Application of soybean GmSTM17 gene in regulation of soybean cotyledon node organogenesis

CN119351441BActive Publication Date: 2026-06-26NORTHEAST AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202310908457.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-07-24
Publication Date
2026-06-26
Estimated Expiration
2043-07-24

Smart Images

  • Figure BDA0004354278340000061
    Figure BDA0004354278340000061
  • Figure BDA0004354278340000071
    Figure BDA0004354278340000071
  • Figure BDA0004354278340000072
    Figure BDA0004354278340000072
Patent Text Reader

Abstract

The application discloses application of a soybean GmSTM17 gene in regulation of soybean cotyledon node organogenesis and belongs to the technical field of biological breeding. In order to improve the regeneration potential in the process of soybean cotyledon node organogenesis, the application provides a method for regulating soybean cotyledon node organogenesis, which comprises regulating expression of a GmSTM17 protein coding gene in a receptor soybean to regulate cotyledon node organogenesis of the receptor soybean, and the amino acid sequence of the GmSTM17 protein is sequence 3. The application also provides application of the GmSTM17 protein in regulation of the regeneration capacity of plant tissues. It is disclosed that the GmSTM17 gene has an inhibiting effect on the growth and development of the clump-bud meristem cells, thereby negatively feeding back regulating the regeneration potential, regeneration efficiency and regeneration rate of the soybean cotyledon node explants. The application provides a theoretical basis for further analyzing the soybean regeneration mechanism and cultivating a soybean variety with high regeneration capacity.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biological breeding technology, specifically involving the application of the soybean SHOOT MERISTEMLESS gene (GmSTM17) in regulating the development of cotyledonary organelles in soybean. Background Technology

[0002] Soybean is recognized as one of the crops most difficult to genetically transform. The main reason for this difficulty is the challenging regeneration of soybean explants. Similarly, obtaining a stable and efficient regeneration system is a prerequisite for genetic transformation. Soybean tissue culture regeneration systems mainly employ two induction pathways: organogenesis and somatic embryogenesis. These two pathways have different genetic bases and require different genetic transformation methods for transgenic work. Organogenesis refers to the process of regenerating adventitious roots or shoots on isolated or injured plant organs. Organogenesis is divided into direct and indirect organogenesis pathways. The main difference lies in the formation of non-embryonic callus: in the indirect organogenesis pathway, non-embryonic callus develops into root or shoot apical meristems, which then develop into root or shoot tips. The indirect organogenesis pathway is commonly used in tissue culture of plants such as Arabidopsis thaliana. In contrast, the direct organogenesis pathway does not form callus. For example, in direct organogenesis of roots, the root progenitor cells directly develop into root primordia, which then develop into adventitious roots or lateral roots. The direct organogenesis pathway is frequently used in soybean organogenesis. Therefore, selecting recipient materials with high regeneration capacity within the existing technological context of soybean genetic transformation is one of the effective ways to improve the efficiency of soybean genetic transformation.

[0003] STM is a type of KNOX protein, first detected in stem meristems in 1996. Studies have shown that the STM gene is expressed in stem meristems, including stem cells, OCs, and proliferating daughter cells in transition before organ primordia formation. While the STM gene in Arabidopsis has been extensively studied, its application in soybean is less well-documented. Therefore, further research on the function of the soybean STM gene is needed to elucidate the soybean regeneration mechanism. Summary of the Invention

[0004] The technical problem to be solved by this invention is: how to improve the regeneration potential of soybean cotyledonary nodes during their development.

[0005] To address the aforementioned technical problems, in a first aspect, the present invention provides a method for regulating the development of cotyledonary organelles in soybean. The method includes regulating the development of cotyledonary organelles in the recipient soybean by controlling the expression of the GmSTM17 protein-encoding gene or by regulating the activity or content of the GmSTM17 protein.

[0006] The GmSTM17 protein is any one of the following proteins (a1)-a3):

[0007] a1) The amino acid sequence is that of the protein shown in SEQ ID No. 3;

[0008] a2) A protein that is more than 80% identical to the amino acid sequence shown in a1) and is associated with the GmSTM17 protein, obtained by substituting and / or deleting and / or adding amino acid residues of the amino acid sequence shown in a1).

[0009] a3) is a fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of a1) or a2).

[0010] Furthermore, in the method described, the GmSTM17 protein is derived from soybeans.

[0011] SEQ ID No.3 consists of 375 amino acid residues.

[0012] The proteins mentioned above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.

[0013] The protein tag refers to a polypeptide or protein fused with a target protein using in vitro DNA recombination technology for expression, detection, tracing, and / or purification of the target protein. The protein tag may be a Flag protein tag, His protein tag, MBP protein tag, HA protein tag, myc protein tag, GST protein tag, and / or SUMO protein tag, etc.

[0014] Furthermore, the method includes promoting cotyledonary organogenesis in the recipient soybean by downregulating or reducing or inhibiting the expression of the gene encoding the GmSTM17 protein or the activity or content of the GmSTM17 protein in the recipient soybean.

[0015] To address the aforementioned technical problems, in a second aspect, the present invention provides a method for preparing soybeans with enhanced regeneration capacity. The method includes obtaining target soybeans with higher regeneration capacity than the recipient soybeans by downregulating, reducing, or inhibiting the expression of the GmSTM17 protein-encoding gene or the activity or content of the GmSTM17 protein in the recipient soybean.

[0016] Furthermore, the method includes introducing an sgRNA gene targeting the gene encoding the GmSTM17 protein and a gene encoding the Cas protein into the recipient soybean to downregulate, reduce, or inhibit the expression of the GmSTM17 protein encoding gene or the activity or content of the GmSTM17 protein in the recipient soybean, thereby promoting the occurrence of cotyledonary nodes in the recipient soybean or obtaining a target soybean with a higher regeneration capacity than the recipient soybean.

[0017] Furthermore, in the method, the target sequence of the sgRNA gene is positions 1514-1533 of SEQ ID No. 1 (5'-ACAAAACCAGCACTAACACT-3').

[0018] Furthermore, the method in this embodiment of the invention can be implemented in any of the following ways (M1)-M8):

[0019] M1) Replace 5'-ACAAAACCAGCACACT-3' (SEQ ID No. 1, positions 1514-1533) in the GmSTM17 gene in the soybean genome with 5'-ACAAAACCAGCACACT-3' (SEQ ID No. 4), thereby knocking out the GmSTM17 gene;

[0020] M2) Replace 5'-ACAAAACCAGCACTAACACT-3' (SEQ ID No. 1, positions 1514-1533) in the GmSTM17 gene in the soybean genome with 5'-ACAAAACCAGCACTAAACT-3' (SEQ ID No. 5), thereby knocking out the GmSTM17 gene;

[0021] M3) Replace 5'-ACAAAACCAGCACTAACACT-3' (SEQ ID No. 1, positions 1514-1533) in the GmSTM17 gene in the soybean genome with 5'-ACAAAACCAGCACAACT-3' (SEQ ID No. 6), thereby knocking out the GmSTM17 gene;

[0022] M4) Replace 5'-ACAAAACCAGCGACTAACACT-3' (SEQ ID No. 1, positions 1514-1533) in the GmSTM17 gene in the soybean genome with 5'-ACAAAACCAGCGACTAACACT-3' (SEQ ID No. 7), thereby knocking out the GmSTM17 gene;

[0023] M5) Replace 5'-ACAAAACCAGCACACT-3' (SEQ ID No. 1, positions 1514-1533) in the GmSTM17 gene in the soybean genome with 5'-ACAAAACCAGCACACT-3' (SEQ ID No. 8), thereby knocking out the GmSTM17 gene;

[0024] M6) Replace 5'-ACAAAACCAGCACTAACACT-3' (SEQ ID No. 1, positions 1514-1533) in the GmSTM17 gene in the soybean genome with 5'-ACAAACT-3', thereby knocking out the GmSTM17 gene;

[0025] M7) Replace 5'-ACAAAACCAGCTT-3' (positions 1514-1533 of SEQ ID No. 1) in the GmSTM17 gene in the soybean genome with 5'-ACAAAACCAGCTT-3' (SEQ ID No. 9), thereby knocking out the GmSTM17 gene;

[0026] M8) The GmSTM17 gene in the soybean genome is knocked out by replacing 5'-ACAAAACCAGCACTAACACT-3' (SEQ ID No. 1, positions 1514-1533) with 5'-ACAACAACAACACT-3' (SEQ ID No. 10).

[0027] To address the aforementioned technical problems, in a third aspect, the present invention provides the use of the GmSTM17 protein or biomaterials related to the GmSTM17 protein in any of the following:

[0028] A1) Application in regulating plant tissue regeneration capacity;

[0029] A2) Application in the preparation of products that regulate the regeneration capacity of plant tissues;

[0030] A3) Application in regulating the development of cotyledonary nodes in soybean;

[0031] A4) Application in the preparation of products that regulate the occurrence of cotyledonary nodes in soybean;

[0032] A5) Applications in plant breeding or plant-assisted breeding.

[0033] Furthermore, in the aforementioned application, the purpose of plant breeding (A5) is to cultivate plants with enhanced tissue regeneration capacity, such as soybeans with enhanced tissue regeneration capacity or soybeans with high potential or efficiency in the development of cotyledonary nodes.

[0034] Furthermore, in the aforementioned application, the substance regulating the expression of the protein-coding gene or the substance regulating the activity or content of the protein is a biological material, wherein the biological material is any one of the following:

[0035] B1) Nucleic acid molecules that inhibit or reduce the expression of the gene encoding the GmSTM17 protein or the activity or content of the GmSTM17 protein.

[0036] B2), an expression cassette containing the nucleic acid molecule described in B1);

[0037] B3), a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);

[0038] B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3);

[0039] B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2), or a transgenic plant cell line containing the recombinant vector described in B3);

[0040] B6) Transgenic plant tissue containing the nucleic acid molecules described in B1), or transgenic plant tissue containing the expression cassette described in B2), or transgenic plant tissue containing the recombinant vector described in B3);

[0041] B7) Transgenic plant organs containing the nucleic acid molecules described in B1), or transgenic plant organs containing the expression cassette described in B2), or transgenic plant organs containing the recombinant vector described in B3);

[0042] B8), the nucleic acid molecule encoding the GmSTM17 protein mentioned above;

[0043] B9) Expression cassettes containing the nucleic acid molecules described in B8), recombinant vectors, recombinant microorganisms or transgenic plant cell lines, transgenic plant tissues or transgenic plant organs.

[0044] Furthermore, in the aforementioned applications, the nucleic acid molecule in B1) may be a DNA molecule expressing sgRNA targeting the aforementioned protein-coding gene or may be sgRNA targeting the aforementioned protein-coding gene.

[0045] B8) The nucleic acid molecule is any one of the following (g1)-g3) DNA molecules:

[0046] g1) A DNA molecule whose coding sequence is SEQ ID No. 2;

[0047] g2) The DNA molecule whose coding strand has the nucleotide sequence of SEQ ID No. 1;

[0048] g3) is a DNA molecule that has more than 80% identity with the DNA molecule described in g1) or g2) and encodes the GmSTM17 protein.

[0049] Furthermore, in the aforementioned application, the expression cassette described in B2) refers to the DNA of the sgRNA gene that targets the gene encoding the GmSTM17 protein and the DNA of the gene encoding the Cas protein, which are capable of expressing in the host cell.

[0050] Furthermore, in the aforementioned application, the recombinant vector in B3) is the recombinant expression vector PGES401-GmSTM17-Target.

[0051] Furthermore, in the aforementioned applications, the recombinant microorganisms described in B4) can specifically be yeast, bacteria, algae, and fungi.

[0052] Furthermore, in the aforementioned applications, the plant tissue described in B6) may be derived from roots, stems, leaves, flowers, fruits, seeds, pollen, embryos, and anthers.

[0053] Furthermore, in the aforementioned applications, the transgenic plant organs described in B7) can be the roots, stems, leaves, flowers, fruits, and seeds of the transgenic plant.

[0054] Furthermore, in the aforementioned applications, the transgenic plant cell lines, transgenic plant tissues, and transgenic plant organs described in B5) may or may not include propagation material.

[0055] Furthermore, in the aforementioned applications, identity refers to the identity of amino acid sequences or nucleotide sequences. The identity of amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, by using blastp as the procedure, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing an identity search on a pair of amino acid sequences, the identity value (%) can be obtained.

[0056] In the above applications, the 80% or more of identity can be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.

[0057] Furthermore, in the aforementioned application, the plant is selected from any of the following:

[0058] C1) Dicotyledons;

[0059] C2), Leguminosae (family legumes);

[0060] C3), soybean plants

[0061] C4), soybeans.

[0062] To address the aforementioned technical problems, in a fourth aspect, the present invention provides the GmSTM17 protein or / and the biomaterials described in the above applications.

[0063] In this invention, regulating the occurrence of soybean cotyledonary nodes or regulating soybean tissue regeneration capacity specifically refers to improving or promoting the occurrence of soybean cotyledonary nodes or improving or promoting soybean tissue regeneration capacity. Specifically, the evaluation indicators for the occurrence of soybean cotyledonary nodes (or soybean regeneration capacity) include: regeneration potential (RP), regeneration efficiency (RE), and / or regeneration rate (RR). The criteria for identifying regeneration potential (RP) are the proportion of explants producing obvious clustered shoot primordia; the criteria for identifying regeneration efficiency (RE) are the ratio of the number of elongated clustered shoots produced by the explants to the total number of explants; and the criteria for identifying regeneration rate (RR) are the proportion of clustered shoots that have obtained rooting to the total number of explants.

[0064] The beneficial technical effects achieved by this invention are as follows:

[0065] 1. This study found that the regeneration potential, regeneration efficiency, and regeneration rate of mutant explants were significantly improved. Furthermore, scanning electron microscopy analysis of the shoot meristem cells of SIM14-stage mutant explants revealed a significant increase in shoot meristem cell size after editing the GmSTM17 gene.

[0066] 2. This study demonstrates that the GmSTM17 gene inhibits the growth and development of meristematic cells in clustered shoots, thereby negatively regulating the regeneration potential, efficiency, and rate of soybean cotyledonary node explants. This provides a theoretical basis for further elucidating the soybean regeneration mechanism and cultivating soybean varieties with high regeneration capacity.

[0067] 3. To overcome the bottleneck in soybean genetic transformation and to deeply reveal and explore the regulatory mechanisms and influencing factors of soybean regeneration, this study used GmSTM17 (Glyma.15g111900), a member of the soybean STM gene family, as the research object. Using CRISPR / Cas9 technology, T2 generation homozygous gene knockout mutants (stm17-2, stm17-6, and stm17-7) were obtained. Phenotypic characteristics related to cotyledonary organogenesis were identified, with wild-type soybean Dongnong 50 as the control (CK). The results showed that the regeneration potential, efficiency, and rate of the GmSTM17 gene-edited mutant soybean lines were significantly improved. These results indicate that the GmSTM17 gene negatively regulates the regeneration potential, efficiency, and rate during cotyledonary organogenesis in soybean, and can be applied to the breeding of new soybean materials without genotype restrictions. Attached Figure Description

[0068] Figure 1 Analysis of GmSTM17 gene expression patterns during key stages of soybean cotyledonary organogenesis;

[0069] Figure 2 For the soybean genetic transformation process;

[0070] Figure 3 For T0 generation conversion event detection;

[0071] Figure 4 Screening of limiting annealing temperatures for primers used in mutant detection;

[0072] Figure 5 For the detection of T1 generation homozygous mutants;

[0073] Figure 6 These are explants from the soybean GmSTM17 mutant SIM14 stage;

[0074] Figure 7 Identification of the regeneration potential of soybean GmSTM17 mutant;

[0075] Figure 8 This is an explant from soybean cotyledonary organogenesis at SEM14 stage;

[0076] Figure 9 Identification of regeneration efficiency of soybean GmSTM17 mutant;

[0077] Figure 10 Identification of the regeneration rate of soybean GmSTM17 mutant;

[0078] Figure 11 Scanning electron microscopy analysis of meristem cells from the clustered shoots of soybean GmSTM17 mutant. Detailed Implementation

[0079] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0080] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0081] Soybean seed Dongnong 50 (also known as DN50) was preserved in our laboratory. It is mentioned in the literature "Ying Zhao et al. Enhanced production of seed oil with improved fatty acid composition by overexpressing NAD+". + The biological material described in the paper "-dependent glycerol-3-phosphate dehydrogenase in soybean. Journal of Integrative Plant Biology (IF 9.106) Pub Date: 2021-03-26, DOI: 10.1111 / jipb.13094" (DN50) is publicly available from the applicant. The obtained biological material can only be used for the verification of the embodiments of this application and cannot be used for other purposes.

[0082] Soybean seed Suinong 14 (also known as SN14) was preserved in our laboratory. The information is available in the literature "Haiyang Zheng et al. Construction of Chromosome Segment Substitution Lines and Inheritance of Seed-Pod Characteristics in Wild Soybean. Front. Plant Sci. (IF 5.6) Pub Date: 2022-06-17, DOI: 10.3389 / fpls.2022.869455".

[0083] The gene-editing vector PGES401 was kindly provided by Professor Guan Yuefeng's research group at Fujian Agriculture and Forestry University and is disclosed in the literature "Mengyan Baietc Combination of two multiplex genome-edited soybean varieties enables customization of protein functional properties Molecular Plant (IF21.949) PubDate:2022-5-27,DOI:10.1016 / j.molp.2022.05.011". The public can obtain the above-mentioned biological material from the applicant. The obtained biological material is only for repeating the experiments of this invention and cannot be used for other purposes.

[0084] Unless otherwise specified, the quantitative experiments in the following examples were performed in triplicate, and the results were averaged.

[0085] Statistical analysis was performed using SPSS 16.0 (SPSS Inc, Chicago, IL, USA). One-way ANOVA was used to compare whether the differences in gene expression between untransformed control plants and transformed plants were statistically significant (P < 0.05). * indicates a significant difference (P < 0.05), ** indicates a highly significant difference (P < 0.01), and *** indicates a highly significant difference (P < 0.001).

[0086] Example 1: Analysis of the expression pattern of GmSTM17 gene at different stages of cotyledon organogenesis

[0087] 1.1 Phenotypic Identification of Cotyledonary Node Organogenesis in Soybean

[0088] 1.1.1 Seed sterilization and disinfection

[0089] Ninety grains each of Dongnong 50 and Suinong 14, with plump grains and no disease spots, were selected. First, they were placed in a 150mL Erlenmeyer flask and allowed to stand for 5 minutes with 75% ethanol. Then, they were sterilized with 15% H2O2 at 28℃ on a shaker at 100rpm for 15 minutes. Finally, they were washed with ddH2O until the water was clear. Then, 50mL of ddH2O was added, and the flask was incubated at 4℃ for 1-2 days.

[0090] 1.1.2. Induction and culture of clustered shoots

[0091] Take the seed material cultured in the previous step, divide the seed into two explants along the cotyledons, retaining 3-5 mm at the junction of the hypocotyl and cotyledon, and remove the excess hypocotyl. Remove the true leaves at the junction of the cotyledon and hypocotyl. Inoculate the treated explants into shoot induction medium (B-5 medium + 0.60 g / L MES + 3.00% sucrose + 0.80% agar + vitamin B5 + 1.67 mg / L 6-BA; pH = 5.7) and culture for 14 days. Inoculate 20 explants per dish according to the "4-6-6-4" principle, which is considered one replicate, and set up 3 replicates for each material.

[0092] 1.1.3. Cultivation of Clustered Bud Elongation

[0093] Explants cultured in SIM medium for 14 days were selected, and those with obvious clustered bud primordia were chosen. Cotyledons, hypocotyls, and primary stems and leaves were removed. These explants were then inoculated into SEM medium (MS medium + 0.6 g / L MES + 3% sucrose + 0.8% agar + vitamin B5 + 0.5 mg / L GA3 + 0.10 mg / L IAA + 1.00 mg / L Zeatin-R + 100 mg / L Glu + 100 mg / L Asp; pH = 5.7) and cultured for 28 days. Five explants were inoculated per dish according to the "2-1-2" principle, and subcultured every 14 days.

[0094] 1.1.4. Rooting culture of clustered buds

[0095] During the elongation culture of the bud clusters, the bud clusters that have grown to more than half the height of the culture dish are cut off with surgical scissors. The wound is dipped in 1 mg / mL IBA and inserted into the rooting medium (RM) (1 / 2 B5 medium + 0.59 g / L MES + 2.00% sucrose + 0.80% agar + 250 mg / L cephalosporin; pH = 5.8) and cultured for 7-10 days.

[0096] 1.1.5 Phenotypic Identification During Cotyledonary Organ Development in Soybean

[0097] During soybean cotyledonary organogenesis, the number of explants with clearly induced shoot primordia was recorded on day 14 of shoot induction. The number of shoots elongating during shoot elongation culture was also recorded. Furthermore, the number of rooted shoots was counted during shoot rooting culture. Based on the indicators in Table 1, the differences in regeneration indicators among the various materials were calculated and evaluated.

[0098] Table 1 Phenotypic Identification Criteria for Cotyledonary Organ Development in Soybean

[0099]

[0100] 1.2 Analysis of GmSTM17 expression pattern during soybean cotyledonary organogenesis

[0101] To verify the expression pattern of GmSTM17 at different stages of soybean cotyledonary organogenesis, we selected the high-regeneration variety Dongnong 50 and the low-regeneration variety Suinong 14 as materials to detect the expression level of GmSTM17 at key stages of soybean cotyledonary organogenesis. Key stages were selected (SIM0 (day 0 of bud induction medium), SIM3 (day 3 of bud induction medium), SIM7 (day 7 of bud induction medium), SIM14 (day 14 of bud induction medium), SEM3 (day 3 of bud elongation medium), SEM7 (day 7 of bud elongation medium), SEM10 (day 10 of bud elongation medium), SEM14 (day 14 of bud elongation medium), and SEM30 (day 30 of bud elongation medium)). Total RNA was extracted using TRIzol reagent (Invitrogen). Each sample was replicated three times. qRT-PCR conditions were performed according to ChamQ™ Universal. The qPCR Master Mix (Vazame) kit was used according to the manufacturer's instructions. The instrument used was a Roche Applied Science LightCycler™ 480. The internal control gene was Actin 4. The reaction system is as follows:

[0102] Table 2 qRT-PCR reaction system

[0103]

[0104] qRT-PCR reaction conditions (40 cycles):

[0105]

[0106] The primer information required for qRT-PCR is as follows:

[0107] Table 3 qRT-PCR primer sequences

[0108]

[0109] The GmSTM17 genome is a DNA molecule with the nucleotide sequence of SEQ ID No. 1, which encodes a DNA molecule with the nucleotide sequence of SEQ ID No. 2 and the GmSTM17 protein with the amino acid sequence of SEQ ID No. 3.

[0110] 1.3 Results

[0111] The results are as follows Figure 1 As shown, the relative expression level of GmSTM17 differed significantly at all key stages of soybean cotyledonary organogenesis. At all stages of soybean cotyledonary organogenesis, the relative expression level of the GmSTM17 gene was significantly higher in Suinong 14 than in Dongnong 50. Since Dongnong 50 is a high-reproducibility variety and Suinong 14 is a low-reproducibility variety, GmSTM17 may negatively regulate soybean cotyledonary organogenesis.

[0112] Example 2: Obtaining GmSTM17 mutant material

[0113] 2.1 Construction of PGES401-GmSTM17 gene editing vector

[0114] The gene editing vector used was PGES401, which employs the PM4 promoter for efficient Cas9 protein expression, making it effective for dicotyledonous plants. This vector also includes a selection bar. First, target sequences were designed and selected. The genomic sequence of GmSTM17 was designed using the CRISPR-GE website (http: / / skl.scau.edu.cn / ), selecting target sequences with high target scores, low off-target probability, and suitable locations. The corresponding target sequences were synthesized, digested, and ligated into the PGES401 gene editing vector to obtain the recombinant expression vector PGES401-GmSTM17-Target. The target sequence of the GmSTM17 genome (GmSTM17-Target) is as follows:

[0115] GmSTM17-Target(5'-3'):ACAAAACCAGCACTAACACT().

[0116] 2.2 Soybean genetic transformation 2.2.1 Agrobacterium EHA105 competent cell transformation

[0117] (1) Clean the electric shock cup three times with anhydrous ethanol and dry it in a clean bench.

[0118] (2) Place the electric shock cup in an ice bath for 20 minutes to melt the EH105 competent cells on the ice.

[0119] (3) Add 1 μL of the correctly sequenced expression vector plasmid to the competent cells, and add Agrobacterium competent cells to the electroporation cup for electroporation.

[0120] (4) The competent cells after electric shock were resuspended in 1 mL of liquid YEP medium, and 100 μL was spread on a solid YEP plate containing 100 mg / L spectinomycin and 100 mg / L rifampin.

[0121] (5) Incubate the plates at 28°C for 48 hours, and pick single colonies for PCR identification.

[0122] 2.2.2 Soybean genetic transformation

[0123] (1) Explant preparation

[0124] Take mature Dongnong 50 soybean seeds with smooth surfaces and no disease spots. First, let them stand in a 150mL Erlenmeyer flask with 75% ethanol for 5 minutes. Then, sterilize them with 15% H2O2 at 28℃ and shake at 100rpm for 15 minutes. Finally, wash them with ddH2O until the water is clear. Add 50mL of ddH2O and incubate at 4℃ for 1-2 days.

[0125] (2) Preparation of engineered bacterial culture

[0126] Streak Agrobacterium suspension at 28°C and invert for 2-3 days. Select single colonies and inoculate them into 3 mL of YEP liquid medium (50 mg / L kanamycin, 25 mg / L rifampin), and incubate at 28°C for approximately 24-48 hours. The next day, expand the culture (50 mL YEP) until the OD600 nm reaches 0.6-0.8. Centrifuge the cells at 3000 rpm for 10 min and resuspend them in a liquid co-culture medium (B5 salt, B5 vitamin, sucrose 30 g / L, MES 3.9 g / L, BAP 1.67 mg / L, GA3 0.25 mg / L, cysteine ​​400 mg / L, DTT 154.2 mg / L, AS 200 μmol / L, pH 5.4), and adjust the OD600. 600nm Set aside until 0.5 is available.

[0127] (3) Agrobacterium infection and co-culture

[0128] Soybean seeds were split open along the hilum using a scalpel, the skin was removed, and slight incisions were made at the cotyledon nodes. The prepared explants were then placed in resuspended Agrobacterium for 30 min of infection. The infected explants were then transferred to a co-culture medium (B5 salt, B5 vitamin, sucrose 30 g / L, MES 3.9 g / L, BAP 1.67 mg / L, GA3 0.25 mg / L, cysteine ​​400 mg / L, DTT 154.2 mg / L, AS 200 μmol / L, agar powder 5 g / L, pH 5.4) and incubated in the dark at 23°C for 4 days.

[0129] (4) Recovery culture and screening culture

[0130] After co-culturing the explants for 4 days, they were transferred to induction medium (B5 salt, B5 vitamin, sucrose 30 g / L, MES 0.59 g / L, BAP 1.67 mg / L, cephalosporin 250 mg / L, Timentin 100 mg / L, glufosinate 5–6 mg / L, agar powder 8 g / L, pH 5.7). The cotyledonary nodes and hypocotyl of the explants needed to be inserted into the medium at a 45° angle to the horizontal plane, with the adaxial surface facing upwards. They were cultured at 25°C under 16 / 8h light / dark conditions for approximately 2 weeks. Then, the explants were removed, and excess hypocotyl was trimmed, leaving only 5 mm. The explants were then transferred to fresh induction medium and cultured for another 2 weeks under the same conditions.

[0131] (5) Bud elongation culture

[0132] The induced shoot clusters (with cotyledon tissue removed) were transferred to shoot elongation medium (MS salts, MS vitamins, sucrose 30 g / L, MES 0.59 g / L, aspartic acid 50 mg / L, L-glutamic acid 50 mg / L, IAA 0.1 mg / L, GA3 0.5 mg / L, zeatin nucleoside 1.0 mg / L, cephalosporin 250 mg / L, Timentin 100 mg / L, glufosinate 5–6 mg / L, agar powder 8 g / L, pH 5.7) and cultured at 25°C with a 16 / 8 h light / dark cycle, subcultured every 2 weeks.

[0133] (6) Rooting

[0134] When the bud clusters grow to 3-5 cm, cut them off and soak them in IBA (1 mg / L) for 30 seconds. Then transfer them to rooting medium (MS salts, 20 g / L sucrose, 0.59 g / L MES, 50 mg / L aspartic acid, 50 mg / L L-glutamic acid, 1.0 mg / L IBA, 3 g / L plant gel, pH 5.6) for further cultivation. Once robust roots have developed, transplant them into a greenhouse for growth and fruiting.

[0135] (7) Detection of mutant plants

[0136] Take trifoliate compound leaves from soybean regenerated seedlings and test them with a bar test strip (Aojin Biotechnology, AG-002-GSLF). Detection ( Figure 3 DNA was extracted from transformed seedlings (A) and subjected to specific PCR detection. Positive mutant plants were then subjected to PCR detection using primers shown in Table 4 to detect the Bar gene. Specific primers were designed approximately 200 bp upstream and 100 bp downstream of the GmSTM17 target sequence (Table 4). PCR reactions were performed according to the system shown in Table 5, and the PCR reaction procedure is shown in Table 6.

[0137] Table 4 PCR reaction primers

[0138]

[0139] Table 5 PCR reaction system

[0140]

[0141] Table 6 PCR reaction program (30 cycles)

[0142]

[0143] The results are as follows Figure 3 In B, a total of 8 independent T0 generation conversion events (lines) were identified, namely Figure 3 The first lane is wild-type, and lanes 2-9 are the eight independent T0 generation transformation events (lines) identified.

[0144] 2.3 Screening of homozygous mutant plants

[0145] 2.3.1 Using the DNA of the receptor material Dongnong 50 (WT) as a template, and with an annealing temperature ranging from 63℃ to 69℃, the limiting annealing temperature of the detection primers was identified by gradient PCR. The results are as follows: Figure 4 As shown, the limiting annealing temperature is 67℃.

[0146] This limiting annealing temperature was used to identify homozygous GmSTM17 mutants. Seeds from T0 generation mutant plants were harvested and sown to obtain T1 generation mutant plants. The first trifoliate leaf of each T1 generation mutant plant was used for ACT-PCR, as shown in Tables 5 and 6, to detect homozygous mutant plants. A total of 95 T1 generation mutant plants were selected for testing. Figure 5 It was found that among the 95 mutant plants to be tested, 22 were homozygous mutant plants (no band or faint band). The remaining 73 were heterozygous mutant plants or non-mutant plants. After gene editing and next-generation sequencing, 8 homozygous mutant materials were finally obtained (Table 8), and the primer information for the ACT-PCR reaction is shown in Table 7.

[0147] Table 7. Primer information for mutant detection

[0148]

[0149] Table 8 Gene Editing Types of GmSTM17 T1 Generation Homozygous Mutants

[0150]

[0151] The mutant stm17-1, compared with the wild-type soybean Dongnong 50, has the following mutation in the GmSTM17 gene in the soybean genome on two homologous chromosomes: the 5'-ACAAAACCAGCACACT-3' (SEQ ID No. 1, positions 1514-1533) in the GmSTM17 gene in the soybean genome is replaced by 5'-ACAAAACCAGCACACT-3' (SEQ ID No. 4), thereby knocking out the GmSTM17 gene.

[0152] The mutant stm17-2, compared with the wild-type soybean Dongnong 50, has the following mutation in the GmSTM17 gene in the soybean genome on two homologous chromosomes: the 5'-ACAAAACCAGCACTAACACT-3' (SEQ ID No. 1, positions 1514-1533) in the GmSTM17 gene in the soybean genome is replaced by 5'-ACAAAACCAGCACTAAACT-3' (SEQ ID No. 5), thereby knocking out the GmSTM17 gene.

[0153] The mutant stm17-3, compared with the wild-type soybean Dongnong 50, has the following mutation in the GmSTM17 gene in the soybean genome on two homologous chromosomes: the 5'-ACAAAACCAGCACTAACACT-3' (SEQ ID No. 1, positions 1514-1533) in the GmSTM17 gene in the soybean genome is replaced by 5'-ACAAAACCAGCACAACT-3' (SEQ ID No. 6), thereby knocking out the GmSTM17 gene.

[0154] The mutant stm17-4, compared with the wild-type soybean Dongnong 50, has the following mutation in the GmSTM17 gene in the soybean genome on two homologous chromosomes: the 5'-ACAAAACCAGCACTAACACT-3' (SEQ ID No. 1, positions 1514-1533) in the GmSTM17 gene in the soybean genome is replaced by 5'-ACAAAACCAGCGACTAACACT-3' (SEQ ID No. 7), thereby knocking out the GmSTM17 gene.

[0155] The mutant stm17-5, compared with the wild-type soybean Dongnong 50, has the following mutation in the GmSTM17 gene in the soybean genome on two homologous chromosomes: the 5'-ACAAAACCAGCACACT-3' (SEQ ID No. 1, positions 1514-1533) in the GmSTM17 gene in the soybean genome is replaced by 5'-ACAAAACCAGCACACT-3' (SEQ ID No. 8), thereby knocking out the GmSTM17 gene.

[0156] The mutant stm17-6, compared with the wild-type soybean Dongnong 50, has the following mutation in the GmSTM17 gene in the soybean genome on two homologous chromosomes: the 5'-ACAAAACCAGCACTAACACT-3' in the GmSTM17 gene of the soybean genome is replaced by 5'-ACAAACT-3' (positions 1514-1533 of SEQ ID No. 1), thereby knocking out the GmSTM17 gene.

[0157] The mutant stm17-7, compared with the wild-type soybean Dongnong 50, has the following mutation in the GmSTM17 gene in the soybean genome on two homologous chromosomes: the 5'-ACAAAACCAGCTT-3' (SEQ ID No. 1, positions 1514-1533) in the GmSTM17 gene in the soybean genome is replaced by 5'-ACAAAACCAGCTT-3' (SEQ ID No. 9), thereby knocking out the GmSTM17 gene.

[0158] The mutant stm17-8, compared with the wild-type soybean Dongnong 50, has the following mutation in the GmSTM17 gene in the soybean genome on two homologous chromosomes: the 5'-ACAAAACCAGCACTAACACT-3' (SEQ ID No. 1, positions 1514-1533) in the GmSTM17 gene in the soybean genome is replaced by 5'-ACAACAACAACACT-3' (SEQ ID No. 10), thereby knocking out the GmSTM17 gene.

[0159] Example 3: Identification of cotyledonary organogenesis in T2 generation homozygous mutant soybean plants

[0160] 3.1 Test Methods

[0161] 3.1.1 Seed sterilization and disinfection

[0162] Seeds produced by homozygous T1 plants are the homozygous T2 mutants. Ninety seeds each of wild-type Dongnong 50 (hereinafter also referred to as wild-type DN50 or WT) and T2 mutants (stm17-2, stm17-6, and stm17-7) with plump seeds and no disease spots were selected. First, the seeds were incubated in a 150mL Erlenmeyer flask with 75% ethanol for 5 minutes. Then, they were sterilized with 15% H2O2 at 28℃ and shaken at 100rpm for 15 minutes. Finally, they were washed with ddH2O until the water was clear. Then, 50mL of ddH2O was added, and the plants were incubated at 4℃ for 1-2 days.

[0163] 3.1.2. Induction and culture of clustered shoots

[0164] Take the seed material cultured in the previous step, divide the seed into two explants along the cotyledons, retaining 3-5 mm at the junction of the hypocotyl and cotyledon, and remove the excess hypocotyl. Remove the true leaves at the junction of the cotyledon and hypocotyl. Inoculate the treated explants into SIM medium (B-5 medium + 0.60 g / L MES + 3.00% sucrose + 0.80% agar + vitamin B5 + 1.67 mg / L 6-BA; pH = 5.7) and culture for 14 days. Inoculate 20 explants per plate according to the "4-6-6-4" principle, which is considered one replicate. Set up 3 biological replicates for each material.

[0165] 3.1.3. Cultivation of Clustered Bud Elongation

[0166] Explants cultured in SIM medium for 14 days were selected, and those with obvious clustered bud primordia were chosen. Cotyledons, hypocotyls, and primary stems and leaves were removed. Explants were inoculated into SEM medium (MS medium + 0.6 g / L MES + 3% sucrose + 0.8% agar + vitamin B5 + 0.5 mg / L GA3 + 0.10 mg / L IAA + 1.00 mg / L Zeatin-R + 100 mg / L Glu + 100 mg / L Asp; pH = 5.7) and cultured for 28 days. Five explants were inoculated per dish according to the "2-1-2" principle, and subcultured every 14 days.

[0167] 3.1.4. Rooting culture of clustered buds

[0168] During the elongation culture of the bud clusters, the bud clusters that have grown to more than half the height of the culture dish are cut off with surgical scissors. The wound is dipped in 1 mg / mL IBA and inserted into RM medium (1 / 2 B5 medium + 0.59 g / L MES + 2.00% sucrose + 0.80% agar + 250 mg / L cephalosporin; pH = 5.8) and cultured for 7-10 days.

[0169] 3.1.5 Phenotypic Identification During Cotyledonary Organ Development in Soybean

[0170] During soybean cotyledonary organogenesis, the number of explants with clearly induced shoot primordia was recorded on day 14 of shoot induction. The number of shoots elongating during shoot elongation culture was also recorded. Furthermore, the number of rooted shoots was counted during shoot rooting culture. Differences in regeneration indices among different materials were evaluated based on the indicators in Table 9.

[0171] Table 9 Phenotypic Identification Criteria for Cotyledonary Organ Development in Soybean

[0172]

[0173] 3.2. Phenotypic identification results of cotyledonary organogenesis in soybean GmSTM17 mutant material

[0174] Soybean cotyledonary organogenesis experiments were conducted on wild-type DN50(WT) and GmSTM17 gene-edited mutants, respectively. Figure 6 As shown, during the SIM14 stage of soybean cotyledonary organogenesis, the stm17-2, stm17-6, and stm17-7 mutants were superior to WT in both the number of explants induced to produce shoot clusters per culture dish and the number of shoot clusters induced from explants. The regeneration potential of stm17-2, stm17-6, and stm17-7 was significantly higher than that of WT. Figure 7 This indicates that the GmSTM17 gene negatively regulates the regenerative potential of soybean cotyledonary organogenesis.

[0175] The regeneration efficiency (RE) and regeneration rate (RR) of the WT and GmSTM17 gene-edited mutants were identified at the SEM14 stage of soybean cotyledonary organogenesis. Figure 8 It can be seen that, compared with WT, STM17-2, STM17-6, and STM17-7 are superior to WT in both the number and speed of shoot elongation. In terms of regeneration efficiency and rate, STM17-2 and STM17-7 are significantly higher than WT in both. STM17-6 is significantly higher than WT in both regeneration efficiency and rate. Figure 9 , Figure 10 ).

[0176] Example 4: Scanning electron microscopy of explants from soybean cotyledonary organogenesis.

[0177] 4.1 Test Methods

[0178] 4.1.1 Sampling and Fixation of Scanning Electron Microscopy Samples

[0179] Soybean cotyledonary explants cultured in SIM medium for 14 days and shoot tips of elongated clustered shoots cultured in SEM medium for 28 days were taken from Example 3. They were fixed in pentylene glycol (pH=6.8) and then placed at 4°C for 1.5 hours for further fixation.

[0180] 4.12 Scanning Electron Microscopy Sample Cleaning and Dehydration

[0181] Rinse the sample three times with 0.1 mol PBS buffer (pH=6.8), 10 min each time. After rinsing, dehydrate the sample once with 50%, 70%, and 90% ethanol, respectively. Dehydrate the sample 2-3 times with anhydrous ethanol, 10-15 min each time.

[0182] 4.1.3 Scanning Electron Microscopy Sample Replacement and Drying

[0183] The samples that had been completely dehydrated according to 1.5.2 were replaced once with replacement solution (anhydrous ethanol: pure tert-butanol = 1:1), and then replaced twice with pure tert-butanol, each time for 15 min. The replaced samples were then placed at -20℃ for 30 min and then dried in an ES-2030 (HITACHI) freeze dryer for 4 h.

[0184] 4.14. Coating and mounting of scanning electron microscope samples

[0185] The dried sample was attached to the scanning electron microscope stage with conductive tape. After depositing a 100-150 angstrom metal film on the sample surface using an ion sputtering coating instrument, it was then examined using a benchtop scanning electron microscope (TM4000).

[0186] 4.2 Scanning electron microscopy of explants from soybean cotyledonary organogenesis of GmSTM17 mutant material

[0187] Depend on Figure 11 According to AH, the size and plumpness of the meristematic cells in the clustered shoots of STM17-2, STM17-6, and STM17-7 explants were superior to those in WT. Figure 11 As shown in Figure I, the size of the shoot meristem cells in the explants of the stm17-6 mutant at the SIM14 stage was significantly larger than that of the WT. Similarly, the size of the shoot meristem cells in the explants of the stm17-2 and stm17-7 mutants at the SIM14 stage was also significantly larger than that of the WT. This indicates that the GmSTM17 gene has an inhibitory effect on the growth and development of shoot meristem cells.

[0188] in conclusion:

[0189] The regeneration potential, efficiency, rate, and size of shoot meristem cells in mutant materials edited with the GmSTM17 gene were identified and statistically analyzed. This study found that the regeneration potential, efficiency, and rate of the mutant explants were significantly enhanced. Scanning electron microscopy analysis of shoot meristem cells from SIM14-stage mutant explants revealed a significant increase in cell size after GmSTM17 gene editing. This study indicates that the GmSTM17 gene inhibits the growth and development of shoot meristem cells, thereby negatively regulating the regeneration potential, efficiency, and rate of soybean cotyledon node explants. These findings provide a theoretical basis for further elucidating the soybean regeneration mechanism and cultivating soybean varieties with high regeneration capacity.

[0190] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. A method for promoting the development of cotyledonary nodes in soybean, characterized in that: The method includes promoting cotyledonary organogenesis in recipient soybean by knocking out the gene encoding the GmSTM17 protein, the GmSTM17 protein being a protein with the amino acid sequence shown in SEQ ID No.

3.

2. The method according to claim 1, characterized in that: The gene encoding the GmSTM17 protein was knocked out by introducing an sgRNA gene targeting the gene encoding the GmSTM17 protein and a gene encoding the Cas protein into the recipient soybean.

3. The method according to claim 2, characterized in that: The target sequence of the sgRNA gene is positions 1514-1533 of SEQ ID No.

1.

4. A method for preparing soybeans with improved regeneration capacity, the method comprising obtaining target soybeans with higher regeneration capacity than the recipient soybeans by knocking out the gene encoding the GmSTM17 protein as described in claim 1 in the recipient soybean.

5. The method according to claim 4, characterized in that: The gene encoding the GmSTM17 protein in the recipient soybean was knocked out by introducing an sgRNA gene that targets the gene encoding the GmSTM17 protein and a gene encoding the Cas protein into the recipient soybean.

6. The method according to claim 5, characterized in that: The target sequence of the sgRNA gene is positions 1514-1533 of SEQ ID No.

1.

7. Use of biomaterials associated with the GmSTM17 protein of claim 1 in any of the following: A1) Application in improving the tissue regeneration capacity of soybeans; A2) Application in the preparation of products that enhance the regeneration capacity of soybean tissues; A3) Application in improving the development of cotyledonary organogenesis in soybean; A4) Application in the preparation of products that enhance the development of soybean cotyledonary organelles; A5) Application in breeding to improve soybean regeneration ability; The biomaterial is any one of the following: B1) A nucleic acid molecule for knocking out the gene encoding the GmSTM17 protein as described in claim 1; B2), an expression cassette containing the nucleic acid molecule described in B1); B3), a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3); B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2), or a transgenic plant cell line containing the recombinant vector described in B3); B6) Transgenic plant tissue containing the nucleic acid molecules described in B1), or transgenic plant tissue containing the expression cassette described in B2), or transgenic plant tissue containing the recombinant vector described in B3); B7) Transgenic plant organs containing the nucleic acid molecules described in B1), or transgenic plant organs containing the expression cassette described in B2), or transgenic plant organs containing the recombinant vector described in B3).

8. The application according to claim 7, characterized in that: B1) The nucleic acid molecule is a DNA molecule that expresses sgRNA targeting the protein-coding gene mentioned above.