Kit for efficiently extracting DNA and / or RNA from complex samples and its applications

Abstract

The present application discloses a kit for efficiently extracting DNA and / or RNA from complex samples and its application. The kit includes a lysis medium, a lysis solution, a precipitation solution, a binding solution, magnetic beads, a first washing solution, a second washing solution and an elution solution. The advantage of using the kit to extract nucleic acids from complex samples is at least to expand the accessibility and convenience of efficient extraction of nucleic acids from complex samples, and to facilitate various related institutions and research units to carry out routine extraction and related detection experiments.

Description

Technical Field

[0001] This application relates to the technical field of nucleic acid extraction and detection, specifically to a kit for efficiently extracting DNA and / or RNA from complex samples and its applications, and further to a DNA and / or RNA co-extraction kit for complex samples including sewage, soil, feces, sediment, sludge, water filtration membranes, etc., as well as a corresponding DNA and / or RNA co-extraction method. Background Art

[0002] With the continuous development and improvement of molecular biology detection techniques, their application scope is gradually expanding to more diverse fields and a wider range of sample types, including various complex samples such as sewage, soil, feces, sediment, sludge, water filtration membranes, etc. For example, a large number of domestic and foreign scholars and government agencies have carried out monitoring on the virus concentration in sewage to obtain overall information on the prevalence of different viruses within a region. Another example is that there are currently a large number of relevant clinical cases using human feces as the main detection means for various digestive tract pathogens. At the same time, a large number of scientists are paying attention to the diversity and functional changes of various microbial communities in water bodies, soil, sediment, and sludge, providing basic information for studying the interaction between organisms and the environment and exploring new high-quality microbial species resources.

[0003] In terms of actual application, the key point in conducting molecular detection on the above-mentioned complex samples including sewage, soil, feces, sediment, sludge, water filtration membranes, etc. lies in how to extract sufficient and pure nucleic acids (including DNA and RNA) from these complex samples. Compared with traditional samples, such samples have a more complex higher-level structure, making it difficult for traditional enzymatic digestion or thermal decomposition methods to release the nucleic acids encapsulated inside. Currently, most solutions mostly involve using chemical reagents such as β-mercaptoethanol, phenol-chloroform-isoamyl alcohol, etc. to enhance the lysis effect. However, since most of the above reagents are controlled chemicals and are difficult to purchase and use in most application scenarios, it is difficult to meet the usage requirements under most conditions.

[0004] Meanwhile, the above-mentioned complex samples often contain a large number of various PCR inhibitors, including humic acid, phytogenic polysaccharides, plant polyphenols, etc. The presence of these inhibitors will interfere with downstream molecular biology reactions, thus affecting the accuracy of molecular detection. Although there are currently some solutions that can remove most of the PCR inhibitors in the sample through selective precipitation technology, most commercially available selective precipitation reagents will lose RNA molecules while precipitating PCR inhibitors, only retaining DNA molecules. This makes most commercially available kits only capable of efficiently extracting DNA from complex samples, but unable to meet the relevant requirements for RNA extraction. Currently, only a few imported kit brands master the selective precipitation technology of shielding agent removal that can retain RNA, and there are few domestic products with similar functions. This means that the RNA extraction of such complex samples mostly relies on imported products, resulting in problems such as high prices, long delivery times, and difficulty in large-scale implementation.

[0005] In addition, most commercially available DNA / RNA extraction kits for the above-mentioned complex samples use the centrifugal column method for nucleic acid recovery. Limited by the principle of the centrifugal column method, it is difficult to achieve automatic extraction relying on an automated nucleic acid extraction platform. This makes the extraction of such highly complex samples highly dependent on manual operation, resulting in problems such as long time consumption, poor extraction effect, and unstable extraction effects in different batches.

[0006] In summary, for the nucleic acid extraction of the above-mentioned complex samples, including sewage, soil, feces, sediment, sludge, water body filter membranes, etc., there is still a lack of a nucleic acid extraction kit and a corresponding nucleic acid extraction method that can achieve efficient lysis of the sample and removal of PCR shielding agents without using regulated chemical reagents, while simultaneously retaining DNA and RNA molecules and being compatible with automated operation.

[0007] Therefore, there is an urgent need in the art to develop a new nucleic acid extraction method. Summary of the Invention

[0008] Based on this, it is necessary to provide at least one kit for efficiently extracting DNA and / or RNA from complex samples and its application.

[0009] In the first aspect of the present application, a kit for efficiently extracting DNA and / or RNA from complex samples is provided, which includes a lysis medium, a lysis solution, a precipitation solution, a binding solution, magnetic beads, a first washing solution, a second washing solution, and an elution solution; wherein:

[0010] The lysis medium includes hard particles, and the particle size of the lysis medium is 0.1 mm to 3 mm;

[0011] The lysis solution includes 10 mmol / L - 100 mmol / L buffer salts, 1 mol / L - 4 mol / L chaotropic salts, 0.01 wt% - 1 wt% detergents, and 0.5 mol / L - 3 mol / L RNA solubilizers;

[0012] The precipitants for the precipitation solution include one or more of aluminum sulfate, potassium alum, ammonium alum, basic aluminum sulfate, aluminum chloride, basic aluminum chloride, ferric chloride, and lanthanum chloride;

[0013] The binding solution includes 10 mmol / L - 100 mmol / L buffer salts, 1 mol / L - 5 mol / L chaotropic salts, 10 wt% - 30 wt% organic solvents, and 0.1 wt% - 5 wt% surfactants;

[0014] The magnetic beads in the magnetic bead stock solution include one or more of hydroxyl - modified silica - coated iron tetroxide magnetic beads, epoxy - modified silica - coated iron tetroxide magnetic beads, and carboxyl - modified silica - coated iron tetroxide magnetic beads, and the concentration of the magnetic beads in the magnetic bead stock solution is 50 mg / mL - 100 mg / mL;

[0015] The first washing solution for impurities includes 10 mmol / L - 100 mmol / L buffer salts, 0.05 mol / L - 2 mol / L chaotropic salts, 30% (v / v) - 80% (v / v) organic solvents, and 0.1 wt% - 5 wt% surfactants, with a pH of 6.0 - 8.0;

[0016] The second washing solution for impurities includes 10 mmol / L - 100 mmol / L buffer salts and 50% (v / v) - 90% (v / v) organic solvents, with a pH of 6.0 - 8.0;

[0017] The elution solution contains 1 mmol / L - 100 mmol / L buffer salts and 0.01 wt% - 1 wt% surfactants, with a pH of 6.0 - 8.0.

[0018] In the second aspect of the present application, a method for extracting DNA and / or RNA from a complex sample using the kit described in the first aspect is provided. The method includes:

[0019] Mechanical force grinding: Mix the lysis medium, lysis solution, and the sample to be detected, and grind them by mechanical force oscillation to obtain a lysis mixture. Among them, the relative dosage of the lysis solution to the liquid sample to be detected in each reaction unit is (400 μL - 700 μL):(50 μL - 300 μL), and the relative dosage of the lysis solution to the solid sample to be detected is (400 μL - 700 μL):(25 mg - 300 mg);

[0020] PCR inhibitor precipitation: Centrifuge the lysis mixture at 5000 g - 15000 g to obtain a supernatant. Mix the supernatant with a precipitation solution at a relative volume ratio of (500 μL - 650 μL):(50 - 250 μL). Invert the mixture several times and then centrifuge at 5000 g - 15000 g to obtain a supernatant.

[0021] Nucleic acid binding: Mix the supernatant, a binding solution, and magnetic beads to allow the magnetic beads to adsorb nucleic acids. Remove the supernatant to obtain magnetic beads bound with nucleic acids. The volume ratio of the supernatant to the binding solution is 1:0.8 - 1:3, and the amount of magnetic beads used per reaction unit is 5 μg - 50 μg.

[0022] Rinsing impurities: Wash the magnetic beads bound with nucleic acids successively with a first impurity washing solution and a second impurity washing solution to remove impurities, obtaining magnetic beads only bound with nucleic acids. The impurities include at least one of proteins, small molecule substances, and salt substances.

[0023] Nucleic acid elution: Mix the magnetic beads only bound with nucleic acids with an elution solution, incubate, and centrifuge to obtain a supernatant containing the target DNA and / or RNA.

[0024] Compared with traditional techniques, the advantages of using the kit of the present application for nucleic acid extraction from complex samples are at least as follows:

[0025] 1. The system improves the components and lysis method of the lysis solution, achieving efficient lysis of various complex samples without the need to add reagents of concern, which can greatly expand the accessibility and convenience of efficient nucleic acid extraction from complex samples and facilitate the daily extraction and related detection experiments of various relevant institutions and research units.

[0026] 2. Through systematic improvement of the working environment of the precipitation solution, under the condition of keeping RNA suspended in the solution, the removal of PCR inhibitors is maximized through selective precipitation technology, effectively removing a large amount of PCR inhibitors in various complex samples, thereby improving the purity of nucleic acid extraction and downstream compatibility.

[0027] 3. By optimizing the nucleic acid recovery method and the automated operation of plate reagent dispensing and operation procedures, semi-automatic DNA / RNA extraction for complex samples is achieved, which can reduce the operation time by 85% and improve the extraction and detection ability by 4 times, and is compatible with current mainstream automated nucleic acid extraction instruments, greatly improving the efficiency of nucleic acid extraction and detection for complex samples. Description of the Drawings

[0028] To more clearly illustrate the technical solutions in the embodiments and examples of the present application and to more fully understand the present application and its beneficial effects, the following will briefly introduce the accompanying drawings required for the description of the embodiments or examples. Obviously, the accompanying drawings in the following description are only some embodiments of the present application. For those skilled in the art, without creative efforts, other drawings can be obtained based on these drawings. It should also be noted that the drawings are all drawn in a simplified form and are only used to conveniently and clearly assist in explaining the present application.

[0029] Figure 1 This is the effect of the nucleic acid extraction method proposed in an embodiment of the present application and the extraction of complex samples by other domestic and foreign commercial kits. Specific embodiments

[0030] To facilitate the understanding of the present application, the following will describe the present application more comprehensively with reference to the relevant accompanying drawings. The preferred embodiments of the present application are given in the drawings. However, the present application can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure content of the present application more thorough and comprehensive.

[0031] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the technical field to which the present application belongs. The terms used in the description of the present application in this specification are only for the purpose of describing specific embodiments and are not intended to limit the present application.

[0032] The selection range of the terms “and / or”, “or / and”, and “and / or” used herein includes any one of two or more related listed items, and also includes any and all combinations of the related listed items. The said any and all combinations include any two related listed items, any more related listed items, or the combination of all related listed items. It should be noted that when at least two conjunctions selected from “and / or”, “or / and”, and “and / or” are used to connect at least three items, it should be understood that in the present application, this technical solution undoubtedly includes the technical solution connected by “logical AND” and also undoubtedly includes the technical solution connected by “logical OR”. For example, “A and / or B” includes three parallel solutions: A, B, and A + B. Another example, the technical solution of “A, and / or, B, and / or, C, and / or, D” includes any one of A, B, C, and D (that is, the technical solution connected by “logical OR”), and also includes any and all combinations of A, B, C, and D, that is, it includes the combination of any two or any three of A, B, C, and D, and also includes the combination of the four items A, B, C, and D (that is, the technical solution connected by “logical AND”).

[0033] In this application, unless otherwise specified, "one or more" means any one of the listed items or any combination of the listed items. Similarly, in other cases where "one or more" or other expressions indicating "one or more" are used, unless otherwise specified, the same understanding applies.

[0034] As used in this application, "its combination", "any combination thereof", "any combination mode thereof", etc. include all suitable combination modes of any two or more of the listed items.

[0035] In this application, "suitable" in "suitable combination mode", "suitable mode", "any suitable mode", etc. is subject to being able to implement the technical solution of this application, solve the technical problems of this application, and achieve the expected technical effects of this application.

[0036] In this application, terms such as "further", "furthermore", "especially", "for example", "such as", "example", "exemplification", etc. are used for descriptive purposes, indicating that there is a correlation in the covered content between the previous and the subsequent different technical solutions, but should not be understood as a limitation on the previous technical solution, nor as a limitation on the protection scope of this application. In this application, unless otherwise specified, A (such as B) means that B is a non-limiting example of A, and it can be understood that A is not limited to B.

[0037] In this application, "optionally", "optional", "option", mean that it can be either present or absent, that is, it refers to any one of the two alternative schemes of "present" or "absent". If "optional" appears multiple times in a technical solution, unless otherwise specified and there is no contradiction or mutual restriction relationship, each "optional" is independent. Unless otherwise specified, descriptions such as "optionally include" and "optionally contain" in this application, taking "optionally include" as an example, mean "may include or may not include".

[0038] The terms "contain", "include", and "comprise" used in this application are synonyms, which are inclusive or open-ended, and do not exclude additional, unmentioned members or features. Members or features include, for example, materials or components, structures, elements, instruments, etc.; non-limiting examples of members or features also include actions, conditions for the occurrence of actions, timing, states, etc.

[0039] In this application, in a technical feature or technical solution described in an open language, it includes a closed technical feature or technical solution composed of the listed content, and also includes an open technical feature or technical solution containing the listed content.

[0040] In this application, exemplary descriptions such as "in some embodiments" or "in one embodiment" can cover, but are not limited to, the following meanings: These solutions can be combined with other solutions in a suitable manner to form new technical solutions.

[0041] In this application, in "the first aspect", "the second aspect", "the third aspect", "the fourth aspect", etc., the terms "first", "second", "third", "fourth", etc. are only used for descriptive purposes and cannot be construed as indicating or implying relative importance or quantity, nor can they be construed as implicitly specifying the importance or quantity of the indicated technical features. Moreover, "first", "second", "third", "fourth", etc. only serve the purpose of non-exhaustive enumerative description and should be understood not to constitute a closed limitation on quantity.

[0042] In this application, regarding numerical intervals (i.e., numerical ranges), unless otherwise specifically stated, the distribution of the selectable numerical values within the numerical interval is considered continuous and includes the two numerical endpoints of the numerical interval (i.e., the minimum value and the maximum value), as well as each numerical value between these two numerical endpoints. Unless otherwise specifically stated, when the numerical interval only refers to integers within the numerical interval, it includes the two endpoint integers of the numerical range, as well as each integer between the two endpoints, which is equivalent to directly listing each integer. For example, t is an integer selected from 1 to 10, indicating that t is any integer selected from the integer group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10. When multiple numerical ranges are provided to describe features or characteristics, these numerical ranges can be combined. In other words, unless otherwise specified, the numerical ranges disclosed herein should be understood to include any and all sub-ranges subsumed therein. The "numerical value" in the numerical interval can be any quantitative value, such as a number, a percentage, a ratio, etc. The "numerical interval" is allowed to broadly include numerical interval types such as percentage intervals, ratio intervals, and ratio value intervals.

[0043] In this application, when a method process involves multiple steps, unless there are clear different descriptions in this article, the execution of these steps has no strict order limit, and they can be executed in an order other than the described one. Moreover, any one step can include multiple sub-steps or multiple stages. These sub-steps or stages do not necessarily need to be executed at the same time, but can be executed at different times, and their execution order does not necessarily need to be sequential, but can be executed alternately or simultaneously with other steps or a part of the sub-steps or stages of other steps.

[0044] The temperature parameter in this application, unless otherwise specifically limited, allows both constant temperature treatment and fluctuations within a certain temperature range. It should be understood that the so-called constant temperature treatment allows the temperature to fluctuate within the accuracy range controlled by the instrument. Fluctuations within a range such as ±5°C, ±4°C, ±3°C, ±2°C, ±1°C are allowed.

[0045] In this application, %(w / w) and wt% both represent weight percentage, %(v / v) refers to volume percentage, and %(w / v) refers to mass-volume percentage.

[0046] All documents mentioned in this application are incorporated herein by reference as if each document was individually incorporated by reference. Unless it conflicts with the purpose of this application and / or the technical solution, the cited documents involved in this application are incorporated by reference in their entirety and for all purposes. When referring to cited documents in this application, the definitions of relevant technical features, terms, nouns, phrases, etc. in the cited documents are also incorporated by reference. When referring to cited documents in this application, examples and preferred methods of the relevant technical features cited can also be incorporated into this application as references, but only to the extent that this application can be implemented. It should be understood that when the cited content conflicts with the description in this application, this application shall prevail or be amended adaptively according to the description in this application.

[0047] The inventors creatively combine relevant components such as lysis medium, lysis solution, precipitation solution, binding solution, magnetic beads, first washing solution, second washing solution and elution solution, etc., and can, without the need to additionally add relevant regulated reagents, efficiently break the high-level structure of complex samples through a combination of physical fragmentation and chemical lysis, thereby releasing nucleic acids, creating a suitable selective precipitation environment, selectively precipitating various PCR inhibitors in the sample while retaining DNA and RNA, and can achieve efficient recovery of DNA and / or RNA through the specific adsorption binding and elution of magnetic beads.

[0048] In a first aspect of the embodiments of this application, there is provided a kit for efficiently extracting DNA and / or RNA and removing PCR inhibitors from complex samples such as sewage, soil, feces, sediment and activated sludge, etc. The kit includes a lysis medium, a lysis solution, a precipitation solution, a binding solution, a magnetic bead storage solution, a first washing solution, a second washing solution and an elution solution.

[0049] The lysis medium in this application can be hard particles pre-packaged in a grinding tube, and its function is at least to provide effects such as impact and friction during the vortex collision, so as to use physical stress to break the complex higher-level structures in the sample and protective structures such as bacterial cell walls and virus nucleocapsids, thereby releasing nucleic acids in the organism. Optionally, the types of the lysis medium include one or more of the following: acid-washed glass beads, zirconium beads, steel beads, garnet or other hard spherical particles. In some embodiments, the above lysis medium is acid-washed glass beads. In this application, the particle size of the lysis medium can be 0.1 mm to 3 mm. In some embodiments, the particle size of the lysis medium is 0.1 mm, 0.2 mm, 0.3 mm, 0.4 mm, 0.5 mm, 0.6 mm, 0.7 mm, 0.8 mm, 0.9 mm, 1 mm, 1.1 mm, 1.2 mm, 1.3 mm, 1.4 mm, 1.5 mm, 1.6 mm, 1.7 mm, 1.8 mm, 1.9 mm, 2 mm, 2.1 mm, 2.2 mm, 2.3 mm, 2.4 mm, 2.5 mm, 2.6 mm, 2.7 mm, 2.8 mm, 2.9 mm, 3 mm, or the range or value between any two values. Exemplarily, the particle size of the lysis medium contained in the kit includes one or more of the following ranges: 0.1 mm to 0.3 mm, 0.3 mm to 0.5 mm, 0.5 mm to 0.7 mm, 0.7 mm to 1 mm, and 1 mm to 3 mm. In some embodiments, the diameter range of the lysis medium is 0.1 mm to 0.3 mm.

[0050] In some embodiments, the pre-packaged mass range of the lysis medium in the grinding tube is 0.2 g to 1 g. This content can be used as the amount of one reaction unit. If not specifically stated, the dosages of the following lysis solution, precipitation solution, etc. are also the dosages in one reaction unit. It should be understood that this pre-packaged mass range can be adjusted according to the content of the complex sample. In some embodiments, the pre-packaged mass of the lysis medium in the grinding tube is 0.45 g.

[0051] Unless otherwise specified, the term "reaction unit" in this application refers to processing a sample or carrying out a reaction in a separate space, such as in a grinding tube or a centrifuge tube. This reaction unit is dynamic. For example, when mechanical force grinding is carried out, one grinding tube is one reaction unit. When the obtained lysis mixture is transferred in space for subsequent PCR inhibitor precipitation treatment, it is also an independent reaction unit, and so on.

[0052] The lysis solution plays at least a dual role. Its first purpose is at least to cooperate with the grinding medium to provide the high-salt environment, detergent, and pH buffer system required during the lysis process, thereby disrupting the cellular and subcellular structures of the biomass and promoting the separation of DNA / RNA from the binding proteins. Its second purpose is at least to provide a solubilizing environment to shield the charges on the RNA base side, thereby increasing the hydrophilicity of RNA and increasing its solubility.

[0053] The components of the lysis solution include buffer salts, chaotropic salts, detergents, and RNA solubilizers. Among them, the purpose of the buffer salts is at least to stabilize the pH value of the lysis system after the sample is added. In this application, the types of buffer salts may include one or more of the following: tris(hydroxymethyl)aminomethane-hydrochloride buffer salt, tris(hydroxymethyl)aminomethane-ethylenediaminetetraacetic acid buffer salt, disodium hydrogen phosphate-sodium dihydrogen phosphate buffer salt, sodium citrate-citric acid buffer salt. In some embodiments, the above buffer salt is disodium hydrogen phosphate-sodium dihydrogen phosphate buffer salt. In some embodiments, the concentration of the above buffer salt in the lysis solution is 10 mmol / L to 100 mmol / L. Exemplarily, the concentration of the buffer solution in the lysis solution is 10 mmol / L, 15 mmol / L, 20 mmol / L, 25 mmol / L, 30 mmol / L, 35 mmol / L, 40 mmol / L, 45 mmol / L, 50 mmol / L, 55 mmol / L, 60 mmol / L, 65 mmol / L, 70 mmol / L, 75 mmol / L, 80 mmol / L, 85 mmol / L, 90 mmol / L, 95 mmol / L, 100 mmol / L, or the range or value between any two values. In one embodiment, the concentration combination of the above buffer salt is 80 mmol / L of disodium hydrogen phosphate and 20 mmol / L of sodium dihydrogen phosphate. The pH range of the binding solution stabilized by the above buffer salt can be 5.5 to 8.5. Exemplarily, 5.5, 6, 6.5, 7, 7.5, 8, or 8.5. In some embodiments, the pH of the binding solution stabilized by the above buffer salt is 7.0. The purpose of the chaotropic salts is at least to create a high-salt lysis environment to denature proteins and destroy potential nucleases. In this application, the types of chaotropic salts may include one or more of the following: guanidine isothiocyanate, sodium isothiocyanate, potassium isothiocyanate, ammonium isothiocyanate, guanidine hydrochloride, ammonium sulfate, sodium chloride, potassium chloride, lithium chloride, or other monovalent salt solutions. In some embodiments, the monovalent salt includes one or more of sodium chloride, potassium chloride, and lithium chloride. In some embodiments, the above chaotropic salt is a mixture of guanidine isothiocyanate and sodium chloride. In this application, the concentration of the above chaotropic salt in the lysis solution can be 1 mol / L to 4 mol / L. Exemplarily, the concentration of the chaotropic salt in the lysis solution is 1 mol / L, 1.5 mol / L, 2 mol / L, 2.5 mol / L, 3 mol / L, 3.5 mol / L, 4 mol / L, or the range or value between any two values. In some embodiments, the lysis solution contains guanidine isothiocyanate and sodium chloride, and the concentration of guanidine isothiocyanate in the lysis solution is 3 mol / L, and the concentration of sodium chloride in the lysis solution is 1 mol / L.The purpose of the detergent is at least to dissolve the cell membrane or the nucleocapsid of the virus and disrupt the binding of DNA / RNA to the binding protein, thereby releasing the nucleic acid in a free state. In this application, the types of detergents may include one or more of the following: anionic or non-ionic surfactants such as sodium dodecyl sulfate, sodium dodecyl sulfonate, sodium dodecyl benzene sulfonate, sodium lauroyl sarcosine, Tween-20, Tween-80, Triton X-100, etc. In some embodiments, the above-mentioned detergent is a mixture of sodium dodecyl sulfate and Tween-20. In this application, the concentration of the above-mentioned detergent in the lysis solution can be 0.01 wt% to 1 wt%. In some embodiments, the detergent is a mixture of sodium dodecyl sulfate and Tween-20, and the concentration of sodium dodecyl sulfate in the lysis solution is 0.2 wt%, and the concentration of Tween-20 in the lysis solution is 0.02 wt%. The purpose of the RNA solubilizer is at least to shield the charge on the side of the RNA base, thereby increasing the hydrophilicity of RNA. In this application, the types of RNA solubilizers may include one or more of the following: small molecule organic acid salts such as ammonium acetate, sodium acetate, potassium acetate, ammonium formate, sodium formate, potassium formate, etc. In some embodiments, the above-mentioned RNA solubilizer is ammonium acetate. Further, the concentration of the above-mentioned RNA solubilizer in the lysis solution is 0.5 mol / L to 3 mol / L. Exemplarily, the concentration of the RNA solubilizer in the lysis solution is 0.5 mol / L, 1 mol / L, 1.5 mol / L, 2 mol / L, 2.5 mol / L, 3 mol / L, or a range or value between any two values. In some embodiments, the concentration of the RNA solubilizer in the lysis solution is 0.5 mol / L to 1 mol / L. In some embodiments, the concentration of the RNA solubilizer in the lysis solution is 0.5 mol / L.

[0054] The purpose of the precipitation solution is at least to produce a large amount of positively charged metal hydroxide colloids. After contacting with the lysis solution, the metal hydroxide colloids will selectively adsorb PCR inhibitors such as proteins, humic acids, heme, and phytogenic polysaccharides, but have a poor adsorption effect on DNA and RNA protected by solubilization, thereby achieving selective removal of PCR inhibitors. In this application, the main components of the precipitation solution may include one or more of the following: aluminum sulfate, potassium alum, ammonium alum, basic aluminum sulfate, aluminum chloride, basic aluminum chloride, ferric chloride, and lanthanum chloride. In some embodiments, the precipitating agent used for the precipitation solution is potassium alum. In some embodiments, the concentration of the precipitating agent in the precipitation solution is 0.01 mol / L to 0.5 mol / L. Exemplarily, the concentration of the precipitating agent in the precipitation solution is 0.01 mol / L, 0.02 mol / L, 0.05 mol / L, 0.07 mol / L, 0.09 mol / L, 0.1 mol / L, 0.15 mol / L, 0.2 mol / L, 0.25 mol / L, 0.3 mol / L, 0.35 mol / L, 0.4 mol / L, 0.45 mol / L, 0.5 mol / L, or the range or value between any two values. In some embodiments, the concentration of the precipitating agent in the precipitation solution is 0.05 mol / L.

[0055] The purpose of the binding solution is at least to supplement the ionic strength reduced after the action of the precipitation solution and additionally provide an organic solvent, thereby reducing the solubility of DNA / RNA so as to be adsorbed and captured by magnetic beads. The components of the binding solution include buffer salts, chaotropic salts, organic solvents and surfactants. Among them, the purpose of the buffer salt is at least to stabilize the pH value of the system during nucleic acid binding to be weakly acidic to promote nucleic acid adsorption. In this application, the types of buffer salts may include one or more of the following: tris(hydroxymethyl)aminomethane-hydrochloric acid buffer salt, tris(hydroxymethyl)aminomethane-ethylenediaminetetraacetic acid buffer salt, disodium hydrogen phosphate-sodium dihydrogen phosphate buffer salt, and sodium citrate-citric acid buffer salt. In some embodiments, the above buffer salt is tris(hydroxymethyl)aminomethane-ethylenediaminetetraacetic acid buffer salt. In this application, the concentration of the above buffer salt in the binding solution can be 10 mmol / L to 100 mmol / L. In some embodiments, the concentration combination of the above buffer salt is 50 mmol / L of tris(hydroxymethyl)aminomethane and 50 mmol / L of ethylenediaminetetraacetic acid. In some embodiments, the pH range of the binding solution stabilized by the above buffer salt is 4.5 to 7.0. Exemplarily, the pH of the binding solution is stabilized at 4.5, 5, 5.5, 6, 6.5, 7, or the range or value between any two values. In some embodiments, the pH of the binding solution stabilized by the above buffer salt is 6.0. The purpose of the chaotropic salt is at least to provide the ionic strength necessary for nucleic acid adsorption to promote nucleic acid adsorption. In this application, the types of chaotropic salts may include one or more of the following: guanidine isothiocyanate, sodium isothiocyanate, potassium isothiocyanate, ammonium isothiocyanate, guanidine hydrochloride, ammonium sulfate, sodium chloride, potassium chloride, or other monovalent salt solutions. In some embodiments, the above chaotropic salt is guanidine isothiocyanate. In this application, the concentration of the above chaotropic salt in the binding solution can be 1 mol / L to 5 mol / L. Exemplarily, the concentration of the chaotropic salt in the binding solution is 1 mol / L, 1.5 mol / L, 2 mol / L, 2.5 mol / L, 3 mol / L, 3.5 mol / L, 4 mol / L, 4.5 mol / L, 5 mol / L, or the range or value between any two values. In some embodiments, the concentration of the chaotropic salt in the binding solution is 3 mol / L. The purpose of the organic solvent is at least to reduce the solubility of nucleic acid in aqueous solution, thereby promoting the precipitation of nucleic acid from the solution and being captured by magnetic beads. In this application, the types of organic solvents may include one or more of the following: ethanol, isopropanol, polyethylene glycol, formamide, or dimethylformamide. In some embodiments, the above organic solvent is isopropanol. In this application, the volume fraction of the above organic solvent in the binding solution can be 10 wt% to 30 wt%. In some embodiments, the volume fraction of the above organic solvent in the binding solution is 25 wt%. The role of the surfactant is at least to stabilize the suspension state of nucleic acid and magnetic beads and prevent nucleic acid from directly settling.In the present application, the types of surfactants may include one or more of the following: Tween-20, Tween-40, Tween-60, Tween-80, Triton X-100, NP-40, polyethylene glycol. In some embodiments, the above surfactant is Tween-20. In the present application, the mass fraction of the above surfactant in the binding solution may be 0.1 wt% to 5 wt%. Exemplarily, the mass fraction may be 0.1 wt%, 0.2 wt%, 0.3 wt%, 0.4 wt%, 0.5 wt%, 0.6 wt%, 0.7 wt%, 0.8 wt%, 0.9 wt%, 1 wt%, 1.5 wt%, 2 wt%, 2.5 wt%, 3 wt%, 3.5 wt%, 4 wt%, 4.5 wt%, 5 wt%, or the range or value between any two values. In some embodiments, the mass fraction of the above surfactant in the binding solution is 2 wt%.

[0056] The purpose of the magnetic beads is at least to utilize the chemical functional groups modified on the surface of the magnetic beads to adsorb and capture DNA / RNA under the conditions of high ionic strength and the presence of organic solvents. In the present application, the above magnetic beads may include one or more of the following: hydroxyl-modified silica-coated iron tetroxide magnetic beads, epoxy-modified silica-coated iron tetroxide magnetic beads, and carboxyl-modified silica-coated iron tetroxide magnetic beads. In some embodiments, the above magnetic beads are hydroxyl-modified silica-coated iron tetroxide magnetic beads. In the present application, the mass concentration of the above magnetic beads in the stock solution may be 5 mg / mL to 100 mg / mL. In some embodiments, the mass concentration of the above magnetic beads in the stock solution is 10 mg / mL.

[0057] The purpose of the first washing and impurity-removing solution is at least to further denature and remove the protein contamination bound to the magnetic beads while keeping the DNA / RNA adsorbed on the magnetic beads. The main components of the first washing and impurity-removing solution include buffer salts, chaotropic salts, organic solvents, and surfactants. Among them, the purpose of the buffer salts is at least to stabilize the pH value during the washing and impurity-removing process. The types of buffer salts in the first washing and impurity-removing solution may include one or more of the following: tris(hydroxymethyl)aminomethane-hydrochloric acid buffer salt, tris(hydroxymethyl)aminomethane-ethylenediaminetetraacetic acid buffer salt, disodium hydrogen phosphate-sodium dihydrogen phosphate buffer salt, sodium citrate-citric acid buffer salt. In some embodiments, the above buffer salt is tris(hydroxymethyl)aminomethane-hydrochloric acid buffer salt. In the present application, the concentration of the above buffer salt in the first washing and impurity-removing solution may be 10 mmol / L to 100 mmol / L. In some embodiments, the concentration combination of the above buffer salt is 20 mmol / L of tris(hydroxymethyl)aminomethane and 20 mmol / L of hydrochloric acid. Further, the pH range of the binding solution stabilized by the above buffer salt is 6.0 to 8.0. In some embodiments, the pH of the first washing and impurity-removing solution stabilized by the above buffer salt is 6.8 to 7.4. The purpose of the chaotropic salt is at least to further denature and wash away the protein contamination remaining on the magnetic beads. Optionally, the types of chaotropic salts include one or more of the following: guanidine isothiocyanate, sodium isothiocyanate, potassium isothiocyanate, ammonium isothiocyanate, guanidine hydrochloride, ammonium sulfate, sodium chloride, potassium chloride, or other monovalent salt solutions. In some embodiments, the above chaotropic salt is guanidine hydrochloride. In the present application, the concentration of the above chaotropic salt in the first washing and impurity-removing solution may be 0.05 mol / L to 2 mol / L. Exemplarily, the concentration of the chaotropic salt in the first washing and impurity-removing solution is 0.05 mol / L, 0.06 mol / L, 0.08 mol / L, 0.09 mol / L, 0.1 mol / L, 0.15 mol / L, 0.2 mol / L, 0.25 mol / L, 0.3 mol / L, 0.35 mol / L, 0.4 mol / L, 0.5 mol / L, 1 mol / L, 1.1 mol / L, 1.2 mol / L, 1.3 mol / L, 1.4 mol / L, 1.5 mol / L, 1.6 mol / L, 1.7 mol / L, 1.8 mol / L, 1.9 mol / L, 2 mol / L, or the range or value between any two values. In some embodiments, the concentration of the chaotropic salt in the first washing and impurity-removing solution is 2 mol / L. The purpose of the organic solvent is at least to stabilize the adsorption state of nucleic acids on the magnetic beads. In the present application, the types of organic solvents may include one or more of the following: ethanol, isopropanol, polyethylene glycol, formamide, or dimethylformamide. In some embodiments, the above organic solvent is ethanol. In the present application, the volume fraction of the above organic solvent in the first washing and impurity-removing solution may be 30% to 80%. In some embodiments, the volume fraction of the above organic solvent in the first washing and impurity-removing solution is 40%.The purpose of the surfactant is at least to promote the elution effect of the denatured protein from the magnetic beads and increase the surface area of the magnetic beads accessible to the solution. In this application, the types of surfactants used in the first washing solution may include one or more of the following: Tween-20, Tween-40, Tween-60, Tween-80, Triton X-100, NP-40, and polyethylene glycol. In some embodiments, the above surfactant is Tween-20. In this application, the mass fraction of the above surfactant in the first washing solution may be 0.1% to 5%. In some embodiments, the mass fraction of the above surfactant in the first washing solution is 1%.

[0058] The purpose of the second washing solution is at least to rinse and remove the residual salt ions on the magnetic beads. The main components of the second washing solution include buffer salts and organic solvents. Among them, the purpose of the buffer salts is at least to stabilize the pH value during the washing process. In this application, the types of buffer salts used in the second washing solution may include one or more of the following: tris(hydroxymethyl)aminomethane-hydrochloric acid buffer salt, tris(hydroxymethyl)aminomethane-ethylenediaminetetraacetic acid buffer salt, disodium hydrogen phosphate-sodium dihydrogen phosphate buffer salt, sodium citrate-citric acid buffer salt. In some embodiments, the above buffer salt is tris(hydroxymethyl)aminomethane-hydrochloric acid buffer salt. In this application, the concentration of the above buffer salt in the second washing solution may be 10 mmol / L to 100 mmol / L. In some embodiments, the concentration combination of the above buffer salt is 10 mmol / L of tris(hydroxymethyl)aminomethane and 10 mmol / L of hydrochloric acid. Further, the pH range of the binding solution stabilized by the above buffer salt may be 6.0 to 8.0. In some embodiments, the pH of the second washing solution stabilized by the above buffer salt is 6.8 to 7.4. The purpose of the organic solvent is at least to stabilize the adsorption state of nucleic acid on the magnetic beads. In this application, the types of organic solvents used in the second washing solution may include one or more of the following: ethanol, isopropanol, polyethylene glycol, and formamide or dimethylformamide. In some embodiments, the above organic solvent is ethanol. In this application, the volume fraction of the above organic solvent in the second washing solution may be 50% to 90%. In some embodiments, the volume fraction of the above organic solvent in the second washing solution is 80%.

[0059] The purpose of the eluent is at least to elute nucleic acids from the magnetic beads. The main components of the eluent include buffer salts and surfactants. Among them, the purpose of the buffer salts is at least to stabilize the pH value during the washing process. In this application, the types of buffer salts used in the eluent may include one or more of the following: tris(hydroxymethyl)aminomethane-hydrochloric acid buffer salt, tris(hydroxymethyl)aminomethane-ethylenediaminetetraacetic acid buffer salt, disodium hydrogen phosphate-sodium dihydrogen phosphate buffer salt, and sodium citrate-citric acid buffer salt. In some embodiments, the above buffer salt is tris(hydroxymethyl)aminomethane-ethylenediaminetetraacetic acid buffer salt. In this application, the concentration of the above buffer salt in the eluent can be 1 mmol / L to 100 mmol / L. Exemplarily, for example, it can be 1 mmol / L, 2 mmol / L, 3 mmol / L, 5 mmol / L, 7 mmol / L, 9 mmol / L, 10 mmol / L, 12 mmol / L, 15 mmol / L, 18 mmol / L, 20 mmol / L, 25 mmol / L, 30 mmol / L, 35 mmol / L, 40 mmol / L, 45 mmol / L, 50 mmol / L, 55 mmol / L, 60 mmol / L, 65 mmol / L, 70 mmol / L, 75 mmol / L, 80 mmol / L, 85 mmol / L, 90 mmol / L, 95 mmol / L, 100 mmol / L, or a range or value between any two values.

[0060] In some embodiments, the concentration combination of the above buffer salt in the eluent is 10 mmol / L of tris(hydroxymethyl)aminomethane and 0.1 mmol / L of ethylenediaminetetraacetic acid. In some embodiments, the pH range of the binding solution stabilized by the above buffer salt is 6.0 to 8.0. In some embodiments, the pH of the eluent stabilized by the above buffer salt is 7.4 to 7.6. The role of the surfactant is at least to shield the charge on the surface of the magnetic beads, thereby improving the elution effect of nucleic acids. In some embodiments, the types of surfactants include one or more of the following: Tween-20, Tween-40, Tween-60, Tween-80, Triton X-100, NP-40, and polyethylene glycol. In some embodiments, the above surfactant is Tween-20. In some embodiments, the mass fraction of the above surfactant in the eluent is 0.01% to 1%. In some embodiments, the mass fraction of the above surfactant in the eluent is 0.05%.

[0061] The second aspect of the embodiments of the present application provides a nucleic acid extraction method for efficiently and synchronously extracting DNA and / or RNA from complex samples including sewage, soil, feces, sediment, sludge, water body filter membranes, etc. based on the above-mentioned kit, which specifically includes mechanical force grinding lysis, shielding agent precipitation, nucleic acid binding, impurity rinsing, and nucleic acid elution.

[0062] In some embodiments, the method includes:

[0063] Mechanical force grinding: Mix the lysis medium, lysis solution and the sample to be detected, and grind them by mechanical force oscillation to obtain a lysis mixture; wherein, the relative dosage of the lysis solution to the liquid sample to be detected in each reaction unit is (400 μL - 700 μL):(50 μL - 300 μL), and the relative dosage of the lysis solution to the solid sample to be detected is (400 μL - 700 μL):(25 mg - 300 mg);

[0064] PCR inhibitor precipitation: Centrifuge the lysis mixture, and obtain the supernatant after centrifugation at 5000 g - 15000 g. Mix the supernatant with the precipitation solution, and the relative dosage is (500 μL - 650 μL):(50 - 250 μL). Invert it up and down several times, and then centrifuge at 5000 g - 15000 g to obtain the supernatant;

[0065] Nucleic acid binding: Mix the supernatant, binding solution and magnetic beads to enable the magnetic beads to adsorb nucleic acids, and remove the supernatant to obtain magnetic beads bound with nucleic acids; the volume ratio of the supernatant to the binding solution is 1:0.8 - 1:3, and the dosage of magnetic beads in each reaction unit is 5 μg - 50 μg;

[0066] Rinsing impurities: Wash the magnetic beads bound with nucleic acids successively with the first impurity washing solution and the second impurity washing solution to remove impurities, and obtain magnetic beads only bound with nucleic acids; the impurities include at least one of proteins, small molecule substances, and salt substances;

[0067] Nucleic acid elution: Mix the magnetic beads only bound with nucleic acids with the elution solution, incubate and centrifuge; obtain the supernatant containing the target DNA and / or RNA.

[0068] Step 1: Mechanical force grinding lysis (only for exemplary operation)

[0069] The purpose of mechanical force grinding lysis is at least to mix the sample to be extracted with the lysis solution and lysis medium in the grinding tube, and under the condition of externally applied mechanical force oscillation, break the higher-level structure of the sample to be extracted through the dual effects of physics and chemistry, and lyse the cell wall / membrane of bacteria and the nucleocapsid of viruses, so as to release nucleic acids. In some embodiments, the operation steps of mechanical force grinding lysis include:

[0070] 1. Add a certain volume of lysis buffer to the grinding tube pre-loaded with grinding media. The volume of the above-mentioned lysis buffer added to a single grinding tube is 400 μL, 450 μL, 500 μL, 550 μL, 600 μL, 650 μL or 700 μL. In some embodiments, the volume of the above-mentioned lysis buffer is 500 μL. It should be noted that the optimal dosage of the lysis buffer should be dynamically adjusted according to the dosage and properties of the sample. When the solid content rate of the sample is high and the volume is large, a larger volume of the lysis buffer dosage (such as 650 μL or 700 μL) should be preferred.

[0071] 2. Add the sample to be detected to the grinding tube already filled with the lysis buffer. When using a single grinding tube and the dosage of the lysis buffer is 400 μL - 700 μL, for liquid samples (such as enriched sewage, resuspended sediment, etc.), the recommended sample input amount is 50 μL - 300 μL. In some embodiments, the input amount of the above-mentioned type of sample is 200 μL; for solid samples (such as soil, sediment, feces, etc.), the recommended sample input amount is 25 mg - 300 mg. In some embodiments, the input amount of the fecal sample is 25 mg - 50 mg, such as 25 mg or 50 mg. In some other embodiments, the input amount of the soil sample is 100 mg - 200 mg; for filter membrane samples (such as enriched water body filter membrane), the recommended sample input amount is 1 / 4 - 1 piece of 47 or 50 mm filter membrane. In some embodiments, the input amount of the filter membrane sample is 1 / 2 piece of 47 or 50 mm filter membrane. In particular, due to the strong heterogeneity of the above-mentioned samples, it should be noted that when facing samples with too high organic matter content and a large content of potential PCR inhibitors, the sample input amount should be appropriately reduced to ensure the nucleic acid extraction effect.

[0072] 3. After adding the sample, cover the lid of the grinding tube, fix the grinding tube on the mechanical force oscillation device, and perform mechanical force oscillation grinding according to certain parameters according to the specific type of oscillation device and the downstream experimental purpose to promote sample lysis. Optionally, the devices for performing mechanical force oscillation include a vortex mixer or a grinding homogenizer. In the subsequent embodiments, both of these mechanical force oscillation methods are involved and are equivalent to a certain extent. The specific oscillation parameters for using the two mechanical force oscillation methods need to be selected by comprehensively considering the sample type and the downstream experimental purpose. Specifically, when the sample structure is relatively complex and the particle size is relatively large, the grinding homogenizer should be preferentially selected for mechanical force oscillation, and when the sample structure is relatively simple, the vortex mixer can also be selected for mechanical force oscillation. At the same time, when the downstream experiment has high requirements for the integrity of nucleic acids, especially DNA (such as long-fragment PCR amplification, third-generation sequencing, etc.), the vortex mixer oscillation should be preferentially selected or the oscillation should be performed under mild parameter conditions, while when the downstream nucleic acid integrity requirements are not high but the lysis effect requirements are high, the grinding homogenizer is preferentially selected and the oscillation is performed under relatively severe parameter conditions. Further, when using a vortex mixer for oscillation, the recommended oscillation speed is 800 rpm to 3000 rpm, and the oscillation time is 5 min to 20 min. In some embodiments, the oscillation speed for using a vortex mixer for oscillation is 1200 rpm to 1500 rpm, and the oscillation time is 10 min; when using a grinding homogenizer for oscillation, the recommended oscillation speed is 3 m / s to 7 m / s, the oscillation time is 15 s to 120 s, and the number of oscillation cycles is 2 to 4 times. In some embodiments, the relatively mild oscillation parameter conditions are an oscillation speed of 4 m / s, an oscillation duration of 15 s, and a cycle number of 2 times, and the relatively severe oscillation conditions are 6 m / s, an oscillation duration of 1 s, and a cycle number of 1 time.

[0073] It should be noted that since the scope of complex samples and environmental samples is relatively wide and the downstream detection purposes are different. Although the nucleic acid load in most complex samples and environmental samples is relatively high, for some samples, such as barren soil, enriched surface water / reclaimed water, and unenriched raw sewage, although they also have the characteristics of complex structure and high inhibitor content, the nucleic acid load in them is relatively low. When extracting nucleic acids from such samples, some necessary chemical aids need to be additionally added on the basis of the above process to ensure the nucleic acid extraction and recovery effects, and the relevant steps and contents also belong to the essential discoveries and contributions of this application. Exemplarily:

[0074] When extracting samples with the above-mentioned relatively complex structures, high inhibitor content but low nucleic acid load, and when the downstream experiments do not include RNA sequencing, to ensure the extraction effect, based on the above-mentioned specific operation method of grinding and lysing, after dispensing a certain volume of lysis buffer into the grinding tube, a certain mass of captured RNA should be additionally added to the grinding tube. Specifically, the mass range of the captured RNA is 1 μg to 10 μg, and preferably the mass range is 2 μg to 5 μg. In some embodiments, the dosage is 2 μg. The captured RNA can effectively avoid nucleic acid loss caused by non-specific adsorption during nucleic acid extraction, so it can improve the nucleic acid extraction effect for such special samples and basically will not cause additional interference to downstream detection experiments including PCR, RT-PCR, qPCR, RT-qPCR, and DNA sequencing. However, since it itself is a kind of RNA, it will cause greater interference to RNA sequencing. Therefore, it is not applicable to downstream experiments involving RNA sequencing.

[0075] When extracting samples with the above-mentioned relatively complex structures, high inhibitor content but low nucleic acid load, and when the downstream experiments include RNA sequencing, to ensure the extraction effect, based on the above-mentioned specific operation method of grinding and lysing, after dispensing a certain volume of lysis buffer into the grinding tube, a certain mass of short RNAs with a length of less than 100 nt should be additionally added to the grinding tube. Specifically, the short RNAs with a length of less than 100 nt include yeast tRNA, Escherichia coli tRNA, artificially synthesized short Poly A fragments, or short fragment in vitro transcription products, etc. In some embodiments, the above-mentioned short RNAs with a length of less than 100 nt are yeast tRNA. Further, the mass of the short RNAs with a length of less than 100 nt added is 5 μg to 25 μg. In some embodiments, the preferred mass concentration of the addition is 10 μg to 20 μg. Since the short RNAs <100 nt have the basic properties of nucleic acids like carrier RNA, they can also effectively avoid non-specific adsorption of nucleic acids during extraction. When building an RNA library after nucleic acid extraction, because of their too short length, they will be removed by sorting magnetic beads after reverse transcription to synthesize dscDNA, so they will not interfere with subsequent RNA sequencing.

[0076] Second step: Precipitation of masking agent (only an exemplary operation)

[0077] The purpose of the precipitation of the masking agent is at least to selectively precipitate various PCR inhibitors including humic acid, polysaccharides, etc. released after sample lysis using the precipitation solution. Specifically, the operation steps of grinding and lysing include:

[0078] 1. Place the grinding tube that has completed grinding and lysis into a centrifuge, and centrifuge it under a certain centrifugal force to separate the grinding medium, cell debris, and released endolysate. Specifically, the range of the above-mentioned centrifugal force is 5000 g to 15000 g. In some embodiments, the above-mentioned centrifugal force is 10000 g; the range of the above-mentioned centrifugation time is 30 s to 120 s. In some embodiments, the above-mentioned centrifugation time is 60 s.

[0079] 2. Aspirate all the supernatant in the grinding tube after centrifugation and transfer it to a new centrifuge tube, and add a certain volume of precipitation solution thereto. Specifically, the volume of the above-mentioned precipitation solution is 50 μL to 250 μL. In some embodiments, the volume of the above-mentioned precipitation solution is 100 μL.

[0080] 3. Invert the above-mentioned centrifuge tube several times, wait for a period of time, and then place the centrifuge tube into the centrifuge again to centrifuge it under a certain centrifugal force to separate the precipitate and the nucleic acid that has completed inhibitor removal. In some embodiments, the range of the above-mentioned centrifugal force is 5000 g to 15000 g. In some embodiments, the above-mentioned centrifugal force is 10000 g; the range of the above-mentioned centrifugation time is 30 s to 120 s. In some embodiments, the above-mentioned centrifugation time is 60 s.

[0081] Step 3: Nucleic acid binding (only exemplary operation)

[0082] The purpose of nucleic acid binding is at least to add binding solution and magnetic beads to the nucleic acid from which PCR inhibitors have been removed, increase the ionic strength and the proportion of organic solvent in the solution, so that the nucleic acid is adsorbed onto the surface of the magnetic beads, thereby achieving the purpose of separating nucleic acid from other impurities. Specifically, the operation steps of nucleic acid binding include:

[0083] 1. Transfer the supernatant after the shielding agent precipitation to a new centrifuge tube, and add a certain proportion of binding solution and a certain mass of silica hydroxyl magnetic beads according to the volume of the transferred supernatant. Specifically, the ratio range of the above-mentioned supernatant to the binding solution is 1:0.8 to 1:3. In some embodiments, the ratio of the above-mentioned supernatant to the binding solution is preferably 1:1.5, and the dosage of the above-mentioned magnetic beads is 5 μg to 50 μg. In some embodiments, the dosage of the above-mentioned magnetic beads is 30 μg.

[0084] 2. Place the mixed solution of the above-mentioned supernatant, binding solution, and magnetic beads on a vortex mixer, oscillate for a certain period of time to promote the adsorption of nucleic acid by the magnetic beads, then briefly centrifuge the centrifuge tube and place it on a magnetic rack. After all the magnetic beads are adsorbed and the supernatant is clear, aspirate and discard all the supernatant.

[0085] Step 4: Rinsing impurities (only exemplary operation)

[0086] The purpose of rinsing impurities is at least to rinse the magnetic beads with washing solutions of different formulations in sequence, so as to remove protein, small molecule and salt impurities, and ensure the elution of pure nucleic acid. Specifically, the operation of rinsing impurities includes:

[0087] 1. Add a certain volume of the first washing solution to the magnetic beads bound with nucleic acid. After thoroughly pipetting and resuspending the magnetic beads, place them on the magnetic stand again. After all the magnetic beads are adsorbed and the supernatant is clear, aspirate and discard all the supernatant. The volume range of the first washing solution is 400 - 900 μL. In some embodiments, the volume of the first washing solution is 750 μL.

[0088] 2. Add a certain volume of the second washing solution to the magnetic beads that have been rinsed with the first washing solution. After thoroughly pipetting and resuspending the magnetic beads, place them on the magnetic stand again. After all the magnetic beads are adsorbed and the supernatant is clear, aspirate and discard all the supernatant. The volume range of the second washing solution is 400 - 900 μL. In some embodiments, the volume of the second washing solution is 750 μL.

[0089] 3. Add a certain volume of the second washing solution to the magnetic beads that have been rinsed with the second washing solution for the first time. After thoroughly pipetting and resuspending the magnetic beads, place them on the magnetic stand again. After all the magnetic beads are adsorbed and the supernatant is clear, aspirate and discard all the supernatant. The volume range of the second washing solution is 400 - 900 μL. In some embodiments, the volume of the second washing solution is 750 μL.

[0090] 4. Briefly centrifuge the above centrifuge tube, place it on the magnetic stand again, aspirate and discard the residual liquid at the bottom again, and then perform air drying to remove the residual ethanol.

[0091] It should be noted that the above impurity rinsing process is the rinsing process when all DNA / RNA needs to be recovered as the target. In some experiments, when it is necessary to remove DNA and only retain RNA during nucleic acid extraction, DNase digestion treatment can be interspersed in the washing step to wash away the DNA adsorbed on the surface of the magnetic beads, so as to only retain RNA. The relevant steps and content also belong to the substantial discoveries and contributions of this application. Specifically, when it is necessary to remove DNA and only retain RNA during the rinsing process, the operation process of rinsing impurities should be changed to:

[0092] 1. Add a certain volume of the first washing solution to the magnetic beads bound with nucleic acid. After thoroughly pipetting and resuspending the magnetic beads, place them on the magnetic stand again. After all the magnetic beads are adsorbed and the supernatant is clear, aspirate and discard all the supernatant. The volume range of the first washing solution is 400 μL - 900 μL. In some embodiments, the volume of the first washing solution is 750 μL.

[0093] 2. Add a certain volume of DNA digestion reaction solution to the magnetic beads that have completed the first washing and rinsing with miscellaneous liquid. After thoroughly pipetting and resuspending the magnetic beads, incubate them at a certain temperature for a certain period of time. Specifically, the main components of the above DNA digestion reaction solution include: DNase I and its corresponding reaction buffer, where the concentration range of DNase is 0.01 U / μL - 0.5 U / μL. In some embodiments, the concentration of the above DNase I is 0.1 U / μL. The above incubation temperature range is 15°C - 45°C. In some embodiments, the above incubation temperature is 37°C. The above incubation time range is 5 - 60 min. In some embodiments, the above incubation time is 15 min.

[0094] 3. After the incubation is completed, add a certain volume of binding solution to the centrifuge tube again. Specifically, the ratio range of the above supernatant to the binding solution is 1:0.8 - 1:3. In some embodiments, the ratio of the above supernatant to the binding solution is preferably 1:2. Place the centrifuge tube containing the binding solution on a vortex mixer and oscillate for a certain period of time to promote the adsorption of nucleic acids by the magnetic beads. Subsequently, briefly centrifuge the centrifuge tube and place it on a magnetic rack. After all the magnetic beads are adsorbed and the supernatant is clear, discard all the supernatant.

[0095] 4. Add a certain volume of the first washing and rinsing with miscellaneous liquid to the magnetic beads that have completed DNA digestion. After thoroughly pipetting and resuspending the magnetic beads, place them on the magnetic rack again. After all the magnetic beads are adsorbed and the supernatant is clear, discard all the supernatant. The volume range of the above first washing and rinsing with miscellaneous liquid is 400 μL - 900 μL. In some embodiments, the volume of the above first washing and rinsing with miscellaneous liquid is 750 μL.

[0096] 5. Add a certain volume of the second washing and rinsing with miscellaneous liquid to the magnetic beads that have completed the first washing and rinsing with miscellaneous liquid. After thoroughly pipetting and resuspending the magnetic beads, place them on the magnetic rack again. After all the magnetic beads are adsorbed and the supernatant is clear, discard all the supernatant. The volume range of the above second washing and rinsing with miscellaneous liquid is 400 μL - 900 μL. In some embodiments, the volume of the above second washing and rinsing with miscellaneous liquid is 750 μL.

[0097] 6. Add a certain volume of the second washing and rinsing with miscellaneous liquid to the magnetic beads that have completed the first and second washings and rinsings with miscellaneous liquid. After thoroughly pipetting and resuspending the magnetic beads, place them on the magnetic rack again. After all the magnetic beads are adsorbed and the supernatant is clear, discard all the supernatant. The volume range of the above second washing and rinsing with miscellaneous liquid is 400 μL - 900 μL. In some embodiments, the volume of the above second washing and rinsing with miscellaneous liquid is 750 μL.

[0098] 7. Briefly centrifuge the above centrifuge tube, place it on the magnetic rack again, and discard the residual liquid at the bottom again, then air dry to remove the residual ethanol.

[0099] Step 5: Nucleic acid elution (only an exemplary operation)

[0100] The purpose of nucleic acid elution is at least to finally use a buffer solution with low ionic strength to elute the nucleic acid adsorbed on the surface of the magnetic beads, so as to obtain a pure nucleic acid sample.

[0101] In some embodiments, the step of rinsing impurities includes:

[0102] Washing the magnetic beads combined with nucleic acid with a first impurity washing solution to remove impurities, obtaining the washed magnetic beads;

[0103] Adding DNase I and its corresponding reaction buffer solution to the washed magnetic beads to obtain a digestion reaction system, incubating to obtain digestion products;

[0104] Mixing the digestion products and the binding solution at a volume ratio of 1:0.8 - 1:3 to obtain DNA-digested magnetic beads;

[0105] Sequentially washing the DNA-digested magnetic beads with the first impurity washing solution and the second impurity washing solution.

[0106] Exemplarily, the operation of rinsing impurities includes:

[0107] 1. Adding a certain volume of elution solution to the magnetic beads that have completed impurity rinsing and drying. Specifically, the volume range of the above elution solution is 50 - 500 μL. In some embodiments, the volume of the above elution solution is 100 μL.

[0108] 2. Placing the centrifuge tube added with the elution solution at a certain temperature for heating incubation for a certain period of time. Specifically, the range of the above incubation temperature is 40 - 70°C. In some embodiments, the above incubation temperature is 60°C, and the range of the above incubation period is 2 - 15 min. In some embodiments, the above incubation period is 10 min.

[0109] 3. Placing the above centrifuge tube on a magnetic rack. After adsorption is completed, the supernatant is the obtained nucleic acid sample.

[0110] The third aspect of the embodiments of the present application provides a semi-automatic operation scheme based on the above method for efficiently extracting DNA / RNA from complex samples such as sewage, soil, feces, sediment, sludge, water body filter membranes, etc., specifically including a plate reagent distribution scheme and an automatic program operation scheme.

[0111] In some embodiments, an automatic nucleic acid extractor is used to extract DNA and / or RNA in complex samples, and each well in the deep well plate corresponds to a reaction unit.

[0112] In some embodiments, the heating module of the automated nucleic acid extractor is located in columns 1, 5, 7, and 11: the binding solution is dispensed into columns 1, 2, 7, and 8 of the deep well plate, the first washing solution is dispensed into columns 3 and 9 of the deep well plate, the second washing solution is dispensed into columns 4 and 10 of the deep well plate, the elution solution is dispensed into columns 5 and 11 of the deep well plate, and the magnetic beads are dispensed into columns 6 and 12 of the deep well plate. In some embodiments, its operating program is carried out with reference to Table 1.

[0113] When DNA needs to be digested and only RNA is retained, the operating program is carried out with reference to Table 2.

[0114] In some other embodiments, the heating module of the automated nucleic acid extractor is located in columns 1, 6, 7, and 12: the binding solution is dispensed into columns 1, 2, 7, and 8 of the deep well plate, the first washing solution is dispensed into columns 3 and 9 of the deep well plate, the second washing solution is dispensed into columns 4 and 10 of the deep well plate, the magnetic beads are dispensed into columns 5 and 11 of the deep well plate, and the elution solution is dispensed into columns 6 and 12 of the deep well plate.

[0115] Specifically:

[0116] For the plate reagent dispensing scheme, taking the common 2.2 mL 96-well deep well plate on the market as an example, since the total volume after mechanical force grinding and lysis and removal of the shielding agent is relatively large, to ensure sufficient binding volume, a certain volume of binding solution is evenly dispensed into the 1st, 2nd, 7th, and 8th columns of the deep well plate, so as to distribute the binding volume into two wells, thus enabling operation in a conventional 96-well deep well plate. Specifically, the volume range of the above-mentioned binding solution is 400-700 μL. In some embodiments, the volume of the binding solution dispensed into the 1st, 2nd, 7th, and 8th columns of the deep well plate is 550 μL. Further, a certain volume of the first washing solution is dispensed into the 3rd and 9th columns of the deep well plate. Specifically, the volume range of the above-mentioned first washing solution is 400-900 μL. In some embodiments, the volume of the first washing solution dispensed into the 3rd and 9th columns of the deep well plate is 750 μL. Further, a certain volume of the second washing solution is dispensed into the 4th and 10th columns of the deep well plate. Specifically, the volume range of the above-mentioned second washing solution is 400-900 μL. In some embodiments, the volume of the second washing solution dispensed into the 4th and 10th columns of the deep well plate is 750 μL. Further, a certain volume of the second washing solution and a certain volume of magnetic beads are dispensed into the 6th and 12th columns of the deep well plate. Specifically, the volume range of the above-mentioned second washing solution is 400-900 μL. In some embodiments, the volume of the second washing solution dispensed into the 4th and 10th columns of the deep well plate is 750 μL, and the volume range of the above-mentioned magnetic beads is 10-50 μL. In some embodiments, the volume of the second washing solution dispensed into the 4th and 10th columns of the deep well plate is 30 μL. Further, a certain volume of eluent is dispensed into the 5th and 11th columns of the deep well plate. Specifically, the volume range of the above-mentioned eluent is 50-200 μL. In some embodiments, the volume of the eluent is 100 μL. Particularly, since the heating module of the conventional automated nucleic acid extractor on the market is generally located in the 1st, 5th, 7th, 11th or 1st, 6th, 7th, 12th columns, the above-mentioned dispensing scheme is distributed according to the heating module in the 1st, 5th, 7th, 11th columns. If a nucleic acid extractor with a heating module in the 1st, 6th, 7th, 12th columns is used, the eluent in the 5th and 11th columns should be swapped with the second washing solution and magnetic beads in the 6th and 12th columns, and their dispensing volumes remain unchanged. The adjustment of the plate splitting method caused by different configurations of the nucleic acid extractor belongs to the adjustment that can be made by those skilled in the art without creative labor, and thus also falls within the protection scope of this application.

[0117] For the automated operation plan, since other instruments such as grinders and centrifuges are required for mechanical force grinding lysis and precipitant precipitation, the above two steps still remain manual operations and are not included in the scope of automated operation. The steps covered by the automated operation include nucleic acid binding, impurity rinsing, and nucleic acid elution. Specifically, on the premise of not performing DNase treatment and recovering all DNA and RNA, the parameter characteristics of the above automated operation are shown in Table 2. Specifically, after the manual completion of the mechanical force grinding lysis and precipitant precipitation operations, the supernatant after precipitant precipitation is evenly distributed into the sample wells corresponding to columns 1, 2 or columns 7, 8, and then placed in an automated nucleic acid extractor to run the corresponding program. Further, in the corresponding program, the automated nucleic acid extractor first moves the magnetic beads stored in columns 6 and 12 to columns 1 and 7 to start the first part of DNA / RNA binding, and then continues to transfer to columns 2 and 8 to complete the second part of DNA / RNA binding, so as to adsorb the nucleic acids in all samples. In the subsequent program, the magnetic beads complete the washing of impurities with 1 time of the first wash solution and 2 times of the second wash solution in wells 3 / 9, 6 / 12, and 4 / 10 in sequence, and finally elute the RNA in the eluents in columns 5 and 11. For the automated operation program, its characteristics are as shown in Table 1 or Table 2.

[0118] Table 1 Operation Program for Not Digesting DNA and Retaining All DNA / RNA

[0119]

[0120] Table 2 Operation Program for Digesting DNA and Only Retaining RNA

[0121]

[0122] For the case where DNase treatment is required to recover RNA, the above-mentioned automated operation program needs to be improved as follows. Firstly, operations such as transferring magnetic beads, binding 1, binding 2, and rinsing 1 in Table 2 still need to be retained. However, after rinsing 1, magnetic attraction is not performed, and the magnetic beads are retained in columns 3 and 9. Subsequently, the first pause program is inserted. At this time, the plate reagent is taken out, and the remaining binding solution in columns 1, 2, 7, and 8 is aspirated with a pipette, and rinsed once with nuclease-free water to remove residual guanidine salts and organic solvents. Subsequently, a certain volume (50 μL in some embodiments) of DNase digestion solution is added to columns 1 and 7, and a certain volume (750 μL in some embodiments) of the first rinsing solution is added to columns 2 and 8. Then it is put back for extraction and continues to run. In the subsequent program, the magnetic beads will be moved from columns 3 and 9 to the DNase digestion solution in columns 1 and 8, and DNA digestion will be completed at a certain temperature (42°C in some embodiments). Subsequently, the second pause program is inserted. At this time, the plate reagent is taken out, and a certain volume of binding solution (550 μL in some embodiments) is added to columns 1 and 7 again to inactivate the DNase and recreate the binding environment. Then it is put back for extraction and continues to run. In the subsequent program, the magnetic beads will adsorb RNA again, and wash impurities with the first rinsing solution once and the second rinsing solution twice in wells 2 / 8, 6 / 12, and 4 / 10 in sequence, and finally elute the RNA in the elution solution in columns 5 and 11.

[0123] Some embodiments are provided below.

[0124] The embodiments of the present application will be described in detail below in conjunction with the embodiments. It should be understood that these embodiments are only used to illustrate the present application and not to limit the scope of the present application. For the experimental methods without specified conditions in the following embodiments, the guidance given in the present application is preferably referred to, and it can also be carried out according to the experimental manuals or conventional conditions in the art, or according to the conditions recommended by the manufacturer, or referring to the experimental methods known in the art.

[0125] In the following specific embodiments, for the measurement parameters of the raw material components, if there is no special description, there may be slight deviations within the weighing accuracy range. For the temperature and time parameters, acceptable deviations caused by instrument test accuracy or operation accuracy are allowed.

[0126] In Examples 1 to 17, unless otherwise specified, the grinding medium used was 0.1 mm acid-washed glass beads pre-packaged in 2 mL screw-cap centrifuge tubes, with a mass of 0.7 ± 0.1 g. The specific components of the lysis buffer used were: 3 mol / L guanidine isothiocyanate, 1.5 mol / L sodium chloride, 1 mol / L ammonium acetate, 80 mmol / L disodium hydrogen phosphate, 20 mmol / L sodium dihydrogen phosphate, and 0.2% SDS. The specific components of the precipitation solution used were 50 mmol / L potassium alum dodecahydrate. The binding buffer used was 3 mol / L guanidine isothiocyanate, 50 mmol / L tris(hydroxymethyl)aminomethane, 50 mmol / L ethylenediaminetetraacetic acid, 25% (w / w) isopropanol, and 2% Tween-20. The magnetic beads used were hydroxyl-modified magnetic beads with a mass concentration of 10 mg / mL. The first washing solution used was 2 mol / L guanidine hydrochloride, 50 mmol / L tris(hydroxymethyl)aminomethane, 50 mmol / L hydrochloric acid, 40% (w / w) ethanol, and 2% Tween-20. The second washing solution used was 10 mmol / L tris(hydroxymethyl)aminomethane, 10 mmol / L hydrochloric acid, and 80% (w / w) ethanol. The elution buffer used was 10 mmol / L tris(hydroxymethyl)aminomethane, 10 mmol / L hydrochloric acid, 0.1 mmol / L ethylenediaminetetraacetic acid, and 0.05% Tween-20. The above chemical reagents were all analytical grade or molecular biology grade reagents, purchased from Shanghai Macklin Biochemical Co., Ltd., and prepared with nuclease-free water. The hydroxyl magnetic beads were purchased from Beijing TianGen Biochemical Technology Co., Ltd.

[0127] In Examples 1 to 17, unless otherwise specified, the grinding and homogenizing instrument used was the TGrinder H24 tissue grinder produced by Beijing TianGen Biochemical Technology Co., Ltd. or the FastPrep-24 5G rapid sample preparation instrument produced by MP Biomedicals. Unless otherwise specified, the working parameters of the grinding and homogenizing instrument were: grinding linear velocity 6 m / s, grinding duration 1 min, and the number of cycles 1. The vortex mixer used was the Vortex Genie® 2 produced by Qiagen / MO-BIO. Unless otherwise specified, the working parameters of the vortex mixer were: vortex at maximum speed, and the vortex duration was 10 min. The centrifuge used was the 5427R tabletop high-speed refrigerated centrifuge produced by Eppendorf AG, Germany. Unless otherwise specified, the centrifugation conditions were normal temperature centrifugation, relative centrifugal force 10000×g, and the centrifugation duration was 1 min. The automated nucleic acid extractor used was the TGuide S16 fully automated nucleic acid extraction and purification instrument produced by Beijing TianGen Biochemical Technology Co., Ltd.

[0128] In Examples 1 to 17, unless otherwise specified, during the nucleic acid extraction process, the sample input amount is 200 μL or 200 mg, the amount of lysis buffer used is 500 μL, the amount of precipitation buffer used is 100 μL, the amount of binding buffer used is 1100 μL, the amount of magnetic beads used is 30 μL (30 μg), the amount of the first washing buffer used is 750 μL, the number of washing times is 1, the amount of the second washing buffer used is 750 μL, the number of washing times is 2, and the amount of elution buffer used is 100 μL.

[0129] In Examples 1 to 17, unless otherwise specified, the nucleic acid extraction process using the nucleic acid extraction kit mentioned in this application is as follows: 1) Take 200 μL or 200 mg of the sample, mix it with 500 μL of lysis buffer, and perform mechanical grinding treatment using a grinding homogenizer or a vortex mixer, and then centrifuge at 10000×g for 1 min; 2) Take all the supernatant after centrifugation, add 100 μL of precipitation buffer, shake at room temperature for 1 min and then centrifuge at 10000×g for 1 min again; 3) Take the supernatant after centrifugation, mix it with 1100 μL of binding buffer and 30 μL of 10 mg / mL magnetic beads, shake well for 10 min and then place it on a magnetic stand. After all the magnetic beads are adsorbed, discard all the supernatant; 4) Add 750 μL of the first washing buffer, shake well for 2 min and then place it on a magnetic stand. After all the magnetic beads are adsorbed, discard all the supernatant; 5) Add 750 μL of the second washing buffer, shake well for 2 min and then place it on a magnetic stand. After all the magnetic beads are adsorbed, discard all the supernatant; 6) Add 750 μL of the second washing buffer again, shake well for 2 min and then place it on a magnetic stand. After all the magnetic beads are adsorbed, discard all the supernatant; 7) Air dry for 5 min; 8) Add 100 μL of elution buffer, shake well and incubate at 60°C for 10 min, then place it on a magnetic stand again. After all the magnetic beads are adsorbed, aspirate the nucleic acid.

[0130] In Example 1, Value 17, the one-step reverse transcription real-time fluorescence quantitative kit for amplifying and detecting the concentration of target DNA / RNA sequences in a sample is the Hieff Unicon® V Universal Multiplex One Step RT-qPCR Probe Kit, purchased from Yeasen Biotechnology Co., Ltd. The forward primer for detecting Porcine Epidemic Diarrhea Virus is (SEQ ID No.1): CCGTGGTGAGCGAATTGAA, the reverse primer is (SEQ ID No.2): GGTCCTGTTCCGAGGTATAGAA, and the probe is (SEQ ID No.3): AACCTTCCAATTGGC. The 5' end of the probe is modified with the fluorescent reporter group FAM, and the 3' end is modified with the fluorescent quenching group MGB. The forward primer for detecting Norovirus GII is (SEQ ID No.4): CARGARBCNATGTTYAGRTGGATGAG, the reverse primer is (SEQ ID No.5): TCGACGCCATCTTCATTCACA, and the probe is (SEQ ID No.6): TGGGAGGGCGATCGCAATCT. The 5' end of the probe is modified with the fluorescent reporter group ROX, and the 3' end is modified with the fluorescent quenching group BHQ2. The forward primer for detecting Polyomavirus is (SEQ ID No.7): AGTCTTTAGGGTCTTCTACCTTT, the reverse primer is (SEQ ID No.8): GGTGCCAACCTATGGAACAG, and the probe is (SEQ ID No.9): TCATCACTGGCAAACAT. The 5' end of the probe is modified with the fluorescent reporter group ROX, and the 3' end is modified with the fluorescent quenching group MGB. The synthetic RNA fragment for detecting the presence of reverse transcription and PCR inhibition is (SEQ ID No.10): ATGTTCAAGCTGTTAATATCAATCTCGATAAA CGTGAACAGGCTGTCGGAGCCACAGTTTCGAGACGAGGAGATTTAGAAATGTTGGGATTATTGCATGATAGAATGGTTCAGTGGCAAA. The forward primer for detecting the above synthetic RNA fragment is (SEQ ID No.11): ATGTTCAAGCTGTTAATATCAATCTCG, the reverse primer is (SEQ ID No.12): TTTGCCACTGAACCATTCTATCAT, and the probe is (SEQ ID No.13): CTGTCGGAGCCACAGTTTCGAGACG. The 5' end of the probe is modified with the fluorescent reporter group FAM, and the 3' end is modified with the fluorescent quenching group BHQ1.

[0131] In Examples 1 to 17, the real-time fluorescence quantitative PCR procedures for amplifying and detecting target DNA / RNA sequences in samples are shown in Table 3.

[0132] Table 3 Real-time fluorescence quantitative PCR reaction procedures

[0133]

[0134] To ensure biosafety, all experiments involving the extraction and detection of virus-containing samples in Examples 1 to 17 were carried out in a Biosafety Level 2 laboratory.

[0135] Example 1: Comparison of the lysis effects of mechanical force grinding lysis method and enzymatic lysis method for complex samples

[0136] To verify whether the mechanical force grinding lysis method selected in the present invention is the optimal lysis and nucleic acid release method for complex samples including sewage, soil, feces, sediment, sludge, water body filter membrane, etc. Direct thermal lysis and protease enzymatic lysis were respectively selected as comparative examples. Nucleic acids were extracted from enriched sewage samples, and the lysis effects of the three lysis methods were compared by detecting the CT values of spiked viruses.

[0137] The specific experimental steps include:

[0138] 1. Sample collection and enrichment: The raw sewage sample to be tested was taken from a large-scale reclaimed water plant in Beijing. After 100 mL of the water sample was inactivated of potential pathogenic microorganisms by pasteurization, it was enriched to 1 mL by the ultrafiltration method.

[0139] 2. Sample lysis: Take 200 μL of the enriched sewage sample, mix it with 500 μL of the lysis buffer, and then use thermal lysis method (placed in a metal bath, heated at 95 °C for 10 min), protease K digestion method (add protease K to a final concentration of 500 mg / mL, heated at 65 °C for 10 min) and mechanical force grinding lysis method (place the sample and the lysis buffer in a grinding medium, grind and homogenize at 6 m / s on a grinder for 1 min). Each of the three methods was set with 3 technical replicates.

[0140] 3. Nucleic acid recovery and detection: After the treatment is completed, centrifuge at 10,000×g for 1 min to remove large particle impurities. Then, take 100 μL of the supernatant, use 1.8×RNA purification and recovery magnetic beads to purify and recover the RNA fragments released by lysis, and elute with nuclease-free water to 40 μL. Use the Qubit RNA HS assay kit to detect the RNA concentration to judge the nucleic acid release effects of the three methods. The RNA concentrations under the three different lysis methods are shown in Table 4 (the RNA concentration is shown in the form of mean ± SD). It can be seen that the RNA concentration obtained by mechanical grinding lysis is the highest, while the concentrations obtained by thermal lysis and proteinase K digestion are both lower. Therefore, it is optimal to choose mechanical lysis as the lysis method for complex samples including sewage, soil, feces, sediment, sludge, water body filter membrane, etc.

[0141] Table 4 Comparison of nucleic acid release effects of samples using different lysis methods

[0142]

[0143] Example 2: Comparison of lysis effects of different grinding media on complex samples

[0144] For the mechanical grinding lysis method, the material of the grinding medium has an important impact on the lysis effect. Therefore, to select a better grinding material, 0.1 mm, 0.5 mm, 1 mm acid-washed glass beads and 1 mm zircon beads are respectively selected as the grinding materials, and their nucleic acid extraction effects are compared to select a better grinding material.

[0145] The specific experimental steps are as follows:

[0146] 1. Sample collection and enrichment: The raw sewage sample to be tested is taken from a large-scale reclaimed water plant in Beijing. After 100 mL of the water sample is inactivated of potential pathogenic microorganisms by pasteurization, porcine epidemic diarrhea virus is added to a final concentration of 50,000 copies / mL, and it is enriched to 1 mL by ultrafiltration.

[0147] 2. Sample lysis: Take 200 μL of the enriched sewage sample, mix it with 500 μL of the lysis buffer and place it in a 2 mL screw-cap centrifuge tube that can stand upright. Respectively add 0.7 g of 0.1 mm, 0.5 mm, 1 mm acid-washed glass beads and 1 mm zircon beads as the grinding materials, and then use a grinding homogenizer for grinding treatment. Each condition is set with 3 technical replicates.

[0148] 3. Nucleic acid extraction and recovery: After the grinding is completed, centrifuge at 10,000×g for 1 min to remove large particulate impurities, then take 200 μL of the supernatant and use the MagMAX Viral / Pathogen Nucleic Acid Isolation Kit produced by Thermo Fisher to extract and recover nucleic acids.

[0149] 4. Sample detection: Use one-step reverse transcription real-time fluorescence quantitative PCR to detect the CT value of the spiked PEDV. The results are shown in Table 5 (the CT values are presented in the form of mean ± SD). The results indicate that using 0.1 mm acid-washed glass beads as the grinding material for mechanical lysis has a better effect. Therefore, 0.1 mm glass beads are selected as the grinding material pre-packaged in screw-cap centrifuge tubes in the grinding medium.

[0150] Table 5 Comparison of the effects of mechanical grinding lysis using different grinding materials

[0151]

[0152] Example 3: Comparing the effects of chaotropic salt concentrations in different lysis buffers on nucleic acid extraction from complex samples

[0153] For complex samples such as sewage, soil, feces, sediment, sludge, and water filtration membranes, which contain a large amount of impurities and nucleases, and mechanical lysis can only disrupt the higher-order structure of the samples but cannot inactivate nucleases. To ensure the inactivation effect of nucleases, the chaotropic salt concentration in the lysis buffer is optimized to obtain a lysis system with the best nuclease inactivation effect.

[0154] The specific experimental steps include:

[0155] 1. Sample collection and enrichment: The original sewage sample to be tested is taken from a large-scale reclaimed water plant in Beijing. After 100 mL of the water sample is pasteurized to inactivate potential pathogenic microorganisms, porcine epidemic diarrhea virus is added to a final concentration of 500 copies / mL and enriched to 1 mL using the ultrafiltration method.

[0156] 2. Preparation of lysis buffers: Prepare lysis buffers with guanidine isothiocyanate concentrations of 1 mol / L, 2 mol / L, and 3 mol / L, respectively, while keeping the concentrations of the other components unchanged.

[0157] 3. Nucleic acid extraction: Except for using lysis buffers with different compositions, all other operating conditions remain unchanged, and 3 technical replicates are set for each lysis buffer condition.

[0158] 4. Sample detection: The CT values of the spiked PEDV were detected using one-step reverse transcription real-time fluorescence quantitative PCR. The results are shown in Figure 6 (the CT values are presented in the form of mean ± SD). The results indicate that as the concentration of guanidine isothiocyanate increases, the CT values of the samples to be detected finally show a gradually decreasing trend, indicating that a high concentration of guanidine isothiocyanate is more conducive to sample lysis and inactivation of nucleases. Therefore, 3 mol / L was selected as the optimal concentration of guanidine isothiocyanate in the lysis solution.

[0159] Table 6 Comparison of the effects of mechanical lysis with different chaotropic salt concentrations in the lysis solution

[0160]

[0161] Example 4: Comparison of the extraction effects of adding regulated chemical reagents to the optimized lysis solution

[0162] For nucleic acid extraction kits commonly available on the market for complex samples such as sewage, soil, feces, sediment, sludge, water body filters, etc., they often add chemical reagents such as β-mercaptoethanol, phenol:chloroform:isoamyl alcohol = 25:24:1 during lysis to enhance the lysis effect. However, since these reagents are highly toxic or regulated chemicals, they may affect the health of operators, and at the same time, it is difficult for a large number of experimental personnel to purchase and obtain them. Therefore, to verify whether the lysis solution prepared in this application needs to add the above chemicals, nucleic acid extraction was carried out respectively on the premise of adding and not adding the above hazardous chemicals to verify the relevant extraction effects.

[0163] The specific experimental steps are as follows:

[0164] 1. Sample collection and enrichment: The raw sewage sample to be tested was taken from a large-scale reclaimed water plant in Beijing. After 100 mL of the water sample was pasteurized to inactivate potential pathogenic microorganisms, porcine epidemic diarrhea virus was added to a final concentration of 500 copies / mL and enriched to 1 mL using the ultrafiltration method.

[0165] 2. Nucleic acid extraction: After mixing 200 μL of the sample with 500 μL of the lysis solution, β-mercaptoethanol was added to a final concentration of 1% (w / w) and β-mercaptoethanol, phenol:chloroform:isoamyl alcohol = 25:24:1 was added to a final concentration of 20% (w / w). In addition, a sample that did not add other chemicals but only added the lysis solution was set as a control. Three technical replicates were set for each condition, and the remaining conditions remained unchanged.

[0166] 3. Sample detection: The CT values of the spiked PEDV were detected using one-step reverse transcription real-time fluorescence quantitative PCR. The results are shown in Table 7 (the CT values are presented in the form of mean ± SD). It can be seen that whether the above-mentioned hazardous chemicals or controlled reagents are added or not, there is little impact on the CT of the spiked virus in the extracted nucleic acid. Therefore, the lysis solution and lysis system involved in this application can achieve efficient lysis of complex samples such as sewage, soil, feces, sediment, sludge, and water body filter membranes without adding other hazardous chemicals or chemicals of concern, which can greatly expand the scope of application of the kit and protect the health of operators.

[0167] Table 7 Influence of adding other chemical reagents on extraction effect

[0168]

[0169] Example 5: Comparison of the lysis effects of different mechanical force grinding methods on complex samples

[0170] Currently, the common mechanical force grinding and lysis methods on the market mainly include two types: using a high-speed grinding homogenizer for lysis and using a vortex mixer for lysis. To verify whether the lysis system involved in this application is compatible with both lysis methods and the results of the two lysis methods are consistent, the same sample was used and tested using different mechanical force lysis methods.

[0171] The specific experimental steps are as follows:

[0172] 1. Sample collection and enrichment: The raw sewage sample to be tested was taken from a large-scale reclaimed water plant in Beijing. After 100 mL of the water sample was inactivated of potential pathogenic microorganisms by pasteurization, porcine epidemic diarrhea virus was added to a final concentration of 500 copies / mL and enriched to 1 mL using the ultrafiltration method.

[0173] 2. Nucleic acid extraction: After mixing 200 μL of the sample with 500 μL of the lysis solution and transferring it into the lysis medium, it was ground and homogenized using a grinding homogenizer at a linear velocity of 6 m / s for 1 min and using a vortex mixer at the highest speed for 10 min respectively. Three technical replicates were set for each condition, and the remaining conditions remained unchanged.

[0174] 3. Sample detection: The CT values of the spiked PEDV were detected using one-step reverse transcription real-time fluorescence quantitative PCR. The results are shown in Table 8 (the CT values are presented in the form of mean ± SD). It can be seen that whether using a grinding homogenizer or a vortex mixer, under the above mechanical force breaking conditions, the CT values of the spiked virus in the finally extracted nucleic acid are basically the same, indicating that the lysis system involved in this application has a certain consistency in the results of the two lysis methods of the grinding homogenizer and the vortex mixer and can be compatible with two different mechanical force lysis modes.

[0175] Table 8 Influence of Different Mechanical Force Lysis Modes on Extraction Effect

[0176]

[0177] Example 6: Comparison of the Influence of Different Mechanical Force Lysis Intensities on the Integrity of Extracted Nucleic Acids

[0178] In practical applications, after nucleic acid extraction from complex samples including sewage, soil, feces, sediment, sludge, water body filter membranes, etc., there are many types of downstream experiments that may be carried out, which may include experiments with high requirements for the integrity of DNA or RNA such as third-generation sequencing or long-fragment PCR. In this case, it is necessary to balance the influence of the mechanical force action time on the integrity of DNA and RNA. To evaluate this influence, the operating parameters of two mechanical force grinding methods, namely the grinding homogenizer and the vortex mixer, are optimized respectively to ensure relevant solutions for maintaining the integrity of DNA and RNA under certain requirements.

[0179] The specific experimental steps are as follows:

[0180] 1. Sample collection and enrichment: The raw sewage sample to be tested was taken from a large-scale reclaimed water plant in Beijing. After 100 mL of the water sample was pasteurized to inactivate potential pathogenic microorganisms, it was enriched to 1 mL using the ultrafiltration method.

[0181] 2. Nucleic acid extraction: After mixing 200 μL of the sample with 500 μL of the lysis buffer and transferring it into the lysis medium, the sample was ground and homogenized using a grinding homogenizer at a linear velocity of 6 m / s for 1 min or homogenized at a linear velocity of 4 m / s for 15 s and repeated for 2 cycles, and using a vortex mixer at the highest speed for 5 min and 10 min, with the remaining conditions remaining unchanged.

[0182] 3. Sample digestion: For the extracted nucleic acids, RNA was digested with RNase A and DNA was digested with DNase I, and then DNA or RNA was recovered and purified using DNA or RNA recovery purification magnetic beads.

[0183] 4. The DIN value and RIN value of the recovered DNA and RNA were measured using an Agilent 4200 capillary electrophoresis analyzer. The results are shown in Table 9. It can be seen that generally, different mechanical force lysis methods have little effect on the RIN value (i.e., RIN integrity), but have a relatively greater impact on DNA integrity. Among them, the DNA integrity is better when using a vortex mixer for mechanical force lysis than when using a grinding homogenizer. Based on the above results, it is recommended that when the downstream experiment of nucleic acid extraction has high requirements for DNA integrity, a vortex mixer can be used for mechanical force lysis, or for samples with overly complex higher-order structures, the parameters of the grinding homogenizer can be changed to homogenize at a linear velocity of 4 m / s for 15 s and repeat 2 cycles.

[0184] Table 9 Effects of different mechanical forces on the integrity of DNA and RNA

[0185]

[0186] Example 7: Comparison of the effects of the concentration of solubilizer in different lysis buffers on the ability of the precipitation solution to retain RNA

[0187] Since the aluminum hydroxide colloid formed during the precipitation process will non-differentially adsorb negatively charged biological macromolecules in the solution, especially RNA molecules, in order to ensure the removal of PCR inhibitors by adding the precipitation solution while minimizing the loss of DNA and RNA molecules as much as possible, a solubilizer needs to be added to the lysis buffer to enhance the hydrophilicity of DNA and RNA molecules, thereby increasing the nucleic acid yield. Therefore, it is necessary to optimize whether to add a solubilizer and the type of solubilizer.

[0188] The specific experimental steps are as follows:

[0189] 1. Preparation of lysis buffer: Lysis buffers with final ammonium acetate concentrations of 0 mol / L, 0.2 mol / L, and 0.5 mol / L were prepared respectively, while the concentrations of the other components remained unchanged.

[0190] 2. Simulated precipitation experiment: Yeast RNA and herring sperm DNA were added to the lysis buffer to final concentrations of 20 ng / μL and 10 ng / μL respectively, and 200 μL of nuclease-free water was added instead of the sample. Subsequently, 100 μL of precipitation solution was added, and after thorough mixing, centrifugation was performed. Three technical replicates were set for each condition.

[0191] 3. Sample Monitoring: Take the supernatant after centrifugation and use the Qubit dsDNA HS assay kit and Qubit RNA HS assay kit to detect the concentrations of DNA and RNA in the supernatant after precipitation, and calculate the proportions of DNA and RNA still suspended in the supernatant after precipitation. The results are shown in Table 10 (the proportions are presented in the form of mean ± SD). It can be seen that when no solubilizer is added, nearly 80% of the DNA and almost 100% of the RNA will be precipitated after adding the precipitation solution. Therefore, a solubilizer must be added to ensure the removal of PCR inhibitors while retaining nucleic acids. As the concentration of the solubilizer increases, when the ammonium acetate concentration rises to 0.5 mol / L, the proportions of DNA and RNA in the supernatant can both reach over 70%. Therefore, 0.5 mol / L is selected as the optimal final concentration of ammonium acetate.

[0192] Table 10 Proportions of Nucleic Acids in the Supernatant after Precipitation at Different Solubilizer Concentrations

[0193]

[0194] Example 8: Comparison of the Effects of Different Elution Buffers on Nucleic Acid Extraction

[0195] Since when performing nucleic acid elution, the effects of pH value, ionic strength, and trace surfactants need to be comprehensively considered to ensure the effective elution of nucleic acids from the surface of magnetic beads and provide a certain role in inhibiting nucleases, different nucleic acid elution buffers were optimized to determine the optimal type of nucleic acid elution buffer.

[0196] The specific experimental steps are as follows:

[0197] 1. Sample Collection and Enrichment: The raw sewage sample to be tested was taken from a large-scale reclaimed water plant in Beijing. After 100 mL of the water sample was pasteurized to inactivate potential pathogenic microorganisms, it was enriched to 1 mL using the ultrafiltration method.

[0198] 2. Preparation of eluents: Use nuclease-free water to prepare 7 eluents, namely 10 mmol / L Tris-HCl (eluent A), 10 mmol / L Tris-HCl + 0.05% Tween-20 (eluent B), 10 mmol / L Tris-HCl + 1 mmol / L EDTA (eluent C), 10 mmol / L Tris-HCl + 1 mmol / L EDTA + 0.05% Tween-20 (eluent E), 10 mmol / L Tris-HCl + 0.1 mmol / L EDTA (eluent F), 10 mmol / L Tris-HCl + 0.1 mmol / L EDTA + 0.05% Tween-20 solution (eluent G), and use nuclease-free water as a control (eluent CK). Adjust the pH value of each solution within the range of 8.0 ± 0.2.

[0199] 3. Nucleic acid extraction: Perform nucleic acid extraction according to the conventional procedure. After the magnetic beads are dried, add 6 different eluents or nuclease-free water to the magnetic beads to elute nucleic acids, and set 3 technical replicates for each different condition.

[0200] 4. Use the Qubit dsDNA HS assay kit to measure the DNA concentration in different eluents. The results are shown in Table 11 (the concentration is shown in the form of mean ± SD). Generally speaking, the DNA concentration eluted by each eluent is higher than that of nuclease-free water, indicating that a weakly alkaline pH value is beneficial to the elution of nucleic acids. At the same time, the elution effect of the eluent containing Tween-20 is slightly improved compared with the eluent without Tween-20, but the influence of the presence or absence of EDTA on the elution effect is not obvious. Considering that EDTA has a certain protective effect on the long-term preservation of nucleic acids, but high concentrations of EDTA may inhibit some downstream reactions, therefore, considering the comprehensive effects of various aspects, 10 mmol / L Tris-HCl + 0.1 mmol / L EDTA + 0.05% Tween-20 solution is selected as the preferred eluent for the kit in this application.

[0201] Table 11 Nucleic acid concentration eluted by different eluents

[0202]

[0203] Example 9: Verify the RT-qPCR inhibition of the sample obtained by the optimized extraction method

[0204] Due to the large amount of inhibitors contained in complex samples including sewage, soil, feces, sediment, sludge, water body filter membranes, etc., it may interfere with downstream reverse transcription and PCR reactions. To verify whether the nucleic acid extraction kit and the corresponding nucleic acid extraction method involved in this application can effectively remove various inhibitors in complex samples, artificial synthetic non-natural RNA fragments were spiked to verify whether the extracted nucleic acid samples have RT-qPCR inhibition.

[0205] The specific experimental steps are as follows:

[0206] 1. Sample collection and enrichment: The raw sewage sample to be tested was taken from a large-scale reclaimed water plant in Beijing. After 100 mL of the water sample was pasteurized to inactivate potential pathogenic microorganisms, it was enriched to 1 mL using the ultrafiltration method.

[0207] 2. Nucleic acid extraction: Nucleic acid extraction was carried out according to the conventional procedure.

[0208] 3. Exogenous artificial fragment spiking and detection. An artificial non-natural RNA fragment (SEQ ID No.10) synthesized entirely by chemistry was used as the exogenous spiking fragment. Specifically, 40,000 copies of this fragment were added to 20 μL of the extracted nucleic acid sample and 20 μL of the nucleic acid eluate respectively. The CT values of this artificial exogenous non-natural sequence were detected by one-step reverse transcription real-time fluorescence quantitative PCR, and 6 technical replicates were set for each detection. The CT values of the spiked exogenous RNA fragments are shown in Table 12 (the CT values are shown in the form of mean ± SD). It can be seen that the CT values of the exogenous spiking sequences with the same copy number are basically exactly the same in the extracted nucleic acid sample and the blank eluate, indicating that the nucleic acid sample extracted according to the nucleic acid extraction kit and the corresponding nucleic acid extraction method involved in this application contains almost no RT-qPCR inhibitors, that is, it will not cause serious reverse transcription or PCR amplification inhibition.

[0209] Table 12 RT-qPCR inhibition of the samples extracted by the optimized extraction method

[0210]

[0211] Example 10: Comparing the effects of the nucleic acid extraction method proposed in this application with other domestic and foreign commercial kits for extracting complex samples

[0212] To determine the improvement in the effect of the nucleic acid extraction kit and the corresponding nucleic acid extraction method involved in this application compared with the existing products on the current market, 3 clinical nucleic acid sample extraction kits and another two nucleic acid extraction kits for complex environmental samples were selected for comparison to verify the advancement of the nucleic acid extraction kit involved in this application.

[0213] The specific experimental steps are as follows:

[0214] 1. Sample collection and enrichment: The raw sewage samples to be tested were taken from a large reclaimed water plant in Beijing. After 100 mL of the water sample was pasteurized to inactivate potential pathogenic microorganisms, porcine epidemic diarrhea virus was added to a final concentration of 500 copies / mL and enriched to 1 mL using ultrafiltration.

[0215] 2. Nucleic acid extraction: The nucleic acid extraction kits involved in this application perform nucleic acid extraction according to conventional procedures. Three clinical sample nucleic acid extraction kits and two environmental sample nucleic acid extraction kits are additionally selected for comparison. The sample extraction volume of each kit is 200 μL and the elution volume is 100 μL. The extraction process of other kits is carried out with reference to the instructions of the corresponding kits.

[0216] 3. Sample testing: One-step reverse transcription real-time fluorescence quantitative PCR was used to detect the CT value of spiked PEDV, and the CT value of endogenous Norovirus GII and polyomavirus in sewage was also detected. The results are shown in the attached Figure 1 As shown in the attached figure, it can be seen that when the same sample is extracted again, the CT values ​​of the three viruses extracted by the kit involved in the present application are the lowest, indicating that the kit involved in the present application is more advanced than existing market products in terms of the effect of extracting complex samples.

[0217] Example 11: Verification of the effect of optimization and improvement for samples with high complexity and low nucleic acid content

[0218] Since complex samples including sewage, soil, feces, sediment, sludge, water filter membrane, etc. have great diversity, some samples have high inhibitor content but low nucleic acid content. For such samples, it is necessary to add a certain type and concentration of nucleic acid precipitation aid to the lysate according to the purpose of downstream experiments to ensure the extraction effect. Therefore, whether to add nucleic acid precipitation aid and the effect of adding are verified.

[0219] The specific experimental steps include:

[0220] 1. Sample collection and enrichment: The reclaimed water (effluent from a sewage treatment plant) to be tested was taken from a large reclaimed water plant in Beijing. After 1000 mL of the water sample was pasteurized to inactivate potential pathogenic microorganisms, porcine epidemic diarrhea virus was added to a final concentration of 5 copies / mL and enriched to 0.5 mL using the ferric chloride flocculation method.

[0221] 2. Nucleic acid extraction: After mixing 200 μL of the sample with 500 μL of the lysis solution, transfer it into the lysis medium. Add 2 μg of capture RNA (PolyA) and 10 μg of yeast tRNA respectively. Set up a sample without adding any additional precipitant as a control, and set 3 technical replicates for each condition. The remaining operations are carried out according to the conventional procedure for nucleic acid extraction. In addition, yeast tRNA is added to the eluate of the group with 10 μg of yeast tRNA added to 20 ng / μL.

[0222] 3. Sample detection: Use one-step reverse transcription real-time fluorescence quantitative PCR to detect the CT value of the spiked PEDV. The results are shown in Table 13 (the CT values are shown in the form of mean ± SD). It can be seen that for samples with high inhibitor content and low nucleic acid content such as enriched reclaimed water, if no additional precipitant is added, a large amount of nucleic acid will be non-specifically adsorbed during grinding and precipitation, thus interfering with the nucleic acid recovery effect. Adding two different nucleic acid precipitants can significantly improve the recovery effect of trace nucleic acid in such samples. However, since capture RNA (Poly A) belongs to long nucleic acid, it will occupy a large amount of data when RNA sequencing is required in downstream experiments, while short nucleic acids less than 100 nt such as yeast tRNA can be removed after synthesizing dscDNA and theoretically will not affect sequencing. To verify the above conjecture, take this nucleic acid sample, construct a total RNA library after treatment with DNaseI, and perform PE150 sequencing using the Illumina platform. Analyze the sequencing results to confirm that there is no yeast tRNA sequence, indicating that the above design idea is feasible. Therefore, when using the kit involved in this application to extract samples with high inhibitor content and low nucleic acid content, it is recommended to add capture RNA (without RNA library construction) or short RNA < 100 nt (with RNA library construction) as a precipitant according to the downstream experimental purpose to ensure the nucleic acid extraction effect.

[0223] Table 13 Effect of adding precipitant on the extraction effect of samples with high inhibitor content and low nucleic acid content

[0224]

[0225] Example 12: Verify the feasibility of DNA digestion during the rinsing of impurities

[0226] For the nucleic acid extraction method involved in this application, a scheme for digesting DNA and only retaining RNA samples during rinsing is provided, thus avoiding digestion after nucleic acid extraction and simplifying the experimental process. To determine the feasibility of this scheme, the enzymatic digestion effect of DNA was verified using real samples.

[0227] The specific experimental steps are as follows:

[0228] 1. Sample collection and enrichment: The raw sewage sample to be tested was taken from a large-scale water recycling plant in Beijing. After 100 mL of the water sample was pasteurized to inactivate potential pathogenic microorganisms, it was enriched to 1 mL using the ultrafiltration method.

[0229] 2. Nucleic acid extraction: After mechanical grinding lysis, shielding agent precipitation, nucleic acid binding, and rinsing with the first washing solution according to the conventional procedure, 50 μL of a DNA digestion working solution with a DNase I concentration of 0.5 U / μL, an RNase Inhibitor concentration of 2 U / μL, and a DNase I reaction solution concentration of 1× was added to the magnetic beads and incubated at 37°C for 15 min for digestion. After the digestion reaction ended, 450 μL of the binding solution was added again and shaken vigorously for 5 min. Then, it was placed on a magnetic stand. After discarding the supernatant, rinsing with the first washing solution, the second washing solution, and air-drying and eluting were continued according to the conventional process. Additionally, samples that were completely co-extracted with DNA / RNA according to the conventional procedure were set as controls, and 3 technical replicates were set for each condition.

[0230] 3. Sample detection: The Qubit dsDNA HS assay kit and Qubit RNA HS assay kit were used to detect the DNA and RNA concentrations of the extracted nucleic acids. The results are shown in Table 14. It can be seen that after digestion with DNase, more than 90% of the extracted DNA can be removed, while more than 70% of the RNA can be retained, indicating that interspersing DNase digestion during the impurity rinsing process can effectively remove DNA in the sample and retain RNA, thus simplifying the experimental procedure.

[0231] Table 14 Verification of the feasibility of DNase digestion during rinsing

[0232]

[0233] Example 13: Verification of the consistency between semi-automated nucleic acid extraction and manual nucleic acid extraction

[0234] For the nucleic acid extraction kit and nucleic acid extraction method involved in this application, a semi-automated nucleic acid extraction scheme combining common existing fully automated nucleic acid extractors on the market is provided. That is, after mechanical grinding and crushing and shielding agent precipitation are completed, the reagents pre-packaged in 96-well deep-well plates are used for subsequent operations. To verify the consistency of the semi-automated scheme and the fully manual scheme, the same sample was used for nucleic acid extraction manually and semi-automatically respectively, and then the consistency of the results was compared.

[0235] The specific experimental steps include:

[0236] 1. Sample collection and enrichment: The raw sewage sample to be tested was taken from a large-scale water recycling plant in Beijing. After 100 mL of the water sample was pasteurized to inactivate potential pathogenic microorganisms, porcine epidemic diarrhea virus was added to a final concentration of 500 copies / mL, and it was concentrated to 1 mL using the ultrafiltration method.

[0237] 2. Nucleic acid extraction: For the fully manual operation, nucleic acid extraction was carried out according to the conventional procedure. For the semi-automated operation, after mechanical force grinding and shielding agent removal were carried out according to the conventional process, the plate reagents pre-packaged in a 96-well deep well plate and a fully automated nucleic acid extractor were used to carry out nucleic acid extraction according to the procedure shown in Table 3. To compare the consistency of the effects of manual and automatic extraction, 8 technical replicates were set for both methods.

[0238] 3. Sample detection: The CT values of the spiked PEDV were detected using one-step reverse transcription real-time fluorescence quantitative PCR. The results are shown in Table 15 (the CT values are presented in the form of mean ± SD). It can be seen that the CT values finally detected using the fully manual method or semi-automated nucleic acid extraction are basically the same, indicating that the nucleic acids extracted by the two methods are consistent, that is, the nucleic acid extraction kit and nucleic acid extraction method involved in this application can be combined with common nucleic acid extractors on the existing market to achieve semi-automated nucleic acid extraction, thereby reducing the number of necessary manual operations, reducing the pressure on the testing personnel, and improving the sample parallelism.

[0239] Table 15 Comparison of the consistency in the effects of manual and semi-automatic nucleic acid extraction

[0240]

[0241] Example 14: Verification of the applicability of the nucleic acid extraction method proposed in this application for extracting enriched sewage samples

[0242] To verify the applicability of the nucleic acid extraction kit and nucleic acid extraction method involved in this application for sewage samples enriched by different pretreatment methods, sewage samples enriched by three methods, namely polyethylene glycol precipitation, aluminum salt flocculation, and ultrafiltration separation, were respectively selected to verify the applicability of the nucleic acid extraction method.

[0243] The specific experimental steps include:

[0244] 1. Sample collection and enrichment: The raw sewage sample to be tested was taken from a large-scale water recycling plant in Beijing. After 100 mL of the water sample was pasteurized to inactivate potential pathogenic microorganisms, porcine epidemic diarrhea virus was added to a final concentration of 500 copies / mL, and the samples were concentrated and enriched to 1 mL using three methods, namely polyethylene glycol precipitation method, aluminum salt flocculation method, and ultrafiltration separation method, respectively.

[0245] 2. Nucleic acid extraction: Nucleic acid extraction was carried out according to the conventional procedure.

[0246] 3. Sample detection: The CT value of the spiked PEDV was detected by one-step reverse transcription real-time fluorescence quantitative PCR, and quantitative analysis was carried out in combination with the standard curve to calculate the overall recovery rate of the spiked virus from enrichment to extraction. The results are shown in Table 16 (the recovery rate is shown in the form of mean ± SD). The results indicate that the nucleic acid extraction kit involved in the present application can achieve good nucleic acid extraction effect and recovery rate for sewage samples enriched by three methods, indicating that the nucleic acid extraction kit and method involved in the present application are applicable to sewage samples enriched by different pretreatment methods.

[0247] Table 16 Overall recovery rate of spiked virus in sewage samples enriched by different pretreatment methods

[0248]

[0249] Example 15: Verification of the applicability of the nucleic acid extraction method proposed in the present application for extracting soil samples

[0250] To verify the applicability of the nucleic acid extraction kit and nucleic acid extraction method involved in the present application for soil samples, three different soil samples were selected to verify the applicability of the nucleic acid extraction method.

[0251] The specific experimental steps are as follows:

[0252] 1. Sample collection and treatment: Three soil samples were taken from farmland, forest and ornamental plant flowerpots around Beijing. Before nucleic acid extraction, 10 g of soil was rinsed 3 times with 20 mL of PBS buffer to remove inorganic minerals by using the different sedimentation coefficients of soil mineral particles and biomass, so as to retain the part rich in biomass for nucleic acid extraction.

[0253] 2. Nucleic acid extraction: Nucleic acid extraction was carried out according to the conventional procedure.

[0254] 3. Sample detection: The DNA and RNA concentrations of the extracted nucleic acid were detected by using Qubit dsDNA HS assay kit and Qubit RNA HS assay kit, and the purity of the extracted sample was detected by Nanodrop 2000. The results are shown in Table 17. The results indicate that the nucleic acid extraction kit involved in the present application can effectively extract nucleic acid with high purity from three types of soil samples, indicating that the nucleic acid extraction kit and method involved in the present application are applicable to soil samples.

[0255] Table 17 Results of nucleic acid concentration and purity of different soil samples

[0256]

[0257] Example 16: Verification of the applicability of the nucleic acid extraction method proposed in the present application for extracting fecal samples

[0258] To verify the applicability of the nucleic acid extraction kit and nucleic acid extraction method involved in this application to soil samples, three different fecal samples were selected to verify the applicability of the nucleic acid extraction method.

[0259] The specific experimental steps are as follows:

[0260] 1. Sample collection and processing: Three fecal samples were taken from three different experimental mice respectively. After collection, the fecal samples were immediately stored in RNAlater preservation solution and stored at -80 °C until extraction.

[0261] 2. Nucleic acid extraction: Nucleic acid extraction was carried out according to the conventional procedure.

[0262] 3. Sample detection: The Qubit dsDNA HS assay kit and Qubit RNA HS assay kit were used to detect the DNA and RNA concentrations of the extracted nucleic acids, and Nanodrop 2000 was used to detect the purity of the extracted samples. The results are shown in Table 18. The results show that the nucleic acid extraction kit involved in this application can effectively extract nucleic acids with relatively high purity from fecal samples, indicating that the nucleic acid extraction kit and method involved in this application are applicable to fecal samples.

[0263] Table 18 Nucleic acid concentration and purity results of different fecal samples extracted

[0264]

[0265] Example 17: Verify the applicability of the nucleic acid extraction method proposed in this application to sediment samples

[0266] To verify the applicability of the nucleic acid extraction kit and nucleic acid extraction method involved in this application to sediment samples, three different sediment samples were selected to verify the applicability of the nucleic acid extraction method.

[0267] The specific experimental steps are as follows:

[0268] 1. Sample collection and processing: Three sediment samples were taken from the digested sludge sediments of three anaerobic digestion plants in Beijing. Before nucleic acid extraction, 10 mL of each sediment was taken into a centrifuge tube, and the precipitate was taken for nucleic acid extraction after centrifugation at 8000×g for 15 min.

[0269] 2. Nucleic acid extraction: Nucleic acid extraction was carried out according to the conventional procedure.

[0270] 3. Sample detection: Use the Qubit dsDNA HS assay kit and the Qubit RNA HS assay kit to detect the DNA and RNA concentrations of the extracted nucleic acids, and use the Nanodrop 2000 to detect the purity of the extracted samples. The results are shown in Table 19. The results indicate that the nucleic acid extraction kit involved in this application can effectively extract nucleic acids with relatively high purity from sediment samples, indicating that the nucleic acid extraction kit and method involved in this application are applicable to sediment samples.

[0271] Table 19 Nucleic acid concentration and purity results of extracting different sediment samples

[0272]

[0273] The technical features of the above-described embodiments can be combined arbitrarily. For the sake of brevity of description, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, it should be considered as falling within the scope described in this specification.

[0274] The above-described embodiments only represent several implementation manners of this application, and their descriptions are relatively specific and detailed, but they should not be construed as limiting the scope of the invention patent. It should be noted that for those of ordinary skill in the art, without departing from the concept of this application, several modifications and improvements can still be made, and these all belong to the protection scope of this application. Therefore, the protection scope of this application patent should be subject to the appended claims, and the description and drawings can be used to explain the content of the claims.

[0275] The above-described embodiments only represent several implementation manners of this application, which are convenient for understanding the technical solutions of this application specifically and in detail, but they should not be construed as limiting the protection scope of the patent application. It should be noted that for those of ordinary skill in the art, without departing from the concept of this application, several modifications and improvements can still be made, and these all belong to the protection scope of this application. In addition, it should be understood that after reading the above teachings of this application, those skilled in the art can make various changes or modifications to this application, and the equivalent forms obtained also fall within the protection scope of this application. It should also be understood that the technical solutions obtained by those skilled in the art through logical analysis, reasoning or limited experiments based on the technical solutions provided in this application are all within the protection scope of the appended claims of this application. Therefore, the protection scope of this application patent should be subject to the content of the appended claims, and the description and drawings can be used to explain the content of the claims.

Claims

1. A kit for efficiently extracting DNA and / or RNA from complex samples, characterized in that: It includes a lysis medium, a lysis solution, a precipitation solution, a binding solution, a magnetic bead storage solution, a first washing solution, a second washing solution and an elution solution; wherein: The cracking medium includes hard particles, which are acid-washed glass beads or zirconium beads with a particle size of 0.1 mm to 3 mm; The components of the lysate are 10 mmol / L to 100 mmol / L disodium hydrogen phosphate-sodium dihydrogen phosphate buffer salt, 2 mol / L to 4 mol / L chaotropic salt, 1 mol / L to 2 mol / L monovalent salt, 0.01 wt% to 1 wt% detergent and 0.5 mol / L to 1.5 mol / L RNA solubilizing agent; the detergent is sodium dodecyl sulfate or sodium dodecyl sulfonate; the RNA solubilizing agent is ammonium acetate; the chaotropic salt is guanidine isothiocyanate or guanidine hydrochloride; the monovalent salt includes sodium chloride; The precipitating solution includes 10 mmol to 100 mmol / L of a precipitating agent, and the precipitating agent is potassium aluminum sulfate dodecahydrate or aluminum sulfate; The components of the binding solution are 10 mmol / L to 100 mmol / L buffer salt, 1 mol / L to 5 mol / L chaotropic salt, 10 wt% to 30 wt% organic solvent and 0.1 wt% to 5 wt% surfactant; the chaotropic salt in the binding solution is guanidine isothiocyanate or guanidine hydrochloride; The magnetic beads in the magnetic bead storage solution are hydroxyl-modified silica-coated ferroferric oxide magnetic beads or carboxyl-modified silica-coated ferroferric oxide magnetic beads, and the concentration of the magnetic beads in the magnetic bead storage solution is 50 mg / mL to 100 mg / mL; The first washing solution comprises 10 mmol / L to 100 mmol / L buffer salt, 0.05 mol / L to 2 mol / L chaotropic salt, 30% (v / v) to 80% (v / v) organic solvent and 0.1 wt% to 5 wt% surfactant, and the pH is 6.0 to 8.0; The second washing solution includes 10 mmol / L to 100 mmol / L buffer salt and 50% (v / v) to 90% (v / v) organic solvent, and the pH is 6.0 to 8.0; The eluent includes 1 mmol / L to 100 mmol / L buffer salt and 0.01 wt% to 1 wt% surfactant, and the pH is 6.0 to 8.0; The complex sample includes one or more of sewage, soil, feces, sediment, activated sludge and water filter membrane; The buffer salts in the binding solution, the first washing solution, the second washing solution and the eluent each independently include one or more of tris(hydroxymethylaminomethane)-hydrochloric acid buffer salt, tris(hydroxymethylaminomethane)-ethylenediaminetetraacetic acid buffer salt, disodium hydrogen phosphate-sodium dihydrogen phosphate buffer salt and sodium citrate-citric acid buffer salt; The chaotropic salt in the first washing solution is guanidine isothiocyanate or guanidine hydrochloride; The surfactants in the binding solution, the first washing solution and the eluting solution each independently include one or more of Tween-20, Tween-40, Tween-60, Tween-80 and Triton X-100; The organic solvents in the combined solution, the first washing solution and the second washing solution each independently include one or more of ethanol, isopropanol and polyethylene glycol.

2. A method for extracting DNA and / or RNA from a complex sample using the kit according to claim 1, characterized in that: The method comprises: Mechanical grinding: the lysis medium, the lysis solution and the sample to be tested are mixed and ground by mechanical vibration to obtain a lysis mixture; wherein the relative amount of the lysis solution and the liquid sample to be tested in each reaction unit is (400μL ~700μL): (50μL ~ 300μL), and the relative amount of the lysis solution and the solid sample to be tested is (400μL ~ 700μL): (25 mg ~ 300 mg); PCR inhibitor precipitation: centrifuge the lysis mixture at 5000 g ~ 15000 g to obtain a supernatant, mix the supernatant with the precipitate in a relative amount of (500 μL ~ 650 μL): (50 ~ 250 μL), invert several times, and centrifuge at 5000 g ~ 15000 g to obtain a supernatant; Nucleic acid binding: the supernatant, binding solution and magnetic beads are mixed to allow the magnetic beads to adsorb nucleic acids, and the supernatant is removed to obtain magnetic beads bound with nucleic acids; the volume ratio of the supernatant to the binding solution is 1:0.8-1:3, and the amount of magnetic beads used in each reaction unit is 5 μg-50 μg; Rinsing impurities: using the first washing solution and the second washing solution to wash the magnetic beads bound with nucleic acid in sequence to remove impurities, so as to obtain only magnetic beads bound with nucleic acid; the impurities include at least one of proteins, small molecules and salts; Nucleic acid elution: Mix the magnetic beads bound only to nucleic acids with the elution buffer, incubate and centrifuge to obtain the supernatant containing the target DNA and / or RNA.

3. The method according to claim 2, characterized in that The mechanical grinding step satisfies one or more of the conditions i) to iii): i) The solid sample to be tested is a soil sample, and the relative amount of the lysate and the soil sample is (400 μL~700 μL): (100 mg~200 mg); The solid sample to be tested is a stool sample, and the relative amount of the lysate and the stool sample is (400 μL~700 μL): (25 mg~ 50 mg); or, The solid sample to be detected is a filter membrane sample, and the relative amount of the lysate and the filter membrane sample is (400 μL~700 μL): (1 / 4~1 47 mm or 50 mm filter membrane); ii) mechanical shaking using a vortexer at a speed of 800 rpm to 3000 rpm for 5 min to 20 min; and, iii) Use a grinding homogenizer for mechanical oscillation at a speed of 3 m / s~7 m / s, an oscillation time of 15 s~120 s, and 2~4 oscillation cycles.

4. The method according to claim 2 or 3, characterized in that The mechanical grinding steps also include the following operations: After grinding, capture RNA or short RNA less than 100 nt is added to reduce nonspecific adsorption; In each reaction unit: the amount of the captured RNA is 1 μg to 10 μg, and the amount of the short RNA below 100 nt is 5 μg to 25 μg.

5. The method according to claim 2 or 3, characterized in that: The method extracts only RNA from a complex sample, and the steps of washing out impurities include: Using the first washing solution to wash the magnetic beads bound with the nucleic acid to remove impurities, thereby obtaining washed magnetic beads; Adding DNase I and its corresponding reaction buffer to the washed magnetic beads to obtain a digestion reaction system, incubating, and obtaining a digestion product; The digestion product and the binding solution are mixed in a volume ratio of 1:0.8 to 1:3 to obtain DNA-digested magnetic beads; The DNA-digested magnetic beads are washed sequentially with the first washing solution and the second washing solution.

6. The method according to claim 5, characterized in that The concentration of the DNase I in the digestion reaction system is 0.01 U / μL to 0.5 U / μL, and the incubation conditions are: 15° C. to 45° C., and 5 min to 60 min.

7. The method according to claim 2 or 3, characterized in that In the nucleic acid elution step, the incubation conditions are: 40°C~70°C, 2 min~15 min.

8. The method according to claim 2 or 3, characterized in that: DNA and / or RNA from complex samples are extracted using an automated nucleic acid extractor. Each well in the deep-well plate corresponds to one reaction unit.

9. The method according to claim 8, characterized in that The heating modules of the automated nucleic acid extractor are located in columns 1, 5, 7 and 11: The binding solution is dispensed into the 1st column, the 2nd column, the 7th column and the 8th column of the deep well plate, the first washing solution is dispensed into the 3rd column and the 9th column of the deep well plate, the second washing solution is dispensed into the 4th column and the 10th column of the deep well plate, the elution solution is dispensed into the 5th column and the 11th column of the deep well plate, and the magnetic beads are dispensed into the 6th column and the 12th column of the deep well plate; or, The heating modules of the automated nucleic acid extractor are located in columns 1, 6, 7 and 12: The binding solution was dispensed into the 1st, 2nd, 7th and 8th columns of the deep well plate, the first washing solution was dispensed into the 3rd and 9th columns of the deep well plate, the second washing solution was dispensed into the 4th and 10th columns of the deep well plate, the magnetic beads were dispensed into the 5th and 11th columns of the deep well plate, and the elution solution was dispensed into the 6th and 12th columns of the deep well plate.

Images