Application of human st gene in plant immune disease resistance

Abstract

The application provides application of a human ST gene in plant immune disease resistance, and belongs to the technical field of plant protection. The application introduces a proton channel protein ST from human into plants, and the protein is started by different plant pathogenic bacteria inducible promoters or strong promoters, so that the protein becomes a specific broad-spectrum resistance gene against multiple pathogenic bacteria. The application combines the ST with different promoters to express in plants to form a transgenic plant, and the transgenic plant has a specific broad-spectrum disease resistance effect. The ST gene can be transformed by selecting different promoters according to different crops and different pathogenic bacteria, and is flexible and changeable, and is suitable for multiple crops. The specific broad-spectrum disease resistance effect is achieved by modifying the promoter sequence of the ST.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of plant protection, and particularly relates to application of a human ST gene in plant immune disease resistance. BACKGROUND

[0002] In plant cells, there are two kinds of disease resistance bodies. One kind is combined with specific effectors to form multimers, open pores in the cell membrane, induce calcium ion flow, and cause plant disease resistance. The other kind of effector needs the help of a helper gene after being combined to be able to multimerize, open pores in the cell membrane, induce calcium ion flow, and cause plant disease resistance. However, the plant disease resistance bodies are still inconvenient to modify and design at present, and often do not meet expectations when facing the invasion of various diseases such as fungi, bacteria and viruses. At the same time, it needs to consume a large amount of manpower, material resources and financial resources to clone and explore more disease resistance bodies from plants.

[0003] ST In animal cells, it participates in the immunity of fungi, bacteria and viruses, but its role in plants has not been studied. SUMMARY

[0004] The application provides application of a human ST gene in plant immune disease resistance, realizes cross-species disease resistance, is more flexible, and makes ST the human gene become a specific broad-spectrum resistance gene that can be targeted to various pathogenic bacteria.

[0005] The application provides a target plant broad-spectrum disease resistance gene, which comprises a promoter and a human ST gene that is optimized in codons of a target plant and is connected in sequence. ST The NCBI Sequence ID of the human gene is 340061.

[0006] Preferably, the promoter comprises a plant pathogenic bacteria inducible promoter and a strong promoter.

[0007] Preferably, when the target plant is tobacco and rice, the nucleotide sequence of the human ST gene that is optimized in codons is as shown in SEQ ID No. 1.

[0008] The application further provides a primer pair for amplifying the target plant broad-spectrum disease resistance gene, which comprises an upstream primer with a nucleotide sequence as shown in SEQ ID No. 2 and a downstream primer as shown in SEQ ID No. 3.

[0009] The application further provides a recombinant vector comprising the target plant broad-spectrum disease resistance gene.

[0010] This invention also provides the application of the above-mentioned broad-spectrum disease resistance gene for target plants or the above-mentioned recombinant vector in improving the broad-spectrum disease resistance of target plants.

[0011] Preferably, the broad-spectrum disease resistance includes resistance to oomycete diseases and resistance to fungal diseases.

[0012] The present invention also provides a method for improving broad-spectrum disease resistance in plants, comprising, based on the codon preference of the plant, […]. ST Gene codon optimization, converting codon-optimized genes... ST Genes are inserted into expression vectors, and plants are transformed using recombinant vectors to obtain plants with enhanced broad-spectrum disease resistance;

[0013] The ST The gene's NCBI Sequence ID is 340061.

[0014] The expression vector contains a plant pathogen-inducible promoter or a strong promoter.

[0015] Preferably, the recombinant vector is transformed into the target plant using an Agrobacterium-mediated genetic transformation method.

[0016] This invention also provides the application of the above-mentioned target plant broad-spectrum disease resistance gene, the above-mentioned recombinant vector, or the above-mentioned method in constructing disease-resistant plant germplasm.

[0017] Beneficial effects: This invention introduces the proton channel protein ST from humans into plants, and activates this protein using different inducible or strong promoters of plant pathogens, making it a specific broad-spectrum resistance gene against a variety of pathogens.

[0018] This invention will ST Transient expression was performed in tobacco leaves to verify whether it induced an immune response in plants; subsequently, ST The transgenic plants were stably transformed into tobacco and rice. Results showed that the transformation introduced a proton channel protein not naturally present in plants, differing from the traditional theory of plant resistance body activation. This invention introduces a novel plant disease resistance strategy. Furthermore, this invention also confirmed that only the proton channel protein... ST This gene can provide resistance to a variety of pathogens, reducing the cost of genetic modification. Furthermore, the present invention... ST Genes can be transformed using different promoters selected for different crops and pathogens, offering flexibility and applicability to multiple crops. ST The promoter sequence achieves a specific broad-spectrum anti-disease effect. Attached Figure Description

[0019] Figure 1Figures for the results of the human ST protein with plant antiviral proteins, where a indicates that transient expression of ST induces cell death, 24 hours after inoculation, photographs were taken under white light (top) and UV light (middle), DAB (bottom), ROS in tobacco leaves were stained with 3,3-diaminobenzidine (DAB), rice blast resistance gene Xa23 was used as a positive control, and empty vector (EV) was used as a negative control, the scale bar is 1 centimeter; b: Western blot analysis of ST, ST-specific antibodies were used to indicate protein expression, the loading of each sample was indicated by Ponceau S staining of ribulose-1,5-bisphosphate carboxylase / oxygenase (RBC); c: ROS production of transiently expressed ST and EV plants was determined by chitin and water (mock) treatment, RLU: relative light units; d: total photon counts of the samples shown in (c); e: ST induces the expression of defense-related genes; f: Expression of ST in N. benthamiana can be seen by electrolyte leakage; g: ST confers resistance to P. capsici in N. benthamiana, photographs were taken 48 h after inoculation, the scale bar is 1 centimeter; h: lesion area of the samples shown in (g); i: relative pathogen biomass of the samples shown in (g); j: ST has resistance to the bacterial pathogen Pseudomonas syringae, photographs were taken 4 days after inoculation, the scale bar is 1 centimeter; k: luciferase intensity of the samples shown in (j); l: bacterial proliferation in diseased leaves of the samples shown in (j); all data are mean ± SD; N is the number of independent samples of organisms in the figure, * indicates significant difference of unpaired Student's t test (*P<0.05, **P<0.01, ***P<0.001, ****P<0.0001), statistical significance indicated by different letters was calculated by Duncan's multiple range test;

[0020] Figure 2 Figures for the results of mST in pepper Phytophthora blight spot detection, where a: N. benthamiana lines mST#6 and mST#15 are resistant to P. capsici, photographs were taken 48 h after infection, the scale bar is 1 centimeter; b, c: lesion area and relative pathogen biomass of the lines in (a); d: N. benthamiana lines mST#6 and mST#15 show resistance to GFP-tagged TuMV virus, photographs were taken on the 8th day after infection, the scale bar is 1 centimeter; e, f: RT-qPCR detection of TuMV-CP and TuMV-GFP in the samples shown in (a), Western blot analysis of TuMV-GFP antibody, data are mean ± SD; N is the number of independent samples of organisms in the figure, statistical significance indicated by different letters was calculated by Duncan's multiple range test;

[0021] Figure 3Figure 1 shows the lesion detection results of *Bacillus oryzae* and *Bacillus thuringiensis* in RST. Figure 2 shows: a: Immunoblotting analysis of ST-HA fusion protein in rice, with wild-type rice WT as the control; immunoblotting analysis of two lines, RST#1 and RST#2, using Ponceau S staining for plant actin and ribulose-1,5-bisphosphate carboxylase / oxygenase (RBC); b: Disease development results of RST and WT lines inoculated with *Bacillus oryzae*, photographed 14 days after inoculation; c: Lesion area and relative fungal biomass of the strains in (b); d: Disease development results of RST and WT lines inoculated with *Bacillus thuringiensis*, photographed 14 days after inoculation; e, f: Damage length and relative fungal biomass of the strains in (d).

[0022] Figure 4 This is a map of the pRHE vector plasmid. Detailed Implementation

[0023] This invention provides a broad-spectrum disease resistance gene for target plants, comprising a promoter and a codon optimized by the target plant, connected in sequence. ST Genes, the ones mentioned ST The gene's NCBI Sequence ID is 340061.

[0024] The promoters described in this invention include plant pathogen-inducible promoters and strong promoters such as MAS (CP026926.1) used in tobacco and PR10a (LOC_Os12g36880) used in other plants.

[0025] In this invention, because ST Since the gene is human-derived, its application to plant disease resistance requires codon optimization tailored to the codon preferences of different plants. This invention does not specifically limit the method of codon optimization; online codon optimization tools (https: / / www.novopro.cn / tools / codon-optimization.html) can be used to optimize the ST protein for plant codon preferences. For example, in this embodiment of the invention, when the target plants are tobacco and rice, the codon-optimized... ST The nucleotide sequences of the genes are all shown in SEQ ID No. 1:

[0026]

[0027] The application also provides a primer pair for amplifying the broad-spectrum disease resistance gene of the target plant, which comprises an upstream primer with the nucleotide sequence shown in SEQ ID No. 2 and a downstream primer with the nucleotide sequence shown in SEQ ID No. 3.

[0028] The primer sequence used in the application is preferably as shown below:

[0029] p1300-ST-F (SEQ ID No. 2): 5' CCAAATCGACTCTAGAAATGCCGCACTCTAGCCT 3';

[0030] p1300-ST-R (SEQ ID No. 3): 5' TTGCTCACCATGGTCTCTGAGAAGTCTGTGCGAAGT 3'.

[0031] In the embodiment of the application, the synthesized ST fragment is used as a template for PCR amplification, and the reaction conditions are preferably as follows: pre-denaturation at 95℃ for 5 min; 95℃ for 30 sec, 58℃ for 30 sec, 72℃ for 30 sec, 28 cycles; and extension at 72℃ for 5 min.

[0032] The application also provides a recombinant vector comprising the broad-spectrum disease resistance gene of the target plant.

[0033] The application preferably inserts the amplified fragment into an expression vector by means of enzyme digestion to construct the recombinant vector. In the embodiment, the pCAMBIA1300 vector is subjected to enzyme digestion with HindIII, the enzyme digestion product is connected with the corresponding fusion fragment to construct a tobacco expression vector, and then Escherichia coli DH5α is transformed to obtain a ST protein vector, and finally Nicotiana benthamiana is transformed; the fragment is connected to PR10a to be constructed into the kpnI of pRHE vector ST Figure 4 and then rice is transformed.

[0034] The application also provides the use of the broad-spectrum disease resistance gene of the target plant or the recombinant vector in improving the broad-spectrum disease resistance of the target plant.

[0035] The broad-spectrum disease resistance preferably comprises resistance to oomycete diseases and resistance to fungal diseases, and is mainly based on triggering plant immunity to achieve a broad-spectrum antibacterial effect.

[0036] The application also provides a method for improving the broad-spectrum disease resistance of a plant, which comprises codon optimization of the gene according to the codon bias of the plant. ST ST ​​The gene is inserted into an expression vector, and the plant is transformed by using the recombinant vector to obtain a plant with improved broad-spectrum disease resistance.

[0037] The ST The gene (ID: 340061).

[0038] The expression vector comprises a plant pathogen inducible promoter or a strong promoter. In the embodiments of the present application, all vectors are synthesized by a company, wherein the tobacco is started by the MAS promoter, and the rice is started by the PR10a promoter.

[0039] The present application preferably comprises using an agrobacterium-mediated genetic transformation method to transform the recombinant vector into the target plant.

[0040] The present application also provides the use of the above-mentioned target plant broad-spectrum disease resistance gene or the above-mentioned recombinant vector or the above-mentioned method in constructing a disease-resistant plant germplasm.

[0041] In order to further illustrate the present application, the human source ST The genes in the application of plant immune disease resistance are described in detail, but they cannot be understood as limiting the scope of protection of the present application.

[0042] Example 1 ST triggers tobacco cell death and has plant disease resistance gene immune characteristics

[0043] S1, vector construction:

[0044] Amplification ST , and it is constructed into the pCAMBIA1300 vector by homologous recombination.

[0045] Amplification ST Segment: the primer pairing mode is p1300-ST-F and p1300-ST-R, and the PCR amplification is carried out by taking the synthesized fragment as a template. The reaction conditions are as follows: 95℃ pre-denaturation for 5min; 95℃ for 30sec, 58℃ for 30sec, 72℃ for 30sec, 28 cycles; 72℃ extension for 5min. ST

[0046] Homologous recombination connection: the pCAMBIA1300 vector is subjected to enzyme cutting with HindIII, the enzyme cutting product and the corresponding fusion fragment are connected to construct a tobacco expression vector, and then Escherichia coli DH5α is transformed to obtain a ST protein vector containing vector.

[0047] S2, immune characteristic analysis:

[0048] ​(1) Nicotiana benthamiana transient expression ST induced plant hypersensitive (HR) response: the test is divided into three groups, pCAMBIAsuper1300 empty vector (EV) and the positive control Xa23 (GenBank: AIX09985.1) which induced HR response. ST, empty vector negative control (EV) and positive control Xa23 were injected into four-week-old N. benthamiana leaves, respectively. 24 h after injection, the tobacco leaves were observed and photographed. ST and Xa23 were constructed into pCAMBIAsuper1300 vector, respectively, and transformed into Agrobacterium GV3101. After 16 h of shake culture, the bacteria were resuspended using an inoculum (10 mM MgCl2, 10 mM MES and 150 μM acetosyringone). The OD of each group was adjusted to 1. ST, empty vector negative control (EV) and positive control Xa23 were injected into four-week-old N. benthamiana leaves, respectively. 24 h after injection, the tobacco leaves were observed and photographed. 600

[0049] The results are shown in Figure a, Figure 1 ST can induce HR response in tobacco cells like positive control Xa23. The empty vector (EV) remains consistent and does not induce HR response in tobacco cells. ST

[0050] (2) ST DAB staining of N. benthamiana reactive oxygen species (ROS) burst: as described in (1), ST, empty vector negative control (EV) and positive control Xa23 were injected into four-week-old N. benthamiana leaves, respectively. 15 h after injection, the injected tobacco leaves were immersed in 20 ml DAB staining solution, and after 8 h of dark horizontal shake culture, they were placed in 95% ethanol for decolorization, and after 48 h of horizontal shake culture, they were photographed under white light.

[0051] The results are shown in Figure a, Figure 1 ST and positive control Xa23 can both stain ROS burst, while the control group empty vector (EV) does not. This indicates that ST expressed in tobacco cells can induce ROS burst like positive control Xa23.

[0052] (3) ST induces N. benthamiana ROS burst-ROS determination: the test is divided into eight groups, namely ST / chitin group, EV / chitin group, ST / mock group, EV / mock group, wherein the ST / chitin group is induced by a mixture solution containing plant immune elicitor chitin (Chitin) to N. benthamiana leaves containing ST Agrobacterium, the EV / chitin group is induced by a mixture solution containing plant immune elicitor chitin (Chitin) to N. benthamiana leaves containing empty vector EV Agrobacterium, the ST / mock group is treated with distilled water to N. benthamiana leaves containing ST Agrobacterium, and the EV / mock group is treated with distilled water to N. benthamiana leaves containing empty vector EV Agrobacterium, each sample group has at least eight biological replicates. ​​

[0053] Chitin treatment system (100 μL): dd H2O 98.25 μL, 6 Mm chitin 0.5 μL, 4 Mm Lo-12 1.25 μL and 1 mg / ml HRP 1 μL;

[0054] Mock treatment system (100 μL): dd H2O 98.75 μL, 4 Mm Lo-12 1.25 μL and 1 mg / ml HRP 1 μL;

[0055] Agrobacterium containing expression plasmids of ST and empty vector EV was injected into leaves of 4-week-old *Tobacco Bengal* plants. Agrobacterium with the empty vector expression plasmid served as an EV control. Seven hours later, 3 mm × 3 mm discs of *Tobacco Bengal* leaves were collected and immersed in distilled water overnight in 96-well plates. The distilled water was discarded, and 100 μL of a mixed solution (50 μM luminol (Wako), 10 μg / mL horseradish peroxidase, and 6 mM chitin (GLPBIO)) was added to each well. 100 μL of distilled water was added to each well in the ST / mock and EV / mock groups as controls. Chemiluminescence was measured at 500 ms intervals for 60 minutes using a Spark-10M microplate reader (TECAN).

[0056] The results are as follows Figure 1 As shown in Figure b, after induction with chitin, expression was found to be... ST The reactive oxygen species in tobacco with the gene expression showed a sharp increase, significantly higher than those in unexpressed tobacco. ST Gene materials indicate ST Expression can induce the production of reactive oxygen species, and the total amount of reactive oxygen species is much higher than that of the control group.

[0057] (4) Detection of disease resistance-related genes: Experimental method: The experiment was divided into four groups, namely, Agrobacterium tumefaciens injected with ST expression plasmid into Nicotiana benthamiana as the experimental group and Agrobacterium tumefaciens injected with empty vector expression plasmid into Nicotiana benthamiana as the EV control. Each sample was subjected to at least three biological replicates.

[0058] RNA extraction and reverse transcription quantitative PCR analysis: Tobacco leaves containing ST and control EVs 15 hours after agroinjection were collected and immediately put into liquid nitrogen for freezing. After grinding in liquid nitrogen, they were used for RNA extraction. Total RNA was extracted from samples using RNAprep Pure Plant Kit (TianGen Biotech; China). RNA was purified from total RNA using DNase I (Thermo Scientific). Complementary DNA (cDNA) was synthesized using HiScript II first strand cDNA synthesis kit (Vazyme). qRT-PCR was performed using SYBR Green mix (Vazyme) on a Bio-Rad CFX96 Real-Time System with a C1000 Thermal Cycler (Bio-Rad).2 -ΔΔCT Methods were used to calculate the expression level of genes, with NbEF1a as the internal reference gene.

[0059] qRT-NbEF1a-F (SEQ ID No. 4): AGAGGCCCTCAGACAAAC;

[0060] qRT-NbEF1a-R (SEQ ID No. 5): TAGGTCCAAAGGTCACAA;

[0061] qRT-NbPR4-F (SEQ ID No. 6): GGCCAAGATTCCTGTGGTAGAT;

[0062] qRT-NbPR4-R (SEQ ID No. 7): CACTGTTGTTTGAGTTCCTGTTCCT;

[0063] qRT-NbPR1b-F (SEQ ID No. 8): GTGGACACTATACTCAGGTG;

[0064] qRT-NbPR1b-R (SEQ ID No. 9): TCCAACTTGGAATCAAAGGG;

[0065] qRT-NbPR2b-F (SEQ ID No. 10): AGGTGTTTGCTATGGAATGC;

[0066] qRT-NbPR2b-R (SEQ ID No. 11): CTGTACCCACCATCTTGC;

[0067] LOX-F (SEQ ID No. 12): AAAACCTATGCCTCAAGAAC;

[0068] LOX-R (SEQ ID No. 13): ACTGCTGCATAGGCTTTGG;

[0069] Results are shown in Figures Figure 1 As shown in Figure C, the expression of PR1b, PR2b, PR4 and LOX and other disease resistance genes in the tobacco sample injected with ST was significantly increased, significantly higher than the control group, indicating that the expression of ST activated the expression of plant disease resistance genes, proving that the ST gene has the characteristics of plant R gene immunity.

[0070] As shown in Figure Figure 1 It can be seen that the human ST protein has the basic characteristics of plant disease resistance proteins.

[0071] Pseudomonas syringae DC3000 ΔhopQ1:LUC (hopQ gene NCBI Reference Sequence: NZ_AP026446.1 is knocked out, which can infect tobacco and carries the LUC gene) was cultured in LB medium (10 g tryptone, 5 g yeast extract and 10 g NaCl dissolved in 1 L of water), and placed in a 28℃ shaker at 150 rpm overnight. Transiently transformed tobacco was used as the test group, and EV tobacco was used as the control group. 3 days after inoculation (dpi), the number of colonies in the inoculated tobacco leaf lesion area was extracted, and the pathogen biomass was determined by counting. Each group was repeated at least three times.

[0072] Results are shown in Figures Figure 1 As shown in Figures a and b, the LUC fluorescence in ST was significantly lower than that in the control group. Figure 1 As shown in Figure C, the colony count of DC3000 ΔhopQ1:LUC was also significantly lower than that of the control group. In summary, mST transgenic tobacco has significant resistance to DC3000.

[0073] Tumv (carrying GFP gene) was cultured in LB medium (10 g peptone, 5 g yeast extract, 10 g NaCl mixed in 1 L water), and placed in a 28℃ shaker at 150 rpm overnight. Transgenic tobacco was used as the test group, and WT tobacco was used as the control group. 3 days after inoculation (dpi), the number of colonies in the inoculated tobacco leaf lesion area was extracted, and the pathogen biomass was determined by counting. Each group was repeated at least three times.

[0074] Results are shown in Figures Figure 1 As shown in Figures a and b, the LUC fluorescence in ST was significantly lower than that in the control group. Figure 1The results showed that the colony count of DC3000ΔhopQ1:LUC was also significantly lower than that of the control group. In conclusion, mST transgenic tobacco exhibits significant resistance to DC3000.

[0075] qRT-TuMV-CP-F (SEQ ID No. 14): CACGCCGGAGCAGACGGATC;

[0076] qRT-TuMV-CP-R (SEQ ID No. 15): CTGATCGTCGCCGTCCATCATC;

[0077] qRT-TuMV-GFP-F (SEQ ID No. 16): gaagcggcacgacttcttcaagag;

[0078] qRT-TuMV-GFP-R (SEQ ID No. 17): gccgaggatgtttccgtcctcc;

[0079] qRT-NbEF1a-F (SEQ ID No. 18): AGAGGCCCTCAGACAAAC;

[0080] qRT-NbEF1a-R (SEQ ID No. 19): TAGGTCCAAAGGTCACAA.

[0081] Example 2: Analysis of resistance of mST transgenic tobacco to Phytophthora capsici.

[0082] Preparation of S1 and mST transgenic tobacco materials

[0083] Transgenic tobacco scavenger was prepared using the ST vector constructed into the pCAMBIA1300 vector in Example 1.

[0084] The methods for genetic modification are as follows:

[0085] (1) Infection of tobacco with Agrobacterium: Cut tobacco leaves of Nicotiana benthamiana into pieces of 2cm size. 2 The leaves were cultured on a co-culture medium (MS medium + NAA 0.1 mg / L + 6-BA 1.5 mg / L). The cut leaves were immersed in Agrobacterium-containing bacterial suspension (OD value 0.4-0.6, designed in Example 1) containing artificially designed plant disease resistance protein carriers for 10 minutes. The bacterial suspension was then poured out, the leaves were transferred to sterile filter paper, the bacterial suspension was discarded, and the leaves were air-dried.

[0086] (2) Differentiation and screening of transgenic tobacco: the co-cultured leaves were transferred to the medium. The culture was carried out under the light at 25°C. The tobacco with sprouts was cut and transferred to the medium (MS + 0.1 mg / L 6-BA + 0.01 mg / L NAA + 30 mg / L hygromycin) for culture.

[0087] (3) Rooting of transgenic tobacco: the tobacco seedlings with roots were picked out and transferred to the rooting medium (MS + 30 mg / L hygromycin) for culture and detection.

[0088] (4) Extraction of small sample of genomic DNA by CTAB method.

[0089] (5) PCR identification of transgenic plants: specific primers were used for PCR detection, and the obtained target fragment was 840 bp in size. The PCR product was subjected to sanger sequencing to identify the positive transgenic plant editing site, and the MASpro-ST transgenic tobacco was obtained, named mST.

[0090] The PCR detection primers were as follows:

[0091] SeqST-F (SEQ ID No. 20): ATGCCGCACATTGCTC;

[0092] SeqST-R (SEQ ID No. 21): GACGCCTTCGTCTGCC.

[0093] The above obtained mST transgenic tobacco was cultured for one month, and then subjected to immune test against disease.

[0094] The pepper Phytophthora was activated on a PDA plate, and was placed at 25°C for 3 d. The bacterial cake was punched with a 3 mm puncher to inoculate the tender two leaves of the mST transgenic tobacco and wild type tobacco (WT) cultured for one month. The transgenic tobacco was used as the test group, and the WT tobacco was used as the control group. 36 h after inoculation (hpi), the photographing was carried out under ultraviolet (UV) light. Meanwhile, the DNA of the inoculated tobacco leaf lesion area was extracted, and the pathogen biomass was determined by qPCR. Briefly, the inoculated tobacco leaf lesion area was quickly placed in liquid nitrogen for freezing. After grinding in liquid nitrogen, it was used for DNA extraction. The total DNA was extracted from the sample using CTAB. The qRT-PCR was carried out using SYBR Green mixture (Vazyme) on Bio-Rad CFX96 real-time system and C1000 thermal cycler (Bio-Rad). -ΔΔCT The method was used to calculate the expression level of the gene. At least three biological repeats were carried out for each group.

[0095] The results are as follows Figure 2As shown in Fig. 3a, b and c, the size of the mST infected by P. capsici was significantly smaller than that of the control group. Figure 2 As shown in Fig. 3a, b and c, the size of the mST infected by P. capsici was significantly smaller than that of the control group.

[0096] TumV was activated in LB medium and incubated at 25°C for 3 days, and then adjusted to a concentration of 5*10 -4 The mST transgenic tobacco and wild-type tobacco (WT) were used as the test group and the control group, respectively. Seven days after inoculation (dpi), the size of the infected area was measured under UV light. The RNA of the infected area of the inoculated tobacco leaves was extracted and used for qPCR to determine the viral biomass. Briefly, the infected area of the inoculated tobacco leaves was quickly frozen in liquid nitrogen. After grinding in liquid nitrogen, the sample was used for RNA extraction. The total DNA was extracted from the sample using an RNA extraction kit (Vazyme). qRT-PCR was performed using SYBR Green mix (Vazyme) on a Bio-Rad CFX96 real-time system with a C1000 thermal cycler (Bio-Rad).2 -ΔΔCT The method was used to calculate the expression level of the gene. At least three biological replicates were performed for each group.

[0097] The results are shown in Fig. 4a, b and c. Figure 2 As shown in Fig. 4a, b and c, the size of the mST infected by GFP was significantly smaller than that of the control group. Figure 2 As shown in Fig. 4a, b and c, the size of the mST infected by GFP was significantly smaller than that of the control group.

[0098] qRT-TuMV-CP-F (SEQ ID No. 22): CACGCCGGAGCAGACGGATC;

[0099] qRT-TuMV-CP-R (SEQ ID No. 23): CTGATCGTCGCCGTCCATCATC;

[0100] qRT-TuMV-GFP-F (SEQ ID No. 24): gaagcggcacgacttcttcaagag;

[0101] qRT-TuMV-GFP-R (SEQ ID No. 25): gccgaggatgtttccgtcctcc;

[0102] qRT-NbEF1a-F (SEQ ID No. 26): AGAGGCCCTCAGACAAAC;

[0103] qRT-NbEF1a-R (SEQ ID No. 27): TAGGTCCAAAGGTCACAA.

[0104] Example 3 RST transgenic rice analysis of resistance to Magnaporthe grisea

[0105] Rice was transformed using the ST construct in Example 1 connected to the PR10a promoter into the pRHE vector.

[0106] The transgenic method was as follows:

[0107] (1) Seed sterilization: peeled rice seeds were soaked in 75% ethanol for 1 minute, then treated with 2.5% sodium hypochlorite twice for 15 minutes each time, and finally washed with sterile ddH2O for 3-5 times.

[0108] Callus induction and subculture: the sterilized mature seeds were cultured in the dark at 28°C for 25-28 days in MS medium + NAA 0.1 mg / L + 6-BA 1.5 mg / L to induce callus. After the callus grew to an appropriate size, smooth, light yellow, and hard embryogenic callus was selected and evenly spread on the subculture callus medium (20x) 50 mL, trace elements (200x) 5 mL, iron salt (200x) 5 mL, organic matter (200x) 5 mL, sucrose 30.0 g, adjust pH to 5.8), and continue to culture for 7-8 days.

[0109] (2) Agrobacterium-mediated transformation of rice callus and co-culture: after activation, the Agrobacterium was co-cultured with the callus, and the OD of the Agrobacterium was between 0.1 and 0.15. 600 After co-culture, the callus was washed with sterile water three times, then soaked in sterile water containing 500 mg / L cefotaxime for 30 minutes, then dried with filter paper, and spread on the selection medium (MS + 0.1 mg / L 6-BA + 0.01 mg / L NAA + 30 mg / L hygromycin).

[0110] (3) Selection culture of transformed callus: after co-culture, the callus was washed with sterile water three times, then soaked in sterile water containing 500 mg / L cefotaxime for 30 minutes, then dried with filter paper, and evenly spread on the selection medium (MS + 0.1 mg / L 6-BA + 0.01 mg / L NAA + 30 mg / L hygromycin), cultured in the dark at 28°C for 10 days, then subjected to a second selection, and the light yellow callus with good growth state was selected for further culture.

[0111] (4) Differentiation culture of callus: select yellow, round callus, evenly spread on pre-differentiation medium (MS + 30 mg / L hygromycin), 28°C dark culture for 7 days. Then select the growth state of good, light yellow embryonic callus, put into differentiation medium (MS + 30 mg / L hygromycin), 28°C light culture for 30-60 days or so, until the transgenic seedling grows out.

[0112] (5) CTAB method for extracting small sample of genomic DNA.

[0113] (6) PCR identification of transgenic plants: PCR detection with specific primers, the obtained target fragment size is 840 bp, PCR products are sanger sequenced, identify positive transgenic plant editing site, obtain PR10pro-ST transgenic rice, named RST.

[0114] PCR detection primers are as follows:

[0115] SeqST-F (SEQ ID No. 20): ATGCCGCACATTGCTC;

[0116] SeqST-R (SEQ ID No. 21): GACGCCTTCGTCTGCC.

[0117] After the above RST transgenic rice was cultured for one month, an immune test was performed.

[0118] Activate Magnaporthe grisea on OTA (150 mL tomato juice, 40 g oatmeal, 0.6 g CaCO3, 15 g agarose mixed with 1 L water) plate, place it at 25°C for 7-10 d, inoculate the RST transgenic rice and wild type rice (WT) leaf blades cultured for one month with 3 mm puncher. Transgenic rice as test group, WT rice as control group. 14 d after inoculation (dpi), take photos for statistics.

[0119] Activate Xanthomonas oryzae on NB plate, place it at 25°C for 2-3 d, inoculate the RST transgenic rice and wild type rice (WT) leaf blades at the heading stage with sterile water and cut leaves. Transgenic rice as test group, WT rice as control group. 14 d after inoculation (dpi), take photos for statistics.

[0120] RST has a lesion-like phenotype, Figure 3 As shown, the size of Magnaporthe grisea lesion in RST is significantly lower than that of the control group. In summary, RST transgenic rice has significant resistance to Magnaporthe grisea.

[0121] Although the above embodiments have been described in detail, it should be understood that these are only some embodiments of the present application, but not all embodiments. Other embodiments can be obtained on the basis of the above embodiments without creativity, and these embodiments all belong to the protection scope of the present application.

Claims

1. Use of a broad-spectrum disease resistance gene of a target plant or a recombinant vector comprising the broad-spectrum disease resistance gene of a target plant in improving the broad-spectrum disease resistance of a target plant, characterized in that, The target plants are tobacco and rice; the broad-spectrum disease-resistant genes of the target plants comprise a promoter and a ST gene which is codon-optimized for the target plants, and the nucleotide sequences of the codon-optimized ST genes are shown in SEQ ID No. 1; When the target plants are tobacco, the expression of the ST genes improves the resistance of the tobacco to Pseudomonas syringae DC3000 and Phytophthora capsici; when the target plants are rice, the expression of the ST genes improves the resistance of the rice to Magnaporthe oryzae.

2. A method of increasing broad spectrum disease resistance in a plant, comprising, The plants are tobacco and rice; The method comprises codon-optimizing the ST genes according to the codon bias of the plants, inserting the codon-optimized ST genes into an expression vector, transforming the plants with the recombinant vector, and obtaining the plants with improved broad-spectrum disease resistance; The nucleotide sequences of the codon-optimized ST genes are shown in SEQ ID No. 1; The expression vector comprises a plant pathogen inducible promoter or a strong promoter; When the plants are tobacco, the expression of the ST genes improves the resistance of the tobacco to Pseudomonas syringae DC3000 and Phytophthora capsici; when the plants are rice, the expression of the ST genes improves the resistance of the rice to Magnaporthe oryzae.

3. The method of claim 2, wherein, The method comprises transforming the recombinant vector into the target plants by using an agrobacterium-mediated genetic transformation method.

4. Use of the method according to claim 2 or 3 for the construction of a plant germplasm resistant to a disease, characterized in that, The disease-resistant plant germplasm is tobacco resistant to Pseudomonas syringae DC3000 and Phytophthora capsici, or rice resistant to Magnaporthe oryzae.

Images