGAACCACGAGGGCGTGAAG

[0387] CGGTTCGACGAGATCCTGGAAGTGTCCGACGGCATCATGGTGGCCAGAGGCGACCT

[0388] GGGCATCGAGATCCCCGCCGAGAAGGTGTTCCTGGCCCAGAAAATGATGATCGGAC

[0389] GGTGCAACCTGGCCGGCAAACCTGTGGTGTGCGCCACCCAGATGCTGGAAAGCATG

[0390] ATCACCAAGCCCAGACCCACCAGAGCCGAGACAAGCGACGTGGCCAACGCCGTGC

[0391] TGGATGGCGCTGACTGCATCATGCTGTCCGGCGAGACAGCCAAGGGCAACTTCCCC

[0392] GTGGAGGCCGTGAAGATGCAGCACGCCATTGCCAGAGAAGCCGAGGCCGCCGTGT

[0393] ACCACCGGCAGCTGTTCGAGGAACTGCGGAGAGCCGCCCCTCTGAGCAGAGATCC

[0394] CACCGAAGTGACCGCCATCGGAGCCGTGGAAGCCGCCTTCAAGTGCTGCGCCGCTG

[0395] CAATCATCGTGCTGACCACCACAGGCAGAAGCGCCCAGCTGCTGTCCAGATACAGA

[0396] CCCAGAGCCGCCGTGATCGCCGTGACAAGATCCGCCCAGGCCGCTAGACAGGTCCA

[0397] CCTGTGCAGAGGCGTGTTCCCCCTGCTGTACCGGGAGCCTCCCGAGGCCATCTGGG

[0398] CCGACGACGTGGACAGACGGGTGCAGTTCGGCATCGAGAGCGGCAAGCTGCGGGG

[0399] CTTCCTGAGAGTGGGCGACCTGGTGATCGTGGTGACAGGCTGGCGGCCTGGCAGCG

[0400] GCTACACCAACATCATGAGGGTGCTGTCCATCAGCTGACCGCGGTCTAGAGGATCCC

[0401] CCGGGCTGCAGGAATTCGAGCATCTTACCGCCATTTATTCCCATATTTGTTCTGTTTT

[0402] TCTTGATTTGGGTATACATTTAAATGTTAATAAAACAAAATGGTGGGGCAATCATTTA

[0403] CATTTTTAGGGATATGTAATTACTAGTTCAGGTGTATTGCCACAAGACAAACATGTTA

[0404] AGAAACTTTCCCGTTATTTACGCTCTGTTCCTGTTAATCAACCTCTGGATTACAAAAT

[0405] TTGTGAAAGATTGACTGATATTCTTAACTATGTTGCTCCTTTTACGCTGTGTGGATAT

[0406] GCTGCTTTAATGCCTCTGTATCATGCTATTGCTTCCCGTACGGCTTTCGTTTTCTCCTC

[0407] CTTGTATAAATCCTGGTTGCTGTCTCTTTATGAGGAGTTGTGGCCCGTTGTCCGTCAA

[0408] CGTGGCGTGGTGTGCTCTGTGTTTGCTGACGCAACCCCCACTGGCTGGGGCATTGC

[0409] CACCACCTGTCAACTCCTTTCTGGGACTTTCGCTTCCCCCTCCCGATCGCCACGGC

[0410] AGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTAGGTTGCTGGGCA

[0411] CTGATAATTCCGTGGTGTTGTCGGGGAAGGGCC (SEQ ID NO: 26).

[0412] In such embodiments, the subject polynucleotide cassette is flanked at the 5' and 3' ends by functional LTR sequences. Figure 1 The positions of the different elements present in the backbone of the LV vector are depicted in Figure 2. Both LTR sequences have been modified to generate the SIN LV vector. The SIN vector has a 400 bp deletion in the 3'-LTR to cover the promoter / enhancer elements from the U3 region. The expression of the transgene is thus dependent on the internal promoter, thereby reducing the risk of RCL and reducing promoter interference (Ginn et al., 2003). This 3'-LTR deletion removes the TATA box, thereby preventing transcription initiation (Miyoshi et al., 1998; Zuffrey et al., 1998); and thus inactivates the vector. The U3 region of the 5'-LTR has been replaced by other heterologous promoter sequences (i.e., CMV or RSV) to achieve Tat-independent transcription and increase genomic RNA synthesis, thereby increasing viral titer. Because the 5'-U3 region drives the expression of the primary transcript, its modification will not be present in transduced cells (Schambach et al., 2009).

[0413] Exogenous elements such as β-globin or the SV40 polyadenylation signal ( Iwakuma et al., 1999 ) or USE from SV40-USE ( Schambach et al., 2007 ) have also been included in the R region of the viral 3′ LTR to reduce transcriptional readthrough from internal promoters ( Zaiss et al., 2002 ) or remnants of the deleted U3 region from SIN-LV vectors ( Almarza et al., 2011 ), thereby preventing potential transcriptional activation of downstream genes.

[0414] In certain embodiments, an expression cassette or gene delivery vector (e.g., LV) comprises a polynucleotide sequence comprising the following sequence in 5' to 3' order:

[0415] a) a PGK promoter sequence, optionally a human PGK promoter sequence;

[0416] b) a sequence encoding a pyruvate kinase polypeptide, optionally a coRPK encoding or cDNA sequence; and

[0417] c) mutating the wPRE sequence, optionally comprising or consisting of the sequence of SEQ ID NO: 24.

[0418] In certain embodiments, an expression cassette or gene delivery vector (e.g., LV) comprises a polynucleotide sequence comprising the following sequence in 5' to 3' order:

[0419] a) cPPT sequence;

[0420] b) a PGK promoter sequence, optionally a human PGK promoter sequence;

[0421] c) a sequence encoding a pyruvate kinase polypeptide, optionally a coRPK encoding or cDNA sequence; and

[0422] d) mutating the wPRE sequence, optionally comprising or consisting of the sequence of SEQ ID NO: 24.

[0423] In certain embodiments, an expression cassette or gene delivery vector (e.g., LV) comprises a polynucleotide sequence comprising the following sequence in 5' to 3' order:

[0424] a) 5'LTR, optionally a modified 5'LTR;

[0425] b) cPPT sequence;

[0426] c) a PGK promoter sequence, optionally a human PGK promoter sequence;

[0427] d) a sequence encoding a pyruvate kinase polypeptide, optionally a coRPK encoding or cDNA sequence;

[0428] e) mutating the wPRE sequence, optionally comprising or consisting of the sequence of SEQ ID NO: 24; and

[0429] f) 3'LTR, optionally a modified 3'LTR.

[0430] In certain embodiments, an expression cassette or gene delivery vector (e.g., LV) comprises a polynucleotide sequence comprising the following sequence in 5' to 3' order:

[0431] a) 5'LTR, optionally a modified 5'LTR;

[0432] b) cPPT sequence;

[0433] c) a PGK promoter sequence, optionally a human PGK promoter sequence;

[0434] d) a sequence encoding a pyruvate kinase polypeptide, optionally a coRPK encoding or cDNA sequence;

[0435] e) mutating the wPRE sequence, optionally comprising or consisting of the sequence of SEQ ID NO: 24;

[0436] f) 3'LTR, optionally modified 3'LTR;

[0437] g) SV40 poly(A) signal; and

[0438] h) SV40 origin of replication (ori).

[0439] In certain embodiments, an expression cassette or gene delivery vector (e.g., LV) comprises a polynucleotide sequence comprising the following sequence in 5' to 3' order:

[0440] a) 5'LTR, optionally a modified 5'LTR;

[0441] b) cPPT sequence;

[0442] c) a PGK promoter sequence, optionally a human PGK promoter sequence;

[0443] d) a sequence encoding a pyruvate kinase polypeptide, optionally a coRPK encoding or cDNA sequence;

[0444] e) mutating the wPRE sequence, optionally comprising or consisting of the sequence of SEQ ID NO: 24;

[0445] f) 3'LTR, optionally modified 3'LTR;

[0446] g) SV40 poly(A) signal;

[0447] h) SV40 origin of replication (ori);

[0448] i) T7 promoter;

[0449] j) f1 ori; and

[0450] k) NeoR / KanR sequence.

[0451] In certain embodiments, an expression cassette or gene delivery vector (e.g., LV) comprises a polynucleotide sequence comprising the following sequence in 5' to 3' order:

[0452] a) 5'LTR, optionally a modified 5'LTR;

[0453] b) HIV-1ψ sequence;

[0454] c) RRE;

[0455] d) cPPT / CTS sequence;

[0456] e) a PGK promoter sequence, optionally a human PGK promoter sequence;

[0457] f) a sequence encoding a pyruvate kinase polypeptide, optionally a coRPK encoding or cDNA sequence;

[0458] g) mutating the wPRE sequence, optionally comprising or consisting of the sequence of SEQ ID NO: 24;

[0459] h) dNEF signal;

[0460] i) 3'LTR, optionally a modified 3'LTR;

[0461] j) SV40 poly(A) signal;

[0462] k) SV40 origin of replication (ori);

[0463] 1) T7 promoter;

[0464] m)f1 ori;

[0465] n) NeoR / KanR sequence;

[0466] o) rrnG terminator;

[0467] p)ori sequence;

[0468] q) CAP binding site;

[0469] r) lac promoter sequence;

[0470] s) lac operator sequence;

[0471] t) T3 promoter sequence;

[0472] u) a CMV enhancer sequence; and

[0473] v) CMV promoter sequence.

[0474] In certain embodiments, the gene delivery vector is PGK-coRPK LV, or comprises Fig.21 Depicted element.

[0475] In certain embodiments, an expression cassette or gene delivery vector (e.g., LV) comprises a polynucleotide sequence comprising the following sequence in 5' to 3' order:

[0476] a) 5'LTR, optionally a modified 5'LTR;

[0477] b) HIV-1ψ sequence;

[0478] c) RRE;

[0479] d) cPPT / CTS sequence;

[0480] e) a PGK promoter sequence, optionally a human PGK promoter sequence;

[0481] f) a sequence encoding a pyruvate kinase polypeptide, optionally a coRPK encoding or cDNA sequence;

[0482] g) mutating the wPRE sequence, optionally comprising or consisting of the sequence of SEQ ID NO: 24;

[0483] h) optionally, a dNEF signal;

[0484] i) 3'LTR, optionally a modified 3'LTR;

[0485] j) SV40 poly(A) signal;

[0486] k) SV40 origin of replication (ori);

[0487] 1) T7 promoter;

[0488] m) pUC ori;

[0489] u) a CMV enhancer sequence; and

[0490] v) CMV promoter sequence.

[0491] In specific embodiments of any of the expression cassettes and gene delivery vectors described herein, the coRPK cDNA or coding sequence encodes a PKLR polypeptide comprising or containing the sequence disclosed in any of GenBank Accession Nos. XP_016856982.1, XP_011507942.1, XP_006711449.1, NP_870986.1, or NP_000289.1, a functional fragment of any of these sequences, or a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to any of these sequences.

[0492] Standard methods can be used to produce gene therapy vectors that encapsidate the polynucleotide cassettes of the present disclosure. For example, in the case of LV virions, the LV expression vector according to the present invention can be introduced into production cells, followed by the introduction of LV helper constructs, wherein the helper constructs contain LV coding regions that can be expressed in production cells and the LV coding regions can supplement LV helper functions that are not present in the LV vector. Helper viruses and / or additional vectors are then introduced into production cells, wherein the helper viruses and / or additional vectors provide helper functions that can support efficient LV virus production. The production cells are then cultured to produce LV. These steps are performed using standard methods.

[0493] Any suitable method for producing viral particles for delivery of the subject polynucleotide cassettes may be used, including but not limited to those described in the Examples below. Any concentration of viral particles suitable for effective transduction of mammalian cells may be prepared to contact mammalian cells in vitro or in vivo. For example, the concentration of viral particles may be formulated to be 10 8 vector genomes or more, for example 5×10 per ml 8 vector genomes; 10 per ml 9 vector genomes; 5×10 per ml 9 vector genomes, 10 per ml 10 vector genomes, 5×10 per ml 10 vector genomes; 10 per ml 11 vector genomes; 5×10 per ml 11 vector genomes; 10 per ml 12 vector genomes; 5×10 per ml 12 vector genomes; 10 per ml 13 vector genomes; 1.5×10 per ml 13 vector genomes; 3×10 per ml13 vector genomes; 5×10 per ml 13 vector genomes; 7.5×10 per ml 13 vector genomes; 9×10 per ml 13 vector genomes; 1×10 per ml 14 vector genomes, 5×10 per ml 14 or more vector genomes, but usually no more than 1 × 10 per ml 15 vector genome.

[0494] In preparing the subject LV compositions, any host cell for producing LV virions can be employed, including but not limited to, for example, mammalian cells (e.g., 293 cells), insect cells (e.g., SF9 cells), microorganisms, and yeast. The host cell can also be a packaging cell, in which the LV rep and cap genes are stably maintained in the host cell, or a production cell, in which the LV vector genome is stably maintained and packaged. Exemplary packaging and production cells are derived from SF-9, 293, A549, or HeLa cells. LV vectors are purified and formulated using standard techniques known in the art.

[0495] In certain embodiments, the present invention includes a cell comprising an expression cassette or a gene delivery vector disclosed herein. In a related embodiment, a cell is transduced with a viral vector comprising an expression cassette disclosed herein or with an expression cassette integrated into the cell genome disclosed herein. In certain embodiments, the cell is a cell for producing a viral gene delivery vector. In other embodiments, the cell is a cell to be delivered to a subject to provide a gene product encoded by an expression cassette to the subject. Therefore, in certain embodiments, the cell is autologous to the subject to be treated, or is obtained from the subject to be treated. In other embodiments, the cell is allogeneic to the subject to be treated, or is obtained from a donor different from the subject to be treated. In a specific embodiment, the cell is a mammalian cell, such as a human cell. In certain embodiments, the cell is a blood cell, an erythrocyte, a hematopoietic progenitor cell, a bone marrow cell, such as a lineage-depleted bone marrow cell, a hematopoietic stem cell (e.g., CD34+) or a directed hematopoietic erythroid progenitor cell.

[0496] The present invention includes pharmaceutical compositions comprising polynucleotide boxes, gene delivery vectors or cells described herein and pharmaceutically acceptable carriers, diluents or excipients. The subject polynucleotide boxes, gene delivery vectors or cells can be combined with pharmaceutically acceptable carriers, diluents and reagents that can be used to prepare formulations, which are generally safe, non-toxic and desirable and include acceptable excipients for use by primates. Such excipients can be solid, liquid, semisolid or gas (in the case of aerosol compositions). Examples of such excipients, carriers or diluents include but are not limited to water, saline, Ringer's solution, dextrose solution and 5% human serum albumin. Supplementary active compounds can also be incorporated into formulations. Solutions or suspensions used in formulations may contain: sterile diluents such as water for injection, saline solution, fixed oils, polyethylene glycol, glycerol, propylene glycol or other synthetic solvents; antibacterial compounds such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating compounds such as ethylenediaminetetraacetic acid (EDTA); buffers such as acetates, citrates or phosphates; detergents such as Tween 20 to prevent polymerization; and compounds for adjusting tonicity such as sodium chloride or dextrose. The pH may be adjusted with acids or bases such as hydrochloric acid or sodium hydroxide. In particular embodiments, the pharmaceutical composition is sterile.

[0497] Pharmaceutical compositions suitable for use in the present invention further include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion.

[0498] As required, a sterile solution can be prepared by incorporating a desired amount of the active compound into a suitable solvent with one of the ingredients listed above or a combination thereof, followed by filtration sterilization. Typically, dispersions are prepared by incorporating the active compound into a sterile vehicle containing a basic dispersion medium and other desired ingredients from those listed above. In the case of sterile powders for the preparation of sterile injectable solutions, the preparation method is vacuum drying and freeze drying, which produces a powder of the active ingredient plus any additional desired ingredients from its previous sterile filtered solution.

[0499] In one embodiment, the composition is prepared with a carrier that will protect the gene cassette or expression vector from rapid elimination from the body, such as a controlled release formulation, a delivery system comprising an implant and microencapsulation. Biodegradable, biocompatible polymers such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid can be used. Methods for preparing such formulations are apparent to those skilled in the art. Materials can also be commercially available.

[0500] It is particularly advantageous to formulate oral, ophthalmic or parenteral compositions in dosage unit form for ease of administration and uniformity of dosage. As used herein, dosage unit form refers to physically discrete units suitable as unitary dosages for the subject to be treated; each unit containing a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The specifications for the dosage unit forms of the present invention are dictated by and directly dependent on the unique characteristics of the active compound and the specific therapeutic effect to be achieved and the limitations inherent in the art of compounding such active compounds for treating individuals.

[0501] The pharmaceutical compositions may be included in a container, pack, or dispenser, such as a syringe, eg, a prefilled syringe, together with instructions for administration.

[0502] The pharmaceutical compositions of the present invention encompass any pharmaceutically acceptable salt, ester or salt of such an ester, or any other compound that is capable of providing (directly or indirectly) a biologically active metabolite or residue thereof when administered to an animal, including a human.

[0503] The term "pharmaceutically acceptable salt" refers to physiologically acceptable salts and pharmaceutically acceptable salts of the compounds of the present invention: that is, salts that retain the desired biological activity of the parent compound and do not produce undesirable toxicological effects on the parent compound. Various pharmaceutically acceptable salts are known in the art and described in the following literature: for example, "Remington's Pharmaceutical Sciences", 17th edition, Alfonso R. Gennaro (ed.), Mark Publishing Company, Easton, Pennsylvania, USA (Mark Publishing Company, Easton, PA, USA), 1985 (and its most recent edition); "Encyclopaedia of Pharmaceutical Technology", 3rd edition, James Swarbrick (ed.), Informa Healthcare USA (Informa Healthcare USA (Inc.), NY, USA), 2007; and "J. Pharm. Sci." 66:2 (1977). Additionally, for suitable salts, see Stahl and Camille, Handbook of Pharmaceutical Salts: Properties, Selection, and Use (Wiley-VCH, 2002).

[0504] Pharmaceutically acceptable base addition salts are formed with metals or amines such as alkali metals and alkaline earth metals or organic amines. Metals used as cations include sodium, potassium, magnesium, calcium, etc. Amines include N-N'-dibenzylethylenediamine, chloroprocaine, choline, diethanolamine, dicyclohexylamine, ethylenediamine, N-methylglucamine and procaine (see, for example, Berge et al., "Pharmaceutical Salts", Journal of Pharmacy (J.Pharma Sci), 1977, 66, 119). The base addition salt of an acidic compound is prepared by contacting the free acid form with a sufficient amount of the desired base to produce a salt in a conventional manner. The free acid form can be regenerated by contacting the salt form with the acid and separating the free acid in a conventional manner. The free acid form is slightly different from its respective salt form in certain physical properties such as solubility in polar solvents, but for the purposes of the present invention, the salt is equivalent to its respective free acid.

[0505] The subject polynucleotide cassettes, gene delivery vectors (e.g., recombinant viruses (virions) or cells (e.g., transduced with a gene delivery vector disclosed herein) can be incorporated into pharmaceutical compositions for administration to mammalian patients, particularly primates and more particularly humans. The subject polynucleotide cassettes, gene delivery vectors (e.g., virions or cells) can be formulated in a non-toxic, inert, pharmaceutically acceptable aqueous carrier, preferably at a pH in the range of 3 to 8, more preferably, in the range of 6 to 8. Such sterile compositions will include vectors or virions containing nucleic acids encoding therapeutic molecules that are dissolved in an aqueous buffer having an acceptable pH value after reconstitution.

[0506] In some embodiments, the pharmaceutical compositions provided herein include therapeutically effective amounts of cells, vectors or virus particles disclosed herein mixed with pharmaceutically acceptable carriers and / or excipients, such as saline, phosphate buffered saline, phosphate and amino acids, polymers, polyols, sugars, buffers, preservatives and other proteins. Exemplary amino acids, polymers and sugars, etc. are octylphenoxy polyethoxyethanol compounds, polyethylene glycol monostearate compounds, polyoxyethylene sorbitol fatty acid esters, sucrose, fructose, dextrose, maltose, glucose, mannitol, dextran, sorbitol, inositol, galactitol, xylitol, lactose, trehalose, bovine or human serum albumin, citrate, acetate, Ringer's solution and Hank's solution, cysteine, arginine, carnitine, alanine, glycine, lysine, valine, leucine, polyvinyl pyrrolidone, polyethylene and ethylene glycol. Preferably, this formulation is stable at 4°C for at least six months.

[0507] In some embodiments, the pharmaceutical compositions provided herein include a buffer such as phosphate buffered saline (PBS) or sodium phosphate / sodium sulfate, tris buffer, glycine buffer, sterile water, and other buffers known to those of ordinary skill in the art, such as those described in Good et al. (1966) Biochemistry 5: 467. The pH of the buffer of the pharmaceutical composition including the tumor suppressor gene contained in the adenoviral vector delivery system can be in the range of 6.5 to 7.75, preferably 7 to 7.5, and most preferably 7.2 to 7.4.

[0508] In certain embodiments, the viral vector can be formulated into any suitable unit dose, including but not limited to 1×10 8 vector genomes or more, e.g., 1 × 10 9 pcs, 1×10 10 pcs, 1×10 11 pcs, 1×10 12 or 1×10 13 vector genomes or more, in some cases 1 × 10 14 vector genomes, but usually no more than 4 × 10 15 In some cases, the unit dose is up to about 5×10 15 vector genomes, e.g. 1×10 14 vector genomes or less, e.g. 1×10 13 pcs, 1×10 12 pcs, 1×10 11 pcs, 1×10 10 or 1×10 9 vector genomes or fewer, and in some cases, 1 × 10 8 vector genomes or less, and usually not less than 1 × 10 8 In some cases, the unit dose is 1×10 10 to 1×10 11 In some cases, the unit dose is 1×10 10 to 3×10 12 In some cases, the unit dose is 1×10 9 to 3×10 13 In some cases, the unit dose is 1×10 8 to 3×10 14 In one embodiment, the range is about 5×10 10 to about 1×10 11 In some embodiments, the range is about 1×109 to about 1×10 10 vector genome.

[0509] In some cases, the unit dose of a pharmaceutical composition can be measured using the multiplicity of infection (MOI). MOI refers to the ratio or multiple of vector or viral genome to cells to which nucleic acid can be delivered. In some cases, MOI can be 1×10 6 In some cases, the MOI can be 1×10 5 -1×10 7 In some cases, the MOI can be 1×10 4 -1×10 8 In some cases, the recombinant virus of the present disclosure is at least about 1×10 1 pcs, 1×10 2 pcs, 1×10 3 pcs, 1×10 4 pcs, 1×10 5 pcs, 1×10 6 pcs, 1×10 7 pcs, 1×10 8 pcs, 1×10 9 pcs, 1×10 10 pcs, 1×10 11 pcs, 1×10 12 pcs, 1×10 13 pcs, 1×10 14 pcs, 1×10 15 pcs, 1×10 16 pcs, 1×10 17 and 1×10 18 In some cases, the recombinant virus of the present disclosure is 1×10 8 to 3×10 14 In some cases, the recombinant virus of the present disclosure is at most about 1×10 1 pcs, 1×10 2 pcs, 1×10 3 pcs, 1×10 4 pcs, 1×10 5 pcs, 1×10 6 pcs, 1×10 7 pcs, 1×10 8 pcs, 1×10 9 pcs, 1×10 10 pcs, 1×10 11 pcs, 1×10 12 pcs, 1×10 13 pcs, 1×10 14 pcs, 1×10 15 pcs, 1×10 16pcs, 1×10 17 and 1×10 18 In some embodiments, the range is from about 20 to about 400 MOI.

[0510] In some aspects, the amount of the pharmaceutical composition comprises about 1×10 8 to about 1×10 15 Recombinant viruses, about 1×10 9 to about 1×10 14 Recombinant viruses, about 1×10 10 to about 1×10 13 recombinant virus or about 1×10 11 to about 3×10 12 A recombinant virus.

[0511] method

[0512] Therefore, the subject polynucleotide boxes and gene delivery vectors collectively referred to herein as "theme compositions" can be used to express transgenes in the cells of animals. For example, the theme composition can be used in research, for example to determine the effects of genes on cell viability and / or function. As another example, the theme composition can be used in medicine, for example to treat or prevent diseases or illnesses. Therefore, in some aspects of the present invention, a method for expressing genes in cells is provided, the method comprising contacting cells with a composition of the present disclosure. In some embodiments, contact occurs in vivo or in vitro. In some embodiments, contact occurs in vivo, i.e., the theme composition is administered to a subject.

[0513] For mammalian cells in vivo or in vitro with the subject polynucleotide box or the gene delivery vector comprising the subject polynucleotide box contact, the cell can be from any mammalian species, such as rodents (e.g., mice, rats, gerbils, squirrels), rabbits, cats, dogs, goats, sheep, pigs, horses, cattle, primates, humans. The cell can be from an established cell line or the cell can be a primary cell, wherein "primary cell", "primary cell line" and "primary culture" are used interchangeably herein to refer to cells and cell cultures derived from a subject and to allow a limited number of passages of in vitro growth cultures, i.e., divisions. For example, a primary culture is a culture that can be passed down 0, 1, 2, 4, 5, 10 or 15 times, but the number is not enough to survive the crisis period. Typically, the primary cell line of the present invention is maintained in vitro less than 10 passages.

[0514] In certain embodiments, the cell contacted with the disclosed polynucleotide box or gene delivery vector is a hematopoietic stem cell from a subject or from a donor (e.g., an allogeneic donor). In certain embodiments, a biological sample (e.g., peripheral blood) is obtained from a subject after the mobilization of hematopoietic stem cells (HSC). In one embodiment, HSC and / or progenitor cells are mobilized by treating the subject with G-CSF or its analogs. HSC and progenitor cells (HSPC) in peripheral blood can be mobilized before collecting the biological sample. Peripheral blood HSC and HSPC can be mobilized by any method known in the art. Peripheral blood HSC and HSPC can be mobilized by any one or more agents described herein or known in the art that increase the number of HSPC circulating in the peripheral blood of the subject to mobilize peripheral blood HSC and HSPC. For example, in certain embodiments, peripheral blood is mobilized by treating the subject with one or more cytokines or growth factors (e.g., G-CSF, kit ligand (KL), IL-I, IL-7, IL-8, IL-11, Flt3 ligand, SCF, thrombopoietin, or GM-CSF (such as sargramostim). Different types of G-CSF that can be used in methods for mobilizing peripheral blood include filgrastim and a longer-acting G-CSF: pegfilgrastim. In certain embodiments, peripheral blood is mobilized by treating a subject with one or more chemokines (e.g., macrophage inflammatory protein-1a (MIP1a / CCL3)), chemokine receptor ligands (e.g., chemokine receptor 2 ligands GRO13 and GR013M), chemokine receptor analogs (e.g., stromal cell-derived factor-1a (SDF-1a) protein analogs, such as CTCE-0021, CTCE-0214 or SDF-1a, such as Met-SDF-113), or chemokine receptor antagonists (e.g., chemokine (CXC motif) receptor 4 (CXCR4) antagonists, such as AMD3100). In certain embodiments, peripheral blood is mobilized by treating a subject with one or more anti-integrin signaling agents (e.g., function-blocking anti-very late antigen 4 (VLA-4) antibodies or anti-vascular cell adhesion molecule 1 (VCAM-1)). In a specific embodiment, peripheral blood is mobilized by treating a subject with one or more cytotoxic drugs such as cyclophosphamide, etoposide or paclitaxel. In a specific embodiment, peripheral blood is mobilized by applying one or more medicaments in the above-listed medicaments to the subject for a certain period of time. For example, before collecting HSPC, one or more medicaments (for example, G-CSF) can be used to treat a subject once a day or twice a day by injection (for example, subcutaneous, intravenous or intraperitoneal) for 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days or 14 days.In a specific embodiment, HSPC is collected within 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 12 hours, 14 hours, 16 hours, 18 hours, 20 hours or 24 hours after the last dose of the medicament for mobilizing HSPC into the peripheral blood. In a specific embodiment, HSC and HSPC are mobilized by treating the subject with two or more different types of medicaments described above or known in the art (such as growth factors (e.g., G-CSF) and chemokine receptor antagonists (e.g., CXCR4 receptor antagonists, such as AMD3100) or growth factors (e.g., G-CSF or KL) and anti-integrin agents (e.g., function blocking VLA-4 antibodies)). In one embodiment, HSC and / or progenitor cells are mobilized by treating the subject with G-CSF or its analogs. In one embodiment, G-CSF is filgrastim. In one embodiment, HSC and / or progenitor cells are mobilized by treating the subject with plerixafor. In a certain embodiment, HSCs and / or progenitor cells are mobilized using a combination of filgrastim and plerixafor, by filgrastim alone, or by plerixafor alone. In specific embodiments, different types of mobilizing agents are administered simultaneously or sequentially. For additional information on methods of mobilizing peripheral blood, see, e.g., Craddock et al., 1997, Blood 90(12):4779-4788; Jin et al., 2008, Journal of Translational Medicine 6:39; Pelus, 2008, Curr. Opin. Hematol. 15(4):285-292; Papayannopoulou et al., 1998, Blood 91(7):2231-2239; Tricot et al., 2008, Haematologica 93(11):1739-1742; and Weaver et al., 2001, Bone Marrow Transplantation 27(2):S23-S29.

[0515] In some embodiments, cells are enriched prior to contacting the cells with a disclosed polynucleotide cassette or gene delivery vector. As used herein, "enriched" or "highly enriched" refers to a method of enriching a cell population that is intended to result in a substantial enrichment of cells expressing a particular biomarker (e.g., CD34). For example, CD34 enrichment used clinically results in a mean of 61.6% and a median of CD34. +65.7% yield of cells and mean: 88.5% and median: 95.9% relative purity (N=166) (Clin Lab. 2016 Jul 1; 62(7): 1243-1248 (PMID: 28164638)). "Enrichment" refers to a process aimed at enriching a relatively rare cell type CD34+, which typically includes between 0.2-2% of the cell product in mobilized leukapheresis or bone marrow collection. Enrichment of CD34+ cells from mobilized leukapheresis or bone marrow collection targets an increase in percentage from 0.2-2% to a final CD34+ of >80%. To this end, after the biological sample is initially applied to the capture matrix, repeated buffer exchanges referred to herein as "washing" are performed with the goal of removing cells that are weakly or non-specifically bound to the capture matrix. Typically, cells are removed from the capture matrix and reapplied in each wash cycle. Removal and reapplication can be done manually by pipetting from a tube or automated using a pump and tubing system. Magnetic Cell Separation System Coupled to Quad Technologies Cell-magnetic particle complexes were separated in tubes on a magnetic stand and washed manually. System, pre-set automated program applies cell-magnetic particle complexes to magnetic columns in tube set and wash / re-application is done using valve pump system. In certain embodiments, selection can be performed on various instruments, including but not limited to Miltenyi Biotec MACSQuant Quad Technologies GE Cell separation system, Terumo Cell separation system, COBE Cell separator, SynGen or System, Fresenius-Kabi Miltenyi Biotec System or CliniMACS System. Selection can be performed in the laboratory or at the point of care. Detailed methods for preparing and enriching cells and cell populations, including exemplary methods for selecting CD34+ cells, are described, for example, in International Patent Publication No. WO / 2016 / 118790. U.S. Patent No. 8,727,132 provides illustrative selection methods useful for high stringency selection.

[0516] In certain embodiments, peripheral blood is obtained by a syringe or a catheter inserted into a blood vessel of a subject or a donor. For example, a single blood collection machine can be used to collect peripheral blood. Blood flows from a blood vessel through a catheter to separate leukocytes (HSPCs from the remainder of the blood), and then the remainder of the blood is returned to the body of the subject. Apheresis can be performed for several hours in consecutive days (e.g., 1 to 5 days) until enough HSPCs have been collected.

[0517] In certain embodiments, bone marrow is obtained from the posterior iliac crest of a subject by fine needle aspiration (see, e.g., Koda et al., 1984, J. Clin Invest. 73: 1377-1384).

[0518] In certain embodiments, the hematocrit level of a biological sample can be determined. The hematocrit level can be determined by centrifuging the sample in a processing chamber to separate the RBCs of the sample into layers so that the packed cell volume can be determined. It should be understood that the sample can be combined with an anticoagulant to help determine the hematocrit level, and such an anticoagulant can be added to the processing chamber before or during centrifugation. Alternatively, the hematocrit level can be determined by measuring the optical properties of the sample. For example, a spectrometer can be used to analyze the sample. It should be understood that any type of known spectroscopic method for determining the hematocrit level can be used, such as, for example, Raman spectroscopy and / or light scattering techniques.

[0519] In certain embodiments, the biological sample depletes red blood cells, such as before preparing one or more cell populations enriched for CD34+ cells from the biological sample. In some embodiments, the cells remaining after the depletion technique are washed. In another embodiment, non-specific IgG is added to the washed cells. In some embodiments, the non-specific IgG is flebogamma.

[0520] Embodiments of the present invention include mammalian cells (e.g., CD34+ cells) transduced with a viral delivery vector (e.g., a LV vector containing a human PKLR gene). Therefore, the present invention includes a method for transducing mammalian cells (e.g., human hematopoietic stem cells or other cells described herein), the method comprising contacting the cells with a viral delivery vector (e.g., a LV vector) comprising a gene expression cassette described herein. In certain embodiments, cells are previously obtained from a subject to be treated or from another donor. In a specific embodiment, the subject is diagnosed with PKD, and the cells are transduced with a LV comprising an expression cassette (e.g., a coRPK coding region or cDNA) encoding pyruvate kinase. It should be understood that the disclosed methods (e.g., those for delivering pyruvate kinase gene products to subjects using, for example, a coPRK cDNA sequence) can also be used to treat hemolytic anemia and / or normalize erythroid differentiation, increase the number of functional mature erythrocytes, reduce extramedullary erythropoiesis, reduce hepatomegaly and other secondary effects of hemolytic anemia or PKD.

[0521] To promote expression of the transgene, a subject polynucleotide cassette or a gene delivery vehicle comprising a subject polynucleotide cassette will be contacted with the cells for about 30 minutes to 24 hours or longer, e.g., 1 hour, 1.5 hours, 2 hours, 2.5 hours, 3 hours, 3.5 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 12 hours, 16 hours, 18 hours, 20 hours, 24 hours, etc.

[0522] The subject polynucleotide box or the gene delivery vector comprising the subject polynucleotide box can be provided to the subject cell once or multiple times, for example once, twice, three times or more than three times, and the cell can be allowed to cultivate a certain amount of time with one or more medicaments after each contact event, for example 16-24 hours, after which the culture medium is replaced with fresh culture medium and the cells are further cultured. The contact cells can occur in any culture medium and under any culture condition that promotes cell survival. The culture can contain a growth factor to which the cell responds. As defined herein, a growth factor is a molecule that can promote cell survival, growth and / or differentiation in culture or intact tissue by the specific action on transmembrane receptors. Growth factors include polypeptides and non-polypeptide factors.

[0523] Typically, an effective amount of a subject polynucleotide box or a gene delivery vector comprising a subject polynucleotide box is provided to produce transgenic expression in a cell. As discussed elsewhere herein, an effective amount can be easily determined empirically, such as by detecting the presence or level of a transgenic product, by detecting the impact on cell viability or function, etc. Typically, compared with the subject polynucleotide boxes known in the art of the same amount, an effective amount of a subject polynucleotide box or a gene delivery vector comprising a subject polynucleotide box will promote the higher expression of transgenic in a cell. Typically, relative to expression from a reference or control (such as a polynucleotide box known in the art), expression will enhance 2 times or more times, such as 3 times, 4 times or 5 times or more times, in some cases, 10 times, 20 times or 50 times or more times, such as 100 times.

[0524] For cells contacted with a subject polynucleotide cassette or a gene delivery vector comprising a subject polynucleotide cassette in vivo, the subject can be any mammal, such as a rodent (e.g., mouse, rat, gerbil), rabbit, cat, dog, goat, sheep, pig, horse, cow, or primate. In a preferred embodiment, the primate is a human. In some embodiments, the cell is a CD34+ cell.

[0525] The methods and compositions of the present disclosure are useful, for example, in treating pyruvate kinase deficiency.

[0526] In another embodiment, the present invention comprises a method for treating a disease in a subject in need thereof, the method comprising providing an effective amount of cells transduced with a gene delivery vector (e.g., a viral vector) to the subject, the gene delivery vector expressing a therapeutic gene product in the cell. In a specific embodiment, the cell is autologous to the subject. In certain embodiments, the cell is an erythroid cell, such as a hematopoietic stem cell or a directed hematopoietic erythroid progenitor cell. In some embodiments, the cell is a bone marrow cell, such as a lineage-depleted bone marrow cell. In a specific embodiment, the method is used to treat PKD, and the viral vector is a LV comprising an expression construct disclosed herein, the expression construct comprising a human PGK promoter operably linked to a coRPK gene cDNA or coding sequence and a mutant wPRE disclosed herein. In a specific embodiment, the cell is provided to the subject parenterally, for example by intravenous injection. In a specific embodiment, the cell is provided to the subject by infusion.

[0527] In another embodiment, the present invention comprises a method of treating PKD in a subject in need thereof, the method comprising providing to the subject an effective amount of autologous CD34+ stem cells transduced with an LV vector that expresses coRPK cDNA in the cells, wherein the LV vector comprises a human PGK promoter operably linked to the coRPK cDNA or coding sequence and a mutant wPRE sequence disclosed herein. In a specific embodiment, the cells are hematopoietic stem cells or committed hematopoietic erythroid progenitor cells, such as bone marrow cells. In a specific embodiment, the cells are provided to the subject parenterally, such as by intravenous injection.

[0528] In another embodiment, the present invention provides a method for treating a disease in a subject in need thereof, the method comprising providing an effective amount of a gene delivery vector (e.g., a viral vector) to the subject, the gene delivery vector expressing a therapeutic gene product in the subject. In a specific embodiment, the method is used to treat PKD, and the viral vector is a LV comprising an expression construct disclosed herein, the expression construct comprising a human PGK promoter operably connected to a coRPK gene cDNA or coding sequence and a mutant wPRE disclosed herein. In a specific embodiment, the gene delivery vector is provided to the subject parenterally, for example, by intravenous injection.

[0529] In certain embodiments, the cells or gene delivery vector are provided to the subject in the form of a pharmaceutical composition.

[0530] In some embodiments, the subject methods produce a therapeutic benefit, such as preventing the development of a condition, halting the progression of a condition, reversing the progression of a condition, etc. In some embodiments, the subject methods include a step of detecting that a therapeutic benefit has been achieved. One of ordinary skill will appreciate that such a measure of therapeutic efficacy will be applicable to the particular disease being modified, and will recognize appropriate detection methods for measuring therapeutic efficacy.

[0531] It is expected that the expression of the transgenic obtained using the subject transgenic is robust.Therefore, in some cases, for example, as by measuring the level of gene product, by measuring the expression of the transgenic detected by therapeutic efficacy etc. can be observed in two months or shorter time after using, for example, in 4 weeks, 3 weeks or 2 weeks or shorter time after using, for example, in 1 week after using the subject composition.Also expect that the expression of transgenic continues over time.Therefore, in some cases, for example, as by measuring the level of gene product, by measuring the expression of the transgenic detected by therapeutic efficacy etc. can be observed in 2 months or longer time after using the subject composition, for example, 4 months, 6 months, 8 months or 10 months or longer time, in some cases 1 year or longer time, for example 2 years, 3 years, 4 years or 5 years, in some cases more than 5 years.

[0532] In certain embodiments, the method comprises the step of detecting expression of a transgene in a cell or in a subject, wherein expression is enhanced relative to expression from a polynucleotide cassette that does not include one or more improved elements of the present disclosure. Typically, expression will be enhanced 2-fold or more, such as 3-fold, 4-fold or 5-fold or more, in some cases 10-fold, 20-fold or 50-fold or more, such as 100-fold, as demonstrated by, for example, earlier detection, higher levels of gene product, greater functional effects on cells, etc., relative to expression from a reference, such as known in the art (i.e., a control polynucleotide cassette).

[0533] Typically, if the subject composition is a LV comprising a subject polynucleotide cassette of the present disclosure, the effective amount for effecting the change will be about 1×10 8 vector genomes or more, in some cases 1 × 10 9 pcs, 1×10 10 pcs, 1×10 11 pcs, 1×10 12 or 1×10 13 vector genomes or more, in some cases 1 × 10 14 vector genomes or more, and usually no more than 1 × 10 15 In some cases, the amount of delivered vector genomes is at most about 1×10 15 vector genomes, e.g. 1×10 14 vector genomes or less, e.g. 1×10 13 pcs, 1×10 12 pcs, 1×10 11 pcs, 1×10 10 or 1×10 9 vector genomes or fewer, and in some cases, 1 × 10 8 vector genomes, and usually no less than 1 × 10 8 In some cases, the amount of vector genome delivered is 1×10 10 to 1×10 11 In some cases, the amount of vector genome delivered is 1×10 10 to 3×10 12 In some cases, the amount of vector genome delivered is 1×10 9 to 3×10 13 In some cases, the amount of vector genome delivered is 1×10 8 to 3×10 14 vector genome.

[0534] In some cases, the amount of a pharmaceutical composition to be administered can be measured using a multiplicity of infection (MOI). In some cases, MOI can refer to the ratio or multiple of vector or viral genome to cells to which nucleic acid can be delivered. In some cases, MOI can be 1×10 6 In some cases, the MOI can be 1×10 5 -1×10 7 In some cases, the MOI can be 1×10 4 -1×10 8 In some cases, the recombinant virus of the present disclosure is at least about 1×10 1 pcs, 1×10 2 pcs, 1×10 3 pcs, 1×10 4 pcs, 1×10 5 pcs, 1×10 6 pcs, 1×10 7 pcs, 1×10 8 pcs, 1×10 9 pcs, 1×10 10 pcs, 1×10 11 pcs, 1×10 12 pcs, 1×10 13 pcs, 1×10 14 pcs, 1×10 15 pcs, 1×10 16 pcs, 1×10 17 and 1×10 18 In some cases, the recombinant virus of the present disclosure is 1×10 8 to 3×10 14 In some cases, the recombinant virus of the present disclosure is at most about 1×10 1 pcs, 1×10 2 pcs, 1×10 3 pcs, 1×10 4 pcs, 1×10 5 pcs, 1×10 6 pcs, 1×10 7 pcs, 1×10 8 pcs, 1×10 9 pcs, 1×10 10 pcs, 1×10 11 pcs, 1×10 12 pcs, 1×10 13 pcs, 1×10 14 pcs, 1×10 15 pcs, 1×10 16 pcs, 1×10 17 and 1×10 18 MOIs.

[0535] In some aspects, the amount of the pharmaceutical composition comprises about 1×10 8 to about 1×10 15 Recombinant virus particles, about 1×10 9 to about 1×10 14 Recombinant virus particles, about 1×10 10 to about 1×10 13 recombinant virus particles or about 1×10 11 to about 3×10 12 recombinant virus particles.

[0536] Any total number of viral particles suitable for providing adequate cell transduction to impart the desired effect or treat disease may be administered to a mammal. In various preferred embodiments, at least 10 8 5×10 8 10 9 5×10 9 10 10 pcs, 5×10 10 10 11 5×10 11 10 12 5×10 12 10 13 1.5×10 13 3×10 13 5×10 13 7.5×10 13 9×10 13 pcs, 1×10 14 Virus particles or 5×10 14 Virus particles or more, but injection usually does not exceed 1×10 15 Any suitable number of vectors may be administered to the eye of a mammal or primate. In one embodiment, the method comprises a single administration; in other embodiments, multiple administrations are performed over time as deemed appropriate by the attending clinician. In some embodiments, a single administration (24-hour transduction) requires at least 2×10 8 5×10 VG / ml 5Cells / ml are used to produce high transduction efficiency. Individual doses are usually not less than the amount required for producing a measurable effect on the subject, and can be determined based on the pharmacokinetics and pharmacology of the absorption, distribution, metabolism and excretion ("ADME") of the subject composition or its byproducts and therefore determined based on the disposal of the composition in the subject. This includes consideration of route of administration and dosage. Effective doses and / or dosage regimens can be easily determined empirically based on preclinical assays, based on safety and incremental and dose range trials, individual clinician-patient relationships, and in vitro and in vivo assays (such as those described herein and shown in the Examples).

[0537] Several aspects of the present invention are described herein with reference to the example applications for illustration. It should be appreciated that many specific details, relationships and methods have been set forth to provide a full understanding of the present invention. However, those of ordinary skill in the relevant art will readily appreciate that the present invention can be put into practice without one or more of the specific details or with other methods. The present invention is not subject to the restriction of the sequencing of the described actions or events, because some actions can occur in different orders and / or simultaneously with other actions or events. In addition, implementation according to the method of the present invention does not require all actions or events of display.

[0538] Further, it should be noted that the claims may be drafted without including any optional elements. Therefore, this statement is intended to serve as antecedent basis for use of exclusive terminology such as "solely," "only," etc. in connection with the recitation of claim elements or use of a "negative" limitation.

[0539] Only the disclosures of the publications discussed herein before the filing date of the present application are provided. Anything herein should not be construed as admitting that the present invention is not entitled to precede such publications due to prior inventions. Further, the publication date provided may be different from the actual publication date, which may need to be independently confirmed.

[0540] All of the above-mentioned U.S. patents, U.S. patent application publications, U.S. patent applications, foreign patents, foreign patent applications, and non-patent publications mentioned in this specification and / or listed in the Application Data Sheet are incorporated herein by reference in their entirety, e.g., to disclose and describe the methods and / or materials in conjunction with the cited publications. It should be understood that in the event of a conflict, the present disclosure supersedes any disclosure of the incorporated publications.

[0541] From the foregoing, it should be appreciated that although specific embodiments of the invention have been described herein for purposes of illustration, various modifications may be made without departing from the spirit and scope of the invention. Accordingly, the invention is not to be limited except as in the appended claims.

[0542] Examples

[0543] The following examples are presented to provide a complete disclosure and description of how to make and use the present invention to one of ordinary skill in the art, and are not intended to limit the scope of what the inventors consider to be their invention, nor are they intended to represent that the following experiments are all or the only experiments performed. Although efforts have been made to ensure accuracy with respect to the numbers used (e.g., amounts, temperatures, etc.), some experimental errors and deviations should still be considered. Unless otherwise indicated, parts are parts by weight, molecular weight is weight average molecular weight, temperature is degrees Celsius, and pressure is at or near atmospheric pressure.

[0544] Experimental methods

[0545] Vector and LV supernatant production. LVs were generated as described herein. The CoRPK sequence was designed by software to increase the GC content of the sequence and prevent cryptic splice sites. The pCCL.sin.ppt.hPGK-EGFP-wPRE* construct generously provided by Dr. Naldinip (HSR-TIGET, San Raffaele Telethon Institute, Milan, Italy) was used as the backbone development vector. The original pCCL lentiviral transfer vector and its elements are described in Dull et al., Journal of Virology, 1998; 72(11): 8463-8471, which is incorporated herein in its entirety. Vector stocks of VSV-G pseudotyped LV were prepared by 3-plasmid calcium phosphate-mediated transfection in 293T cells (ATCC, Rockville, MD, USA: CRL-1573) as previously described [Follenzi A et al., (2000). Nat Genet 25: 217-222]. The titer of infectious LV was determined in HT1080 cells by qPCR as described elsewhere [Charrier S et al., (2005). Gene Therapy 12:597-606]. 10 7 -10 8 LV stock solution with a titer of 10 virus particles (vp) / mL.

[0546] Purification and transduction of murine HSCs. BM from 8-14 week old male PKD mice was harvested from leg bones and transduced using Lin - Cell depletion kit (Miltenyi Biotec, Gladbach, Germany) was used to purify lineage-negative cells (Lin -), thereby obtaining a purity of 70-90%. Lin was pre-stimulated with 100 ng / mL recombinant human IL-11 (Peprotech EC Ltd., London, UK) and 100 ng / mL recombinant mouse SCF (R&D Systems Inc., Minneapolis, MN) in IMDM-Glutamax medium (Thermo Fisher Scientific, Waltham, MA) supplemented with 20% FBS and 0.5% antibiotics (50 U / mL penicillin and 50 μg / mL streptomycin). - Cells were cultured for 24 hours and then transduced with EGFP or coRPK carrying LVs at an MOI of 1-10 vp / cell in two transduction cycles. Each transduction was performed on cells previously coated with CH-296 fibronectin fragments (2 μg / cm 2 ; Takara Shuzo (Takara Shuzo, Otsu, Japan) on a plate containing Retronectin for 24 hours at 4°C overnight.

[0547] In vivo RBC survival. Transplanted mice carrying the coRPK transgene were injected intravenously three times (12 hours apart) with biotin 3-sulfonyl-N-hydroxysuccinimide ester sodium salt (50 mg / kg) (Sigma-Aldrich, St. Louis, MO). Twelve hours after the last injection, tail vein blood was collected and labeled with 2 μg / mL of anti-mouse Ter119-PE (BD Biosciences, San Jose, CA) and streptavidin-FITC (50 μg / mL, BD Biosciences, San Jose, CA) for 30 minutes at 4°C. Samples were analyzed every 2-4 days in an EPICS XL flow cytometer (Beckman Coulter, Berry, CA) for 40 days after injection. RBC survival kinetics were measured by the percentage of biotinylated cells within the total RBC population.

[0548] CFC assay. According to the manufacturer's procedure from Methocult culture medium GF M3434 (Stem Cell Technologies, Vancouver, Canada), CFC assays were performed in BM and spleen from control and transplanted mice. BM cells were collected from all groups of mice at different time points after transplantation, and CFU (clusters of 30 or more cells) were scored after 7 days of inoculation in a Nikon Diaphot-TMD microscope.

[0549] Identification of hematopoietic lineages. PBMCs were obtained from the tail vein of transplanted animals and labeled with a panel of antibodies to detect different hematopoietic cells. Myeloid cells were detected with anti-GR-1 and anti-Mac-1 biotinylated antibodies (BD Biosciences, San Jose, California, 5 μg / mL), while lymphoid cells were detected with anti-CD3-PE antibodies for T cells and anti-B220-PE antibodies and anti-B220-PECy5 antibodies for B cells (BD Biosciences, San Jose, California, 10 μg / mL) with SAV-TRC secondary antibodies (Invitrogen, Waltham, Massachusetts, Thermo Fisher Scientific). Samples were analyzed in BD LSRFortessa cytometer (BD Biosciences, San Jose, California, USA, 2 μg / mL) to exclude dead cells.

[0550] Structural and Histological Studies. Spleens were collected, photographed, and weighed on a precision balance to determine the presence of splenomegaly. Histological studies were performed on spleen and liver sections obtained according to conventional histological methods and stained with hematoxylin (Gill-2 hematoxylin, Thermo Fisher Scientific, Pittsburgh, USA) and eosin (eosinol, Thermo Fisher Scientific, Waltham, Mass.). Iron deposits were also studied in the spleen by Prussian blue or Perls staining (Sigma-Aldrich, St. Louis, Mo.) according to the manufacturer's instructions. All sections were examined using an Olympus BX40 light microscope and photographed with an Olympus DP21 camera at a final magnification of 100× or 200×.

[0551] Erythroid differentiation. Flow cytometric analysis of Ter119 and CD71 marker intensity in BM and spleen can be used to identify different erythroid subsets as described elsewhere [Socolovsky M et al., (2001). Blood 98:3261-3273] using 4 μg / mL anti-mouse Ter119-PE antibody (BD Biosciences, San Jose, CA), 10 μg / mL biotinylated anti-CD71 antibody (BD Biosciences, San Jose, CA) and streptavidin trichrome (Invitrogen, Thermo Fisher Scientific, Waltham, MA). Cells were then analyzed in an EPICS XL flow cytometer (Beckman Coulter, Berry, CA) using propidium iodide (IP, 2 μg / mL) to detect viable cells.

[0552] Provirus quantification. Detection and quantification of integrated provirus per cell was accomplished using complementary primers to the packaged provirus sequence (Ψ) and the mouse titin housekeeping gene. Total BM and peripheral blood samples were collected periodically, and genomic DNA from nucleated cells was isolated using the DNeasy blood and tissue kit (Qiagen, Venlo, Limburg, The Netherlands). 20 to 50 ng of genomic DNA (gDNA) was amplified by multiple qPCR using the 7500 Fast Real-Time PCR System (Applied Biosystems, Thermo Fisher Scientific, Waltham, MA) and previously described primers and probes [Charrier S et al., (2011). Gene Therapy 18:479-487].

[0553] Chimerism. The presence of donor cells was quantified by qPCR detection of the Y chromosome SRY gene and the mouse β-actin housekeeping gene. Genomic DNA from PB of transplanted mice was amplified using the 7500 Fast Real-Time PCR System (Applied Biosystems, Thermo Fisher Scientific, Waltham, MA) using primers and probes previously described [Navarro S et al. (2006). Mol Ther 14:525-535]. Standard curves were prepared using gDNA extracts from samples containing 0% to 100% BM cells from a mixture of male / female mice, and chimerism was calculated as: % of donor transplantation = 100 × 2 (CtβAct-CtSRY) .

[0554] LAM-PCR program. In order to identify the vector integration site, according to Schmidt et al., 2007 [" natural method (NatMethods) "4: 1051-1057] published method by LAM-PCR amplification 3 ' vector LTR-genome connection. Use biotinylated LTR specific primers and up to 100ng of gDNA as template to carry out initial linear amplification (100 cycles). Use streptavidin magnetic beads to purify linear amplification products, and then carry out complementary chain synthesis, digest in parallel with 2 kinds of different restriction enzymes (Tsp509I and HpyCH4IV) and use the end complementary linker box left with enzyme cutting to carry out two kinds of ligation reactions. The fragment generated by two other exponential PCR steps is amplified. Separate and quantify LAM-PCR products by gel electrophoresis on MultiNA automation system (Shimadzu (Shimadzu)).

[0555] Setup of LAM-PCR products for Illumina MiSeq sequencing. According to the method published by Parazynski et al. [Paruzynski A et al., (2010). Nat Protoc 5: 1379-1395], 40 ng of the second index PCR product generated by Tsp509I and HpyCH4IV enzymes was re-amplified using fusion primers containing specific sequences that allow double-end sequencing on the Illumina MiSeq sequencer. Roche 454GS-FLX adapters were added by fusion PCR to make the LAM-PCR samples suitable for 454-pyrusequencing: adapter A plus 8-nucleotide barcodes were added to the LTR end of the LAM-PCR amplicon; adapter B was added to the linker box side. In the 5'-3' direction, the final amplicon composition is as follows: adapter A, barcode, LTR sequence, unknown genomic sequence, linker box sequence and primer B. Purified fusion primer PCR products were run and quantified on a MultiNA automated electrophoresis system and pooled to obtain a final equimolar library of 10 nM. The final library was then re-quantified using the KAPA Library Quantification Kit for the Illumina sequencing platform (KAPA Biosystems, Wilmington, MA) on a Viia7 Real-Time PCR System (Applied Biosystems, Thermo Fisher Scientific, Waltham, MA) to obtain an estimated concentration of 16.35 nM. Finally, the library was sequenced using the Illumina MiSeq kit.

[0556] Bioinformatics analysis. To extract vector IS from both high-throughput sequencing platforms, Roche 454 and Illumina MiSeq / HiSeq, a pipeline was designed that accepts raw data (usually in FastQ file format) as input, providing a list of reliable IS and the nearest genes. Advanced level analysis for clone abundance quantification and gene ontology enrichment was performed using Excel, GraphPad Prism (TM) and available online tools.

[0557] NGS data processing and pipeline use. The steps of NGS data processing involve managing high-throughput data from the Illumina MiSeq sequencing platform and aim to identify ISs in which all valid sequence reads are aligned to the reference genome. Data processing includes two main activities: 1. Data quality check and analysis, in which LV vector sequences and other contaminants are trimmed. 2. Integration site identification, in which all valid sequence reads are aligned to the reference genome and valid ISs are retrieved.

[0558] Data quality analysis. In order to identify the IS from Illumina MiSeq raw data, a bioinformatics pipeline was developed. Standard LAM-PCR products contain LTR sequences, flanking human genome sequences, and linker box (LC) sequences. 459 technology allows retrieval of LAM-PCR sequences ranging in length from 10bp to 900bp. Similar results were retrieved from Illumina MiSeq double-end reads. These length boundaries are important parameters to be considered in the quality analysis process because they affect both the algorithms for subsequent alignment procedures and vector component identification. Sequences that are too short to be correctly aligned with reference genes and those sequences that exceed the maximum size that NSG technology can reach are discarded to avoid losing part or all of the LC sequence. Once the pipeline of each pool is finished, all integration sites are collected in both files (archived in TIGET network attached file storage-NAS-) and internal databases, and maintained in the storage server tracking the modified copy.

[0559] Integration site identification. To identify unique integration sites and extract an excel file (IS matrix) with all IS in rows and each sample in columns with the nearest gene annotation, we ran the following steps: 1. Create an IS matrix using a program called create_matrix to enable collision detection between projects. This program will produce a tab-delimited file (TSV); 2. Annotate the IS matrix file using the program annotate_bed, which is annotated as follows for each pool using the input TSV file: awk '{print "chr" $1" \t" $2" \t" $2}' TSV_FILE | tail -n + 2 > TSV_FILE.bed; annotate_bed –a / opt / genome / mouse / mm9 / annotation / mm9.refGene.TIGET.gtf -b TSV_FILE.bed -o TSV_FILE.annotated.bed; 3. Import both the annotation and matrix files into a new Excel worksheet (herein referred to as XLS).

[0560] Collision detection. To obtain a reliable dataset of IS from each transplanted mouse, we filtered the data from potential contamination / collisions and false positives based on sequence counts. An additional step of data normalization was required to combine integration sites generated from different experiments.

[0561] The term "collision" is used to identify the presence of the same IS in independent samples. In our experimental setting, vector integration in the same genomic position in different cells is an extremely low probability event. Therefore, the detection of the same IS in independent samples may originate from contamination that may occur at different stages of wet laboratory procedures (sample purification, DNA extraction, LAM-PCR and sequencing). Although our workflow is designed to minimize the occurrence of contact between samples, the high-throughput analysis of IS inherently carries a certain degree of background contamination. The identification of the degree of contamination between samples is also crucial, because the same IS is retrieved in different samples obtained from the same mouse for inference of the biological properties of hematopoietic cells marked by the vector in subsequent steps (i.e., multi-lineage potential and continuous clonogenic activity). Therefore, we must be able to distinguish the actual occurrence of the same IS from contamination / collision in different samples (from the same mouse).

[0562] To address these issues, we evaluated the extent of shared IS between samples originating from different test items and mice as a measure of the degree of collision in our analysis and then designed rules to discard those IS that can be attributed to collisions from the data set of each mouse and minimize the possibility of scoring false positives when looking for shared IS between samples from the same mouse. We designed a collision detection process that allows verification of each integration locus. The overall result should be that given a set of integration loci I, if integration locus i in I is classified as a collision, i will be discarded from I. We applied the collision detection process between 3 independent transplant groups: 1. coPKR170s: transplanted with Lin transduced with coRPK-expressing LV vectors (coRPK 1-3) - Mice from assay 1 were euthanized 170 days after cell incubation. 2. EGFP: Lin cells transplanted with EGFP-expressing LV vectors (EGFP 1-6) - The cells were from mice used in assay 2. 3. coPKR-TC: transplanted with Lin transduced with coRPK-expressing LV vector (coRPK 1-14) - Blood and BM of cells from mice in assay 2 were analyzed at different time points, including secondary recipients transplanted with pooled BM from a subset of primary transplanted mice (coRPK 11-14).

[0563] Each identical IS has different sequence reads (sequence counts) between different mice. Sequence counts can be used to determine whether a sample from a mouse contaminates the sample of other mice based on abundance criteria. In our basic principle, the integration found in two mice will be assigned to the mouse showing the highest abundance, and in another mouse, the integration will be considered as a pollutant. Therefore, we can identify the threshold value of the differential sequence count that allows a given collision to be assigned to a mouse and removed from other mice. We retrieved the threshold value from our data, and the value obtained was 10, which means that for each IS, between all TIs, if the abundance value (percent sequence count ratio) obtained by the IS is 10 times lower than the highest abundance value (percent sequence count) of other TIs, the IS is discarded from the current TI. We apply these rules between TI and the selected group, and the Excel file is used to calculate collision detection by applying the following rules (detailed description for TI filtering here, but the rules can also be extended to group filtering): 1. Separate each TI, and group all samples of the same TI together by summing the sequence counts. 2. For the three TIs obtained, for each IS, calculate the percentage between the sum of the IS sequence count and the reads for TI. 3. Then, the following rules are applied to calculate the decision steps with a threshold of 10 that allow to assign each IS to a reliable TI.

[0564] Once an IS was detected to be removed, the reads of that IS were removed from the group so that they would no longer be assigned to that group. The filtering described above was applied between mice transplanted with different ex vivo transduced cell populations (one cohort of EGFP-expressing mice from assay 2 and two cohorts of coPKR mice belonging to two independent transplant experiments). In addition, for the coPKR-TC group (assay 2), the filtering method mentioned above was modified in two ways: a) to better highlight the sharing of integrations between time points in the context of clonal abundance analysis, we added the following rule: if an integration is shared between one or more mice, the integration of all time points will be retained, even if its sequence count is less than 10% of the maximum sequence count between mice; b) for lineage tracing relationships, we applied a more stringent filter for sharing between time points by eliminating ISs with sequence counts less than 3 and the 10% sequence count filter. This means that integrations shared between two time points will only be retained or discarded if they are more or less than the other, respectively.

[0565] Gene ontology analysis. All gene ontology analyses were performed using GREAT online software (http: / / bejerano.stanford.edu / great / public / html / ). The webpage allows uploading of the integrated genomic coordinates of each data set and calculates the enrichment level in the tested data set by correlating the position information (based on binomial distribution analysis for p-value calculation) with the annotated function of the gene closest to the integration site (based on hypergeometric distribution analysis for p-value calculation) [Groeschel S et al., (2011). Journal of Inherited Metabolic Diseases (J Inherit MetabDis) 34: 1095-1102]. The molecular functions of biological processes and GO databases were selected for enrichment analysis. Only gene categories with false discovery rates <0.05 in two statistical analyses ( Fig. 20 ).

[0566] Data Storage. All data (both raw and results) are stored in the TIGET Network Attached File Storage (NAS) in the root folder, where all alignments from the pipeline as well as abundance matrices and maps are available. The NAS storage is protected by authentication and authorization policies and is built on a reliable and scalable infrastructure using redundant array of disks RAID 5 and backed up on our CrashPlan software registered in TIGET.

[0567] Example 1

[0568] PGK-coRPK therapeutic LV vector leads to stable and long-term correction of anemic phenotype in genetically corrected PKD mice just.

[0569] By transducing and transplanting lineage-depleted BM cells (Lin -cells) to determine the in vivo efficacy of PGK-coRPK LV (Figure 2a). Figure 2a is a schematic diagram of the SIN LV vector used throughout the gene therapy experiment, which carries the human PGK promoter that regulates the expression of the EGFP transgene in the control vector (upper figure) or the expression of the coRPK cDNA in the therapeutic vector (lower figure). The coRPK sequence shows 80.4% homology to the human PKLR cDNA and 76.5% homology to the mouse Pklr cDNA, with no changes in the amino acid sequence. Figure 2b is a schematic diagram of the gene therapy protocol performed to address the function of the developed PGK-coRPK LV vector. The correction of the PKD phenotype in PB and BM within 4 to 9 months after transplantation was studied by hematological analysis and metabolic profiling. Integrated analysis was performed in different tissues and time points from all mice to address LV vector safety. At 280 days after transplantation, total BM from primary transplanted mice carrying the coRPK transgene was re-transplanted into lethally irradiated female PKD mice (secondary recipients) to test the stability and safety of the transplant. Lethally irradiated PKD mice transplanted with deficient cells transduced with coRPK LV showed significant improvements in all erythroid parameters tested when compared to non-transplanted PKD littermates or to mice transplanted with cells transduced with EGFP LV ( FIG. 3 and Table 2 ).

[0570] Table 2. Hematological variables recorded in peripheral blood 140 days after transplantation.

[0571]

[0572]

[0573] Data represent mean ± SEM and were statistically analyzed using the Kruskal-Wallis nonparametric test by comparison with EGFP-expressing mice. *p<0.05; **p<0.01.

[0574] Increased RBC counts ( FIG. 3 a ) and constitutive reticulocytosis, one of the most common signs of PKD, as early as 40 days after transplantation were significantly reversed in mice carrying the PGK-coRPK transgene, reaching levels close to those observed in healthy controls at least 9 months after transplantation ( FIG. 3 b ). In contrast, PKD animals transplanted with EGFP LV-transduced cells showed anemia and significant reticulocytosis in parallel with PKD mice at all time points analyzed. Hemoglobin levels (HGB), hematocrit index (HTC), mean corpuscular volume (MCV), and mean corpuscular hemoglobin (MCH) values ​​in mice transplanted with LV-corrected cells were also corrected when compared to non-transplanted PKD littermates ( Table 2 ). Hematological correction was achieved with donor chimerism of 63.66±4.45% and transduction efficiency ranging from 60% to 90% ( Table 3 ).

[0575] Table 3. Relevant molecular parameters in mice transplanted with genetically modified cells.

[0576]

[0577] Data represent mean ± SEM, nd indicates not determined. a Represents the estimated percentage of transduction obtained by interpolation in the linear regression constructed from Experiment 1 (X axis: VCN / WBC, Y axis: % provirus + CFU).

[0578] Transduced cells showed an average of 1.65 ± 0.08 integrated vector copies per cell, indicating that the PGK-coRPKLV-vector provides sufficient human RPK transgene expression to reverse hemolytic anemia. It is noteworthy that when compared with untransplanted PKD mice, the expression of the coRPK transgene resulted in an extension of the erythroid cell half-life (Fig. 3c, d). On average, PKD mice showed an RBC half-life of 19 days, while in gene-corrected mice, the RBC half-life was extended to 25 days (6 days of extension), reaching a value close to the wild-type RBC half-life (Fig. 3d). Therefore, the RBCs of coRPK-expressing mice showed intermediate survival dynamics between healthy control mice and defective control mice (Fig. 3c), most likely because complete chimerism was not achieved in these animals (Table 3).

[0579] Nine months after transplantation, hematopoietic progenitor cells from primary recipients were transplanted into the second generation recipients maintaining transplantation levels (62.89 ± 5.61%) and VCN (1.44 ± 0.08 copies) (Table 3). Second generation transplant recipients showed multi-lineage hematopoietic reconstruction (Fig. 4) and showed significant improvement in all PB erythroid parameters for up to 5 months after transplantation (Fig. 5 and Table 2). Fig. 4a is a diagram for identifying flow cytometry strategies for different hematopoietic lineages by using CD3-PE, B220-PE, B220-PECy5, Gr1-biotin and Mac1-biotin antibodies plus SAV-PE-Cy5 markers. Fig. 4b depicts representative dot plots and the percentage of each lineage in PB at 140 days after transplantation (Fig. 4c). The bars represent the mean percentages ± SEM of healthy (n=2, black bars) and PKD mouse (n=2, gray bars) controls and secondary transplanted mice expressing the coRPK therapeutic transgene (n=4, dashed lines). In addition, proviral integration was detected in differentially directed hematopoietic progenitor cells (Fig. 6a, b) and its number remained constant over time (Fig. 6c), which shows the stability of the gene correction and highlights the safety of the PGK-coRPK LV. Fig. 6a shows the vector copy number per cell in BM CFU from a single transplanted mouse at 120 to 170 days after transplantation. Transduction and chimerism percentages are also shown. Fig. 6b shows the proviral copy number in cells from different hematopoietic compartments. The columns represent the mean ± SEM of different groups of transplanted mice. Fig. 6c shows the kinetics of proviral integration in BM cells from a single transplanted EGFP-expressing mouse (gray line) and a mouse carrying the coRPK transgene (black line).

[0580] Example 2

[0581] LV-derived RPK expression normalizes erythroid differentiation and allows the generation of functional mature erythrocytes.

[0582] PKD mice show a characteristic expansion of the erythroid compartment caused by a compensatory erythropoietic mechanism (Min-oo et al. 2004). Studies of the erythroid differentiation pattern in transplanted mice showed that ectopic RPK expression reversed this mechanism (Fig. 7a, b). PKD and EGFP-expressing mice showed a predominance of immature erythroid precursors in the BM and spleen (subpopulation I: proerythroid cells and subpopulation II: basophilic erythroblasts) and a significant decrease in late erythroid cells (group IV: reticulocytes and mature erythrocytes), while mice transplanted with cells transduced with coRPK LV showed a significant decrease in immature erythroid precursors (subpopulations I and II) and a significant increase in the most advanced erythroid compartment (subpopulation IV) equivalent to healthy mice (Fig. 7a, b). In addition, unlike PKD and EGFP-expressing mice, those mice carrying the coRPK transgene showed a significant decrease in erythropoietin (Epo) levels in plasma (Fig. 7c). Fig. 8a shows total CFU from the spleen, and Fig. 8b shows bone marrow 140 days after transplantation. Points represent the number of colonies per mouse analyzed, and lines represent the mean ± SEM of each group. Data were statistically analyzed by nonparametric Kruskal-Wallis test. Normalization of erythropoiesis in PKD mice treated with therapeutic vehicle was achieved by reducing the number of spleens of progenitor cell content to normal levels (Fig. 8a), although no changes were seen in BM CFU content (Fig. 8b).

[0583] Example 3

[0584] Transplantation of cells transduced with coRPK LV vector reverses extramedullary erythropoiesis and organ pathology.

[0585] Due to the active destruction of RPK-deficient erythrocytes, PKD and EGFP-expressing mice exhibited acute splenomegaly, with spleen weight and size increased by more than 200% when compared to healthy controls (Fig. 9a, b). Architectural disorganization of spleen tissue and expansion of spleen red pulp were also observed in these animals, indicating that intense extramedullary erythropoiesis was also supported by the presence of erythroid cell clusters in PKD and EGFP-expressing liver sections (Fig. 9c). It is noteworthy that ectopic expression of the coRPK transgene completely reversed spleen and liver pathology in genetically corrected mice, thereby reducing RBC accumulation and normalizing spleen histological structure and size (Fig. 9). In addition, histological studies showed that iron deposits were completely absent in the livers of genetically corrected mice, while PKD mice from non-transplanted groups or transplanted groups with HSCs transduced with EGFP-carrying vectors exhibited intense iron overload due to a persistent hemolytic process (Fig. 9c). In general, transplantation of genetically corrected HSCs in PKD mice restored the normal state of erythropoiesis and all secondary effects due to hemolytic anemia.

[0586] Example 4

[0587] LV-derived expression of PGK-coRPK restores glycolytic pathways in RBCs without modifying WBC metabolic balance path.

[0588] Next, we performed extensive metabolomics analysis on all transplanted mice and control mice to study the functional modification of RPK enzyme activity. According to the non-targeted mapping strategy, we observed significant changes in glycolytic intermediates in RBCs between different groups, thereby identifying three major clusters with different trends in metabolite patterns (Figure 10a). RBCs from coRPK-expressing mice showed an increase in metabolites from cluster 1 that was similar to healthy controls but different from transplanted mice carrying the EGFP transgene. Similarly, cluster 3 reflects the trend of reduced metabolites in genetically corrected mice that are similar to wild-type mice and different from EGFP-expressing mice. However, cluster 2 from assay 1 does not show the difference in metabolite profiles between transplanted mouse groups (EGFP and coRPK-expressing mice) (Figure 10a). The non-targeted metabolic profile also shows that genetic modification can modify some important glycolytic intermediates, thereby achieving an increase in the levels of ATP (Figure 10b), ADP (Figure 10c) and pyruvate (Figure 10d) in red blood cells isolated from mice transplanted with PGK-coRPK LV-transduced HSCs. Given these metabolic trends, we then used a targeted mapping approach to analyze other metabolites that are located closer to the PK-catalyzed reactions. Levels of the direct PK substrates phosphoenolpyruvate (PEP) (Figure 10e) and 3-phosphoglycerate (3-PG) (Figure 10f), which are located upstream of the PK-catalyzed reactions, were close to those of healthy control mice. When compared to PKD and EGFP-expressing mice, defective erythrocytes expressing the coRPK transgene also produced an increase in D-lactate (Figure 10g), the final product of anaerobic glycolysis. To test whether the compensation in the glycolysis metabolites was caused by normalization of PK activity in mature erythrocytes, we measured the activity of this enzyme and normalized it relative to hexokinase activity in order to avoid the effect of a large number of reticulocytes on defective animals. RBCs were purified by cellulose columns to prevent contamination with leukocyte PK activity. Complete compensation of PK activity was observed in animals expressing coRPK, achieving ratios similar to those obtained from wild-type healthy animals and from normal healthy blood donor volunteers (Figure 11). Figure 11a shows pyruvate kinase activity, Figure 11b shows hexokinase activity, and Figure 11c shows the ratio of pyruvate kinase activity to hexokinase activity in RBCs from control mice and mice transplanted with transduced cells. RBCs were purified from blood samples by cellulose columns to avoid contamination with leukocyte PK activity, and enzyme activity was assessed. Black bars, healthy mice (n=2); white bars, mice transplanted with cells transduced with an EGFP-expressing vector (n=3); dashed bars, mice transplanted with cells transduced with a coRPK-expressing vector (n=3). The checkered bars represent values ​​from healthy volunteers (n=1). The data represent the mean ± SEM of each group.

[0589] Principal component analysis showed that the metabolite patterns of RBCs varied by group and were significantly different from the WBC profiles (Figure 12a). In contrast, the WBC subgroups clustered together with very little intergroup difference, suggesting that the metabolic balance of leukocytes did not change when expressing ectopic coRPKs (Figure 12a). In addition, the specific metabolite changes observed in the RBC non-targeted profiles were not present in WBCs (Figures 12b-d).

[0590] Example 5

[0591] PGK-coRPK LV-transduced cells resulted in polyclonal hematopoietic repopulation without evidence of vector genotoxicity. establish.

[0592] Integration profiles of LV carrying coRPK or EGFP transgenes were analyzed in transplanted mice. Due to the genome-wide integration profiles of LV, each insertion creates a unique genetic signature that can be used to track clonal behavior in individual transduced cells. - Linear amplification-mediated PCR (LAM-PCR) ( Fig.13 and 14 ) was used to amplify the vector / genome junction and identify the vector IS. Fig.13 Vector IS is shown to be identified by LAM-PCR amplification of the 3' vector LTR-genome junction. The MultiNA automated system was used, resulting in a pattern characterized by several bands. The vector backbone-derived Tsp509I internal control band (IC) is indicated by an arrow. Fig.14 Vector IS is shown to be identified by LAM-PCR amplification of the 3' vector LTR-genome junction. The MultiNA automation system was used, resulting in a pattern characterized by several bands. The vector backbone-derived HpyCH4IV5 IC is indicated by an arrow.

[0593] PCR products were sequenced by MiSeq Illumina platform, and the obtained sequences were mapped to the mouse genome by bioinformatics pipeline and filtered for collisions as described above in the methods section ( Fig.15 ). Fig.15 Overall scheme of the analysis of IS mapping in mice transplanted with genetically modified hematopoietic progenitor cells. Bone marrow and white blood cell samples from transplanted mice belonging to two independent experiments (Table 3) and collected at different time points after transplantation were analyzed according to the indicated pipeline as described in the Supplementary Methods.

[0594] In total, we mapped 5,173,892 sequencing reads on the transplanted mouse genome, resulting in 2,220 unique vector integration sites. The genomic distribution of IS from two independent experiments matches the previously reported LV preference for integration within the transcription unit (especially within the first 50Kb downstream of the transcription start site-TSS-) (Figure 16a), showing that there is no skew to any specific chromosome in the mouse genome (Figure 16b). Figure 16a shows the IS frequency distribution around the TSS of the nearest RefSeq gene spanning 500Kb upstream and downstream of the TSS. The top number is the number of IS detected for all samples and time points. Figure 16b shows the chromosomal distribution of LV IS in transplanted mice expressing EGFP transgenes (black bars) or coRPK therapeutic transgenes (gray bars), showing that there is no skew to any specific chromosome.

[0595] The safety of PGK-coRPK LV-based gene therapy was investigated by clonal abundance estimation, calculating the percentage of sequence counts for each IS (clonal marker) relative to the total number of sequences in the data set. The dot plots and heat map representations of the relative abundance of each IS retrieved for each mouse (Figures 17, 18 and 19) show strong fluctuations in the clonal composition of different mice and in vitro cultured Lin- cells. Figure 17 is a chart tracking shared integration between primary recipient mice and secondary recipient mice carrying therapeutic PGK-coRPK LV vectors. Integrations detected in any organ, at any time in any mouse are pooled. Secondary recipients received pooled BM from transplanted mice coRPK11 to 14. The remaining IS detected were detected in primary or secondary recipients. The numbers in the boxes show the representativeness of the percentage of the corresponding integration in the mentioned mice. In addition to the ≥5% filter applied to the integration analysis, all integrations with sequence counts <3 were eliminated. Fig.19 A dot plot representation of the pooled integrated clonal abundance in the bone marrow of each mouse is shown. The relative percentage (y-axis) of each IS is related to the total number of sequence reads obtained in each dataset. Similar to the co-RPK transduced cells (Figure 17), this figure shows that the vast majority of transplanted mice show a polyclonal pattern of hematopoietic repopulation.

[0596] Moreover, it is understandable that for several samples, a small number of integrations resulted in a large number of sequence reads (Figures 17 and 18), which revealed a polyclonal pattern of repopulation of transduced HSCs. In addition, tracking shared integrations between primary mice carrying therapeutic PGK-coRPK LV and subsequent transplanted secondary mice showed no strong sharing of integrations between the groups, confirming the lack of clonal dominance ( Fig.18 ).

[0597] To determine if there are markers of insertional mutagenesis in transplanted mice, we evaluated the occurrence of common insertion sites (CIS) similar to the currently ongoing LV-mediated clinical trials. CIS is an insertion hotspot that can be caused by integration bias during transduction or in vivo selection of clones carrying vector integration that confers growth advantage. CIS was identified using an algorithm based on Abel and cols and a Grubbs test for outliers, thereby finding no CIS through this reading, and therefore no signs of worrying genotoxicity. In addition, GO analysis showed that no skewness to gene categories involved in cancer, cell proliferation or apoptosis regulation was found in any of the integrated data sets sorted by tissue distribution, time point or abundance of repopulating hematopoietic cell clones ( Fig. 20 ). Fig. 20 LV genomic integration map is shown. GO analysis was performed on samples from transplanted mice using GREAT software. All integrations retrieved from this study (N=2220) show over-representation of gene functions indicated on the left side of the figure. In order to address the question of whether the most abundant integration is enriched in a specific gene category, all ISs with relative sequence counts greater than 5% of the entire data set were selected (as shown in Figure 17), thereby showing GO gene categories that are not over-represented.

[0598] These results indicate neutrality of vector integration and demonstrate the safety of PGK-coRPK LV in the preclinical setting.

[0599] Example 6

[0600] Human clinical trials

[0601] A clinical trial was conducted to evaluate the safety and preliminary efficacy of autologous hematopoietic stem cell transplantation (HSCT) using the EU / 3 / 14 / 1130 drug product (autologous CD34+ hematopoietic stem cells transduced with an LV vector containing the RPK gene) in patients with PKD with a history of severe and transfusion-dependent anemia refractory to splenectomy.

[0602] ODD EU / 3 / 14 / 1130 includes a SIN LV vector expressing the coRPK gene ( Fig.21 ).

[0603] SIN LV vectors provide more robust expression (Ellis 2005) and are less susceptible to transcriptional silencing than γ-RV vectors (Pfeifer, Ikawa et al. 2002). SIN LV vectors also show a safer integration profile (Schroder, Shinn et al. 2002)(Mitchell, Beitzel et al. 2004)(Wu, Li et al. 2003) and, due to the 400 bp deletion it carries in the 3'LTR sequence (Miyoshi, Blomer et al. 1998)(Zufferey, Dull et al. 1998), transgene expression is regulated by an internal promoter, thereby increasing the safety of LV-based gene modification.

[0604] The sequence of the receiving LV vector also contained several modifications to improve transgene expression and safety in target cells.

[0605] One modification is the use of the human PGK promoter, which has been characterized by its stable in vivo activity and improved safety profile compared to other promoters used in gene therapy (Montini, Cesana et al. 2006, Modlich, Navarro et al. 2009, Montini, Cesana et al. 2009, Biffi, Montini et al. 2013). The incorporation of the PGK promoter results in physiological expression of the transgene and lower sensitivity to transcriptional silencing (Gerolami, Uch et al. 2000, Zychlinski, Schambach et al. 2008).

[0606] Another modification was the coRPK gene to increase mRNA stability during transcription. For optimization, Software was used to increase the GC content and remove cryptic splice sites to avoid transcriptional silencing and thus increase transgene expression. The coRPK optimized sequence showed 80.4% homology to the human PKLR gene, while the amino acid sequence of the protein did not change.

[0607] Another modification is a mutated wPRE that lacks any residual open reading frame (Schambach, Bohne et al. 2006) to improve the expression level and stability of the therapeutic gene. The backbone, promoter and wPRE* sequences of this LV vector (PGK-coRPK LV) are identical to the one corresponding to the drug product "Lentiviral vector containing the Fanconi anemia A (FANCA) gene for the treatment of patients with Fanconi anemia type A" (see 141 / 2000) and the vector backbone used in the currently ongoing clinical trial for metachromatic leukodystrophy (MLD) (Biffi, Montini et al. 2013).

[0608] Mode of action

[0609] CD34 + After the progenitor cells are transduced with the drug product in vitro, the therapeutic vector is integrated into the genome of the cells. Once integrated, the therapeutic human gene (coRPK) is transcribed and translated within the defective cells to produce the therapeutic RPK protein that is lost or reduced in PKD mature red blood cells. The transduced PKD hematopoietic progenitor cells are then genetically corrected and are therefore able to produce RBCs with sufficient amounts of ATP to fulfill their functions ( Fig. 22 These gene-corrected hematopoietic progenitor cells (which will constitute the drug product) are then transplanted back into the patient and, once engrafted, will generate normal red blood cells, thereby providing a lifelong cure for the disease.

[0610] The active ingredient is composed of modified hematopoietic stem cells (CD34 + ) cells, which has been designated as an orphan drug for the treatment of PKD by the European Commission (ODD EU / 3 / 14 / 1130). Therefore, this new drug should be included in the Advanced Therapies Development Group within the gene therapy subcategory.

[0611] The active ingredient consists of at least 2×10 6 CD34 + The genetically modified cell suspension consists of 10 cells / kg body weight, wherein each cell has at least 0.1 copies of the therapeutic vector. The cells are suspended in saline buffer with 2% HSA.

[0612] The final therapeutic product is produced according to GMP regulations, so the product requirements for its release and infusion in patients will be related to the quality of the product. In this regard, these specifications will include cell viability ≥ 30%, sterility (Gram test and sterility pharmacopoeia), absence of mycoplasma, absence of replication-competent LV particles and the presence of at least 0.1 vector copies per cell as detected by quantitative PCR to demonstrate the efficacy of the therapeutic potential. Therefore, the content of hematopoietic progenitor cells and the number of vector copies therein were investigated and studied. Three independent validations were performed with healthy control cells to ensure that the procedure met the above requirements.

[0613] The final product is packaged in transfer bags sealed by heat and specially designed for freezing and storage until its infusion into the patient; before this, samples will be collected for exact corresponding quality control.

[0614] mobilization

[0615] The patients were mobilized in their respective hospitals, although the first two patients were in Madrid (Spain) The mobilization process consisted of recombinant granulocyte colony-stimulating factor (G-CSF, Amgen, Neupogen, Thousand Oaks, CA) at a dose of 12 mg / kg twice daily from birth for up to 8 days, and plerixafor (Genzyme Europe BV, Naarden, The Netherlands) at a dose of 240 mg / kg / d subcutaneously on day 4 for 4 consecutive days. ). Hematopoietic progenitor cells were collected from peripheral blood by leukapheresis and were cultured according to the Madrid The standard protocol at the Jesús Hospital is to deliver large volumes via cell separators starting from day 5 of mobilization. All devices and solutions are CE marked and comply with the specifications of the Medical Devices Regulation.

[0616] CD34 + Cell purification

[0617] In line with the mobilization process, apheresis takes place in the hospital where the patient is mobilized. The apheresis product is immediately processed to select hematopoietic progenitor cells (CD34 + Cells), which allows the separation of cells using high magnetic field gradients using powerful permanent magnets and separation columns with a ferromagnetic matrix. The CliniMACS system (Miltenyi Biotec, Gladbach, Germany) includes a computer CD34 + Select software, a set of sterile test tubes (CliniMACS test tube set), magnetically controlled reactive sterile instruments (CliniMACS CD34 reagents) and sterile buffers (CliniMACS PBS / EDTA buffers). The instruments and reagents used are CE marked and will comply with the specifications of the Medical Devices Regulation. During this stage and the subsequent washing period, nonspecific immunoglobulin (Grifols Flebogamma IV 5% 0.5gr) and human albumin (Grifols human albumin) are used. 20%), after centrifugation, the nonspecific immunoglobulins and the human albumin are removed by washing. The CD34+ cells are then quantified. The obtained product will be microbiologically controlled by culturing with standard fungi, aerobic bacteria and anaerobic samples according to a specific protocol.

[0618] CD34 + Transduction

[0619] Purified CD34 with ODD EU / 3 / 14 / 1130 was analyzed under GMP conditions within a 48-hour window after cell extraction from the patient (apheresis). + Cells are transduced. The in vitro culture of cells lasts less than 48 hours, and will be cultured according to established standards, which include using appropriately formulated culture medium X-vivo-20 (Lonza Group), adding hematopoietic growth factors (100ng / ml hrSCF, 100ng / ml hrFlt-3, 100ng / mlTPO and 20ng / mL IL-3 (all from Prepotech)), 1μg / mL Bermuda (Pulmozyme) and controlled 5% O2 concentration. The GMP LV batch of ODD EU / 3 / 14 / 1130 produced by VIVE Biotechnology (VIVEbiotech) (San Sebastian, Spain) is transduced. After transduction, the cells are washed in X-vivo-20 (Lonza Group) to finally be packaged in a transfer bag suitable for cryopreservation. Specific samples are collected to determine whether the final product meets all specifications mentioned for its final release. Three independent validations are carried out to evaluate the stability of the product. All products and solutions including the vector will comply with the specifications of regulations for medical devices and clinical use.Before production, all raw materials including consumables, biological reagents and chemical powders will be checked by CliniStem's Quality Control (QC) unit according to the Standard Operating Procedure (SOP).

[0620] adjust

[0621] Patients were adjusted according to the standardized and specific protocols considered for the trial. For patients considered for adjustment, as an alternative, a spare 2×10 6 Unmanipulated CD34 + The cells / kg are kept frozen for use in case the prepared product fails to completely reconstitute the hematopoiesis of the patient being treated.

[0622] Infusion

[0623] Prior to infusion, patient eligibility was checked to ensure that the patient met the study requirements. Days of infusion, premedication, and prophylactic medications used were recorded.

[0624] Example 7

[0625] Nonclinical development

[0626] Previous work has demonstrated the feasibility of HSC gene therapy for PKD in mice when more than 25% of gene-corrected cells were transplanted. These results suggest that a large number of donor gene-corrected HSCs (Zaucha, Yu et al. 2001) and high levels of transgenic expression are required to achieve therapeutic effects on PKD. We have developed a new therapeutic LV vector proposed for this clinical trial, which carries the hPGK eukaryotic promoter that drives the expression of PKLR cDNA, which was designated as an orphan drug in August 2014 (EU / 3 / 14 / 1130). With this vector, we conducted a preclinical gene therapy program for PKD in a mouse model of the disease. At LV doses based on clinical standards, ectopic RPK expression was able to normalize the erythroid compartment, thereby correcting the hematological phenotype and reversing organ pathology. Metabolomics studies have shown that the glycolytic pathway in gene-corrected RBCs is functionally corrected, while no metabolic disturbances are observed in leukocytes. Notably, parallel analysis of WBCs showed that when RPK was ectopically expressed under the activity of a ubiquitous promoter such as PGK, the metabolic balance in leukocytes was not altered, which ruled out possible safety issues of leukocyte metabolic dominance and enhanced the therapeutic potential of the EU / 3 / 14 / 1130 vector.

[0627] The multilineage reconstitution in secondary recipients following proliferative stress induced by BM re-transplantation and the lack of any leukemic events or clonal expansions confirm the long-term stability and safety of the PGK-coRPK LV vector-based regimen. The use of the human PGK eukaryotic promoter, which i) may lead to more physiological expression of the RPK transgene, ii) has been shown to be a weak transactivator and iii) is currently used in clinical trials for metachromatic leukodystrophy (MLD), may also explain the safety of the overall procedure.

[0628] In order to evaluate the long-term safety of HSC gene therapy by analysis of vector IS, next-generation sequencing was used to predict the risk of insertion tumor formation in HSC. More than 5,173,892 sequence reads were mapped on the mouse genome to form a total of 2220 unique vector ISs, thereby finding no evidence of in vivo amplification or selection of clones carrying ISs. On the contrary, our data show the dynamics of clonal composition and hematopoiesis after transplantation of transduced HSCs in mice, indicating true and stable in vivo genetic modification of HSCs over time. In general, the analysis of vector integration patterns emphasizes the safety characteristics of the PGK-coRPK LV vector that provides PKD gene correction without evidence of genotoxicity.

[0629] Example 8

[0630] Clinical Research and Development

[0631] Regulatory agencies require protocol assistance for clinical studies. Our goal is to conduct a clinical trial sponsored by the European Commission. The ForGeTPKD Alliance, composed of different European clinicians and basic researchers, has been established to work on PKD research and the development of new therapeutic strategies. The ForGeTPKD clinical trial will be the first administration of this drug product in humans. It is designated as an international, multicenter, Phase I / II open-label study to evaluate the safety and efficacy of transplantation of autologous CD34+ cells transduced ex vivo with a lentiviral vector containing the erythrocyte pyruvate kinase (RPK) gene (EU / 3 / 14 / 1130) in patients with severe pyruvate kinase deficiency.

[0632] Regulatory status

[0633] The drug product does not currently have a marketing authorization. The goal of the PKD Consortium is to advance the clinical development of the drug product with a view to ultimately obtaining a marketing authorization.

[0634] The final product mentioned will be produced using LV vectors that have received orphan drug designation in relation to:

[0635] instruct: Treatment of pyruvate kinase deficiency

[0636] standard: The only curative treatment of PKD is the allogeneic BMT used in the patient with the refractory severe anemia of transfusion dependence of other measures. However, allogeneic BMT is not the widely accepted treatment for PKD (only one patient has been reported in the document (Tanphaichitr, Suvatte et al. 2000)), because it is related to the severe complications and acute and chronic graft-versus-host disease (GVHD) regulated by the intensive pre-allo-BMT of chemotherapy or chemoradiotherapy. Our hypothesis is to use the gene therapy of the autologous hematopoietic stem cell transduced by the viral vector containing the wild-type gene version provided by ODD EU / 3 / 14 / 1130 to show the potential curative treatment opportunity for these patients, thereby avoiding the risk of GVHD, which is the main cause of hematopoietic progenitor cell transplantation failure.

[0637] Active ingredients: Autologous CD34 cells transduced with a lentiviral vector containing the erythroid pyruvate kinase (RPK) gene (ODDEU / 3 / 14 / 1130) expressing the wild-type version of the protein + Hematopoietic stem cells.

[0638] Finished product: Suspended in saline buffer with 2% HSA containing at least 2×106 active substance / kg patient body weight.

[0639] Example 9

[0640] Pharmacology

[0641] Completed research: The developed drug product contains several modifications in its sequence that provide some advantages for gene therapy of PKD: 1) The use of SIN-LV vector design allows relatively simple and safe production of viral stocks capable of effectively transducing HSCs; 2) The use of weak eukaryotic promoters (such as hPGK) that are not easily silenced by methylation (Gerolami, Uch et al. 2000) leads to physiological expression of the transgene, thereby achieving therapeutic levels with a viral dose (1.65 VCN) within clinical standards (Matrai, Chuah et al. 2010); and 3) The presence of codon-optimized transgene sequences and mutated wPRE sequences increases transgene mRNA stability. No reporter gene is included in the therapeutic vector sequence, thereby avoiding possible immunogenicity issues (Morris, Conerly et al. 2004); (Stripecke, Carmen Villacres et al. 1999).

[0642] The developed hPGK-coRPK LV drug product effectively reversed PKD pathology in both primary and secondary deficient mice transplanted with progenitor cells transduced and corrected with ODD EU / 3 / 14 / 1130. Correction was achieved with cells carrying an average of 1.65 copies per cell of the therapeutic transgene.

[0643] The human PGK promoter is sufficiently efficient to express clinically relevant levels of coRPK protein, thereby restoring the hemolytic phenotype in transplanted mice.

[0644] Genetic correction was able to: prolong RBC half-life; normalize hematological variables and reticulocyte levels; reverse compensatory erythropoiesis that is constitutively activated in PKD mice; and rescue pathology in the spleen and liver, thereby significantly reducing iron overload, one of the life-threatening complications of PKD. In addition, ectopic expression of human RPK corrected the energy defect in RBC without altering the metabolic balance in WBC, thereby emphasizing the efficacy and safety of the drug product.

[0645] Example 10

[0646] Ongoing Research

[0647] Human hematopoietic progenitor cells from healthy donors and PKD patients were transduced to facilitate the study of: 1) determining the transduction efficiency of ODDEU / 3 / 14 / 1130 in human cells; 2) defining the optimal vector copy number / cell to obtain efficient and therapeutic expression of RPK therapeutic protein; and 3) defining the optimal conditions to obtain therapeutic transduction levels without losing hematopoietic stem cell capacity.

[0648] Planned studies included establishing conditions for large-scale transduction at a GMP facility, pre-validation and 3 validation studies to establish optimal conditions to achieve the desired specifications defined for the final therapeutic product.

[0649] toxicology

[0650] The completed study results include: 1) ectopic expression of human RPK corrected the energy defect in RBC without changing the metabolic balance in WBC; 2) genomic integration analysis of the vector has shown that: (i) analysis of the relative abundance of specific cell clones showed oligoclonal hematopoietic reconstitution for some mice, with no clonal advantage in any primary and secondary transplanted mice; (ii) CIS analysis of markers considered for insertional mutagenesis did not show any signs of genotoxicity or abnormal enrichment of CIS over time, as the detected CIS from two independent gene therapies performed in mice were not represented by high sequence counts and did not preferentially target oncogenes; (iii) GO analysis of genes targeted by LV integration and analysis of the location of vector integration in specific regions of the genome showed no skewness towards gene categories involved in cancer, cell proliferation or apoptosis regulation; and (iv) Overall, drug product integration analysis did not show any evidence of genotoxicity.

[0651] Planned ResearchContains 1) analysis of the production of recombinant competent lentivirus (RCL): human T lymphocytes from healthy donors and from PKD patients will be transduced with ODD EU / 3 / 14 / 1130 and cultured in vitro for an extended period of time. The presence of viral p24 protein will be analyzed in the supernatant by ELISA to evaluate the potential generation of RCL; and 2) biodistribution of drug products: mouse hematopoietic progenitor cells will be transduced with ODD EU / 3 / 14 / 1130 and will be transplanted into lethally irradiated recipients. One month after transplantation, animals will be sacrificed and different organs (gonads, liver, kidneys, brain, bone marrow, spleen and peripheral blood) will be analyzed for the presence of vector DNA; and 3) vector integrase in human cells: hematopoietic progenitor cells from healthy donors and from PKD patients will be transduced with ODD EU / 3 / 14 / 1130 and will be transplanted into severely immunodeficient mice to allow engraftment and proliferation of human hematopoietic cells. At different time points (1, 2 and 3 months post transplant), blood and BM transplants will be performed, sorted for human cells and analyzed for vector integrase as has been done with mouse cells.

[0652] Example 11

[0653] Human clinical trials

[0654] To test clinical efficacy, the ForGeTPKD trial will be conducted. The proposed clinical trial is designed to evaluate the safety and preliminary efficacy of autologous HSCT using the EU / 3 / 14 / 1130 drug product (autologous CD34+ hematopoietic stem cells transduced with a lentiviral vector containing the erythroid pyruvate kinase (RPK) gene) in patients with PKD with a history of severe and transfusion-dependent anemia refractory to splenectomy.

[0655] The primary objectives are to evaluate treatment, safety, and tolerability / feasibility. The following endpoints will be measured based on: 1) the incidence and characterization of adverse events (AEs), including AEs related to the infusion of transduced cells, AEs derived from conditioning prior to cell infusion, and AEs derived from clonal evolution associated with the transduced cells; and 2) the number of patients with stem cell engraftment 30 days after transplantation.

[0656] The secondary objective is to evaluate the initial treatment efficacy. The following endpoints will be measured based on: 1) the number of patients who become "transfusion-free" at the end of the study, and the number of patients who still require transfusions after treatment; 2) the ratio between the average number of transfusions required during the study period (1 year) relative to the average number of transfusions in the last 1.5 years before the baseline assessment; 3) a clinically significant reduction in anemia, defined as the number of patients with a 2 gr / dL increase in hemoglobin level from baseline at the end of the study; 4) a clinically significant reduction in reticulocytosis, defined as a 50% reduction from baseline assessment at the end of the study; and 5) the number of patients with stem cell transplants in which 1% of the transduced cells can be detected at the end of the study at 6 months and 12 months after cell infusion.

[0657] The exploratory objective is to evaluate the effect of treatment on the patients' quality of life. The following endpoints will be measured based on: improvement in quality of life at the end of the study compared to baseline, using a quality of life questionnaire (SF-36 for adults or PEDSQL for children) and its validated version translated into the languages ​​of the participating countries (Italian, Dutch and Spanish).

[0658] The ForGetPKD trial is a multicenter international trial that will be conducted in 3 EU Member States: Spain, Italy and the Netherlands. Participating centers include national investigators and institutions of reference for PKD diagnosis and treatment.

[0659] The trial will demonstrate the first administration of the product to humans. It is designed as a non-controlled, open-label, single-dose, Phase I / II study.

[0660] The global study duration will be 2 years, from the first visit of the first patient to the last visit of the last patient. This includes a 1-year recruitment period and a 1-year treatment period with early (immediate) follow-up. After the end of the trial, included subjects will be asked to participate in a subsequent follow-up study that will monitor safety and efficacy for up to 5 years after transplantation.

[0661] The study procedures included a screening period, a treatment period, and a follow-up period. The visit details and associated study procedures for each period are described in detail below and summarized in Table 4.

[0662] Table 4. Study procedures

[0663]

[0664] Screening period

[0665] Visit-1: Pre-Screening Visit

[0666] Potential candidates will be informed of the objectives and characteristics of the trial and written informed consent will be obtained, completed and signed in duplicate by the patient (or legal representative if a minor). To be eligible for the study, patients must meet all inclusion criteria and not meet exclusion criteria, which will be examined. This includes the use of mobilization and acquisition of live CD34 + Pre-treatment procedures for cells to: A. Store 2 x 10 6 CD34+ cells / kg body weight to serve as backup in case of non-transplantation, B. At least 6×10 6 CD34+ cells / kg body weight to produce the drug product and perform all quality controls required for the release of the drug product. Only after the release of the drug product are sufficient transduced cells (2×10 6 Only patients with 100 transduced CD34+ cells / kg body weight were included in the study.

[0667] The following procedures will also be performed during this visit:

[0668] - Registration of relevant medical or surgical history.

[0669] - Registration of demographic data and clinically relevant physical examination results.

[0670] -Registration of relevant concomitant medications.

[0671] -Peripheral blood testing for routine blood cell count (CBC), biochemistry, coagulation assays, and serology.

[0672] -Echocardiogram, lung function tests, and chest x-ray.

[0673] - Quality of life questionnaire (SF-36 or PEDSQL).

[0674] -Genetic diagnosis of PKD.

[0675] To be eligible for the study, patients had to meet all of the following inclusion criteria and none of the exclusion criteria.

[0676] Inclusion criteria were: male or female patients, aged >2 years at the time of recruitment, willing to give signed informed consent (in the case of children under 18 years of age, it will be signed by their parents or legal representatives), previous diagnosis of PKD confirmed by genetic testing, history of severe transfusion-dependent anemia, non-response to splenectomy, candidate for autologous hematopoietic stem cell transplantation, and availability of ≥2×10 6 Transduced CD34 + cells / kg body weight and had been treated and followed up for at least the past 2 years in a specialized center that maintained detailed medical records (including transfusion history).

[0677] Exclusion criteria were: positive for human immunodeficiency virus type 1 or 2 (HIV 1 and HIV 2), uncorrected bleeding disorders, presence of other causes of hemolysis, any previous or current malignancy or myeloproliferative disorder or immunodeficiency disorder, immediate family members with known or suspected familial cancer syndrome (including but not limited to hereditary breast and ovarian cancer syndrome, hereditary non-polyposis colorectal cancer syndrome and familial adenomatous polyposis), patients with previous allogeneic transplantation, presence of residual cells of donor origin, patients deemed to have grade III / IV cardiac, pulmonary, hepatic or renal dysfunction after medical evaluation, uncontrolled epilepsy, carbon monoxide ( The following were considered to be eligible: DLco) diffusing capacity < 50% predicted (corrected for hemoglobin), any other evidence of severe iron overload that warrants exclusion in the investigator's opinion, participation in another clinical study with the investigational drug within 30 days of screening, availability of an HLA-matched donor for allogeneic bone marrow transplantation, pregnant or breastfeeding women, patients who would be unable to understand the study objectives, benefits and risks and / or comply with study procedures according to the investigator's criteria, poor functional status as evidenced by a Karnofsky index ≤80 in adults or a Lansky index ≤80 in children.

[0678] The statistical analysis of the study will be descriptive. Qualitative endpoints will be described using frequencies and percentages. Qualitative endpoints include: adverse events, number of patients with stem cell transplantation, number of patients who became "transfusion independent", number of patients with clinically significant reduction in anemia, number of patients with clinically significant reduction in reticulocytosis, number of patients with stem cell transplantation (in which the presence of transduced cells can be detected), and improvement in quality of life from baseline as measured by the SF-36 or PEDSQL questionnaire. Quantitative endpoints will be described using mean and standard deviation or median and quartiles. Quantitative endpoints include: reduction from baseline in anemia and reticulocytosis, number of transfusions required during the study period relative to the number of transfusions in the last year before the baseline assessment, and vector copy number in peripheral blood and bone marrow. All endpoints will be described at the end of the study.

[0679] Previous work has demonstrated the feasibility of HSC gene therapy for PKD in mice when more than 25% of gene-corrected cells were transplanted. These results suggest that a large number of donor gene-corrected HSCs (Zaucha, Yu et al. 2001) and high levels of transgenic expression are required to achieve therapeutic effects on PKD. We have developed a new therapeutic LV vector proposed for this clinical trial, which carries the hPGK eukaryotic promoter that drives the expression of PKLR cDNA, which was designated as an orphan drug in August 2014 (EU / 3 / 14 / 1130). With this vector, we conducted a preclinical gene therapy program for PKD in a mouse model of the disease. At LV doses based on clinical standards, ectopic RPK expression was able to normalize the erythroid compartment, thereby correcting the hematological phenotype and reversing organ pathology. Metabolomics studies have shown that the glycolytic pathway in gene-corrected RBCs is functionally corrected, while no metabolic disturbances are observed in leukocytes. Notably, parallel analysis of WBCs showed that when RPK was ectopically expressed under the activity of a ubiquitous promoter such as PGK, the metabolic balance in leukocytes was not altered, which ruled out possible safety issues of leukocyte metabolic dominance and enhanced the therapeutic potential of the EU / 3 / 14 / 1130 vector.

[0680] The multilineage reconstitution in secondary recipients following proliferative stress induced by BM retransplantation and the lack of any leukemic events or clonal expansion confirmed the long-term stability and safety of the PGK-coRPK LV vector-based regimen. The use of the human PGK eukaryotic promoter, which has been shown to be a weak transactivator and is currently used in clinical trials for metachromatic leukodystrophy (MLD), which may lead to more physiological expression of the RPK transgene, may also explain the safety of the overall procedure.

[0681] In order to evaluate the long-term safety of HSC gene therapy by analysis of vector IS, next-generation sequencing was used to predict the risk of insertion tumor formation in HSC. More than 5,173,892 sequence reads were mapped on the mouse genome to form a total of 2220 unique vector ISs, thereby finding no evidence of in vivo amplification or selection of clones carrying ISs. On the contrary, our data show the dynamics of clonal composition and hematopoiesis after transplantation of transduced HSCs in mice, indicating true and stable in vivo genetic modification of HSCs over time. In general, the analysis of vector integration patterns emphasizes the safety characteristics of the PGK-coRPK LV vector that provides PKD gene correction without evidence of genotoxicity.

[0682] The present invention may be further defined by reference to the following descriptive clauses:

[0683] 1. An expression cassette comprising a polynucleotide sequence, wherein the polynucleotide sequence comprises in the following 5' to 3' order:

[0684] a) Promoter sequence;

[0685] b) a sequence encoding a gene product; and

[0686] c) RNA output signal,

[0687] The promoter sequence is operably linked to the sequence encoding the gene product.

[0688] 2. An expression cassette according to clause 1, wherein the promoter is a phosphoglycerate kinase (PGK) promoter.

[0689] 3. An expression cassette according to clause 1 or clause 2, wherein the gene product is a therapeutic gene product.

[0690] 4. An expression cassette according to clause 3, wherein the therapeutic gene product is a pyruvate kinase (PK) polypeptide, optionally a pyruvate kinase, liver and erythrocyte (PKLR) polypeptide.

[0691] 5. An expression cassette according to any one of clauses 1 to 4, wherein the sequence encoding the gene product is codon-optimized.

[0692] 6. An expression cassette according to clause 5, wherein the codon-optimized sequence comprises a sequence having at least 85% identity to SEQ ID NO: 8.

[0693] 7. The expression cassette according to any one of clauses 1 to 6, wherein the RNA export signal is a mutated Woodchuck Hepatitis Virus Post-transcriptional Regulatory Element (wPRE).

[0694] 8. An expression cassette according to clause 7, wherein the mutated wPRE is a chimeric wPRE comprising a sequence having at least 80% identity to SEQ ID NO:24.

[0695] 9. An expression cassette according to any one of clauses 1 to 8, further comprising one or more enhancer sequences.

[0696] 10. The expression cassette according to any one of clauses 1 to 9, further comprising a polypurine tract (PPT) or a polyadenylation (polyA) signal sequence.

[0697] 11. An expression cassette according to any one of clauses 1 to 10, further comprising one or more of the following sequences:

[0698] i) packaging signal sequence;

[0699] ii) truncated Gag sequence;

[0700] iii) Rev response element (RRE);

[0701] iv) central polypurine tract (cPPT);

[0702] v) Central terminal sequence (CTS); and

[0703] vi) an upstream sequence element (USE), optionally from Simian Virus 40 (SV40-USE).

[0704] 12. An expression cassette according to any one of clauses 1 to 11, further comprising 5' and 3' long terminal repeat sequences.

[0705] 13. A recombinant gene delivery vector comprising an expression cassette according to any one of clauses 1 to 12.

[0706] 14. The recombinant gene delivery vector according to clause 13, wherein the recombinant gene delivery vector is a virus or a viral vector.

[0707] 15. The recombinant gene delivery vector according to clause 14, wherein the virus or viral vector is a lentivirus (LV).

[0708] 16. A cell comprising an expression cassette according to any one of clauses 1 to 12 or a recombinant gene delivery vector according to any one of clauses 13 to 15.

[0709] 17. The cell according to clause 16, wherein the cell is a hematopoietic stem cell.

[0710] 18. The cell according to clause 16, wherein the cell is a committed hematopoietic erythroid progenitor cell.

[0711] 19. A pharmaceutical composition comprising a pharmaceutically acceptable excipient and the recombinant gene delivery vector according to any one of clauses 13 to 15 or the cell according to any one of clauses 16 to 18.

[0712] 20. A method of treating or preventing a disease or disorder in a subject in need thereof, comprising providing the subject with a pharmaceutical composition according to clause 19.

[0713] 21. A method according to clause 20, wherein the disease or disorder is pyruvate kinase deficiency (PKD) and the gene product is a pyruvate kinase (PK) polypeptide, optionally a pyruvate kinase, liver and erythrocyte (PKLR) polypeptide.

[0714] 22. The method according to clause 20 or clause 21, wherein the pharmaceutical composition comprises the recombinant gene delivery vector.

[0715] 23. The method according to clause 20 or clause 21, wherein the pharmaceutical composition comprises the cells.

[0716] 24. The method according to clause 23, wherein the cells are autologous to the subject.

[0717] 25. A method for expressing a transgene in erythroid cells, comprising contacting one or more erythroid cells with an effective amount of a recombinant viral vector, wherein the vector comprises a human phosphoglycerate kinase promoter, a codon-optimized version of human pyruvate kinase, a liver and erythroid (PKLR) cDNA transgene, and a mutated woodchuck hepatitis virus post-transcriptional regulatory element, wherein after said contacting, PKLR is expressed at a detectable level in said one or more erythroid cells.

[0718] The present invention also includes the following exemplary embodiments:

[0719] 1. A pharmaceutical composition for treating or preventing pyruvate kinase deficiency, comprising a cell transduced with a recombinant gene delivery vector, wherein the recombinant gene delivery vector comprises an expression cassette, wherein the expression cassette comprises a polynucleotide sequence, wherein the polynucleotide sequence comprises, in the following 5' to 3' order:

[0720] a) a promoter sequence,

[0721] b) a codon-optimized sequence encoding a human PKLR gene product; and

[0722] c) a mutated woodchuck hepatitis virus posttranscriptional regulatory element (wPRE),

[0723] wherein the promoter sequence is operably linked to the codon-optimized sequence encoding the human PKLR gene product,

[0724] wherein the codon-optimized sequence encoding the human PKLR gene product comprises a sequence having at least 80% identity to SEQ ID NO: 8, and

[0725] wherein the mutated wPRE is a chimeric wPRE comprising a sequence having at least 90% identity to SEQ ID NO:24.

[0726] 2. A pharmaceutical composition according to embodiment 1, wherein the codon-optimized sequence encoding the human PKLR gene product is at least 90% identical to SEQ ID NO:8.

[0727] 3. A pharmaceutical composition according to embodiment 1 or 2, wherein the codon-optimized sequence encoding the human PKLR gene product comprises the sequence of SEQ ID NO: 8.

[0728] 4. A pharmaceutical composition according to any one of embodiments 1-3, wherein the promoter is a phosphoglycerate kinase (PGK) promoter.

[0729] 5. A pharmaceutical composition according to any one of embodiments 1-4, wherein the mutated wPRE comprises the sequence of SEQ ID NO: 24.

[0730] 6. A pharmaceutical composition according to any one of embodiments 1-5, wherein the expression cassette comprises a sequence that is at least 90% identical to SEQ ID NO: 26.

[0731] 7. A pharmaceutical composition according to embodiment 6, wherein the expression cassette comprises the sequence of SEQ ID NO: 26.

[0732] 8. A pharmaceutical composition according to any one of embodiments 1-7, wherein the recombinant gene delivery vector is a lentiviral vector.

[0733] 9. The pharmaceutical composition according to embodiment 8, wherein the recombinant gene delivery vector is a therapeutic gene delivery vector.

[0734] 10. A pharmaceutical composition according to any one of embodiments 1-9, wherein the cells are hematopoietic stem cells.

[0735] 11. A pharmaceutical composition according to any one of embodiments 1-9, wherein the cells are committed hematopoietic erythroid progenitor cells.

[0736] 12. The pharmaceutical composition according to any one of embodiments 1-11, comprising a pharmaceutically acceptable excipient.

[0737] 13. A pharmaceutical composition according to any one of embodiments 1-12, wherein the cells are CD34+ cells.

[0738] 14. The pharmaceutical composition of any one of embodiments 1-13, wherein the cells comprise at least 0.5 vector copies / cell (VCN).

[0739] 15. The pharmaceutical composition of embodiment 14, wherein the cells contain at most 5 vector copies / cell (VCN).

[0740] 16. Use of the pharmaceutical composition according to any one of embodiments 1-15 in the manufacture or preparation of a medicament for treating pyruvate kinase deficiency in a subject in need thereof.

[0741] 17. Use of a pharmaceutical composition according to embodiment 16, wherein the cells are autologous to the subject.

[0742] 18. The use of a pharmaceutical composition according to embodiment 16 or 17, wherein the pharmaceutical composition comprises at least 2x10 6 CD34 + cells / kg subject body weight.

[0743] 19. An expression cassette for pyruvate kinase deficiency, the expression cassette comprising a polynucleotide sequence, the polynucleotide sequence comprising in the following 5' to 3' order:

[0744] a) Promoter sequence;

[0745] b) a codon-optimized sequence encoding a human PKLR gene product; and

[0746] c) a sequence encoding a post-transcriptional regulatory element of a mutant woodchuck hepatitis virus;

[0747] wherein the promoter sequence is operably linked to the codon-optimized sequence encoding the human PKLR gene product,

[0748] wherein the codon-optimized sequence encoding the human PKLR gene product has at least 80% identity to SEQ ID NO: 8, and

[0749] The sequence encoding the mutated woodchuck hepatitis virus post-transcriptional regulatory element is at least 90% identical to SEQ ID NO: 24.

[0750] 20. A recombinant gene delivery vector comprising the expression cassette according to embodiment 19.

[0751] 21. A cell comprising the expression cassette according to embodiment 19.

[0752] 22. A pharmaceutical composition comprising the cell according to embodiment 21.

Claims

1. A pharmaceutical composition for treating or preventing pyruvate kinase deficiency, comprising a cell transduced with a recombinant gene delivery vector, wherein the recombinant gene delivery vector comprises an expression cassette, wherein the expression cassette comprises a polynucleotide sequence, wherein the polynucleotide sequence comprises, in the following 5' to 3' order: a) a promoter sequence, b) a codon-optimized sequence encoding a human PKLR gene product; and c) a mutated woodchuck hepatitis virus posttranscriptional regulatory element (wPRE), wherein the promoter sequence is operably linked to the codon-optimized sequence encoding the human PKLR gene product, wherein the codon-optimized sequence encoding the human PKLR gene product comprises a sequence having at least 80% identity to SEQ ID NO: 8, and wherein the mutated wPRE is a chimeric wPRE comprising a sequence having at least 90% identity to SEQ ID NO:

24.

2. The pharmaceutical composition of claim 1, wherein the codon-optimized sequence encoding the human PKLR gene product is at least 90% identical to SEQ ID NO:

8.

3. The pharmaceutical composition according to claim 1 or 2, wherein the codon-optimized sequence encoding the human PKLR gene product comprises the sequence of SEQ ID NO:

8.

4. The pharmaceutical composition according to any one of claims 1 to 3, wherein the promoter is a phosphoglycerate kinase (PGK) promoter.

5. The pharmaceutical composition according to any one of claims 1-4, wherein the mutated wPRE comprises the sequence of SEQ ID NO:

24.

6. The pharmaceutical composition of any one of claims 1-5, wherein the expression cassette comprises a sequence that is at least 90% identical to SEQ ID NO:

26.

7. The pharmaceutical composition according to claim 6, wherein the expression cassette comprises the sequence of SEQ ID NO:

26.

8. The pharmaceutical composition according to any one of claims 1-7, wherein the recombinant gene delivery vector is a lentiviral vector.

9. The pharmaceutical composition of claim 8, wherein the recombinant gene delivery vector is a therapeutic gene delivery vector.

10. The pharmaceutical composition according to any one of claims 1 to 9, wherein the cells are hematopoietic stem cells.

11. The pharmaceutical composition according to any one of claims 1-9, wherein the cells are committed hematopoietic erythroid progenitor cells.

12. The pharmaceutical composition according to any one of claims 1 to 11, comprising a pharmaceutically acceptable excipient.

13. The pharmaceutical composition according to any one of claims 1-12, wherein the cells are CD34+ cells.

14. The pharmaceutical composition according to any one of claims 1-13, wherein the cells comprise at least 0.5 vector copies / cell (VCN).

15. The pharmaceutical composition of claim 14, wherein the cells comprise at most 5 vector copies / cell (VCN).

16. Use of the pharmaceutical composition according to any one of claims 1 to 15 in the manufacture or preparation of a medicament for treating pyruvate kinase deficiency in a subject in need thereof.

17. Use of a pharmaceutical composition according to claim 16, wherein the cells are autologous to the subject.

18. The use of a pharmaceutical composition according to claim 16 or 17, wherein the pharmaceutical composition comprises at least 2x10 6 CD34 + cells / kg subject body weight.

19. An expression cassette for pyruvate kinase deficiency, the expression cassette comprising a polynucleotide sequence, the polynucleotide sequence comprising in the following 5' to 3' order: a) Promoter sequence; b) a codon-optimized sequence encoding a human PKLR gene product; and c) a sequence encoding a post-transcriptional regulatory element of a mutant woodchuck hepatitis virus; wherein the promoter sequence is operably linked to the codon-optimized sequence encoding the human PKLR gene product, wherein the codon-optimized sequence encoding the human PKLR gene product has at least 80% identity to SEQ ID NO: 8, and The sequence encoding the mutated woodchuck hepatitis virus post-transcriptional regulatory element is at least 90% identical to SEQ ID NO:

24.

20. A recombinant gene delivery vector comprising the expression cassette according to claim 19.

21. A cell comprising the expression cassette of claim 19.

22. A pharmaceutical composition comprising the cell according to claim 21.

Images