Sorghum double-grain character gene SbDG2 and application thereof in regulation and control of double-grain sorghum formation

Abstract

The invention discloses a sorghum double-grain character gene SbDG2 and application thereof in regulating and controlling the formation of double-grain sorghum. The invention provides an application of any one of the following substances A1)-A3) in any one of the following substances E1-E4: E1) regulating and controlling the number of grains per ear of a plant; e2) regulating and controlling the plant yield; e3) regulating and controlling organ development of the plant spikelet; e4) regulating and controlling the formation of double seeds of the plant spikelet; a1) a protein SBDG2; a2) a nucleic acid molecule encoding the protein SBDG2; a3) a recombinant vector, an expression cassette or a recombinant bacterium containing a nucleic acid molecule encoding the protein SBDG2; the gene SbDG2 for controlling the double-grain character of the sorghum is cloned, and the grain number per ear and the production yield of the sorghum can be effectively improved by using the coding gene for genetic breeding.

Description

Technical Field

[0001] The invention belongs to the field of plant genetic engineering, and relates to a sorghum double-grain trait gene SbDG2 and an application thereof in regulating the formation of double-grain sorghum. Background Art

[0002] Sorghum (Sorghum bicolor (L.) Moench, 2n = 2x = 20) belongs to the genus Sorghum of the Poaceae family and is one of the five major cereal crops. It is used as a model crop for studying C4 plants in the Poaceae family because of its rich germplasm resources, high photosynthetic efficiency, and small genome (about 730Mb) (Andrew H. Paterson et al. (2009). The Sorghum bicolor genome and the diversification of grasses. Nature, 457 (7229), 551-556). Sorghum originated from the African continent. It not only has the characteristics of high protein, high sugar content and high biomass, but also has excellent stress resistance such as drought resistance, salinity resistance, high temperature resistance and barrenness resistance. It is called the "camel among crops". Sorghum has a wide range of uses. In addition to its important edible and nutritional value, it is also used as an important feed for ruminants, pigs and poultry, and is also used in industrial production such as bio-brewing and bioenergy (Tang Sanyuan, Xie Qi. (2019). Sorghum - Small Crop with Big Uses. Biotechnology Bulletin, 35(05):1). Sorghum will once again become an important cereal crop and gradually develop into an important industry for increasing farmers' income and agricultural efficiency. This will inevitably put forward newer and higher requirements for the yield and quality of sorghum. It is necessary to increase and accelerate the basic research and practical breeding of sorghum to meet the needs of sorghum industry development and consumer market.

[0003] In sorghum production, the number of spikelets per unit area, the number of grains per spikelet and the thousand-grain weight constitute the three key factors of sorghum yield, especially the number of grains per spikelet plays a leading role, accounting for 52% of the effect, followed by the thousand-grain weight. Therefore, increasing the number of grains per spikelet or increasing the thousand-grain weight can significantly increase the total yield of sorghum (Andrew Borrell et al. (1999). Stay-green trait associated with yield in recombinant inbred sorghum lines varying in rate of leaf senescence. International Sorghum and Millets newsletter., 40 (40), 31-34). In general, the stalked spikelets of sorghum will be sterile and not fruitful, while the sessile spikelets can develop normally into fruitful spikelets. The sessile spikelets contain two florets, the superior flower and the inferior flower. The inferior flower usually aborts and leaves only one lemma, while the superior flower develops normally and eventually produces one seed. Some special sorghum varieties show double (multiple) grain traits, that is, two or more seeds are produced in one spikelet, which can increase the number of grains per spikelet and have the potential to increase yield. Since 1936, reports on the double-grain trait of sorghum have begun to appear. After observing different double-grain sorghum materials, it was found that the double-grain phenotype of spikelets is caused by different reasons: one reason is the normal development of the lower flowers, and this double-grain trait is controlled by a dominant locus; and the other double-grain phenomenon is caused by the formation of two pistils in the upper flowers (Karper RE (1936). Floral abnormalities insorghum. Journal of Heredity, 27 (5), 183-194). Although some studies on the double-grain trait of sorghum have appeared at home and abroad in the subsequent process, the genetic basis and molecular mechanism of this trait are still unclear. Therefore, fully exploring and cultivating excellent new varieties with double-grain traits and trying to analyze their molecular regulatory mechanisms have important theoretical significance and application value for improving the number of grains per spikelet and high-yield breeding of sorghum. Summary of the invention

[0004] The technical problem to be solved by the present invention is how to promote the formation of double seeds in plant spikelets.

[0005] In order to solve the above technical problems, the first aspect of the present invention provides the use of any one of the following substances A1)-A3) in any one of the following E1-E4:

[0006] E1) Regulate the number of grains per ear in plants;

[0007] E2) regulating plant yield;

[0008] E3) regulates the development of plant spikelet floral organs;

[0009] E4) regulates the formation of double seeds in plant spikelets;

[0010] A1) Protein SBDG2;

[0011] A2) a nucleic acid molecule encoding protein SBDG2;

[0012] A3) a recombinant vector, expression cassette or recombinant bacterium containing a nucleic acid molecule encoding protein SBDG2;

[0013] The protein SBDG2 is as follows B1) or B2) or B3):

[0014] B1) a protein consisting of the amino acid sequence shown in Sequence 4 in the sequence list;

[0015] B2) a protein derived from B1) with the same function as the amino acid sequence shown in Sequence 4 in the sequence list, wherein one or more amino acid residues are substituted and / or deleted and / or added;

[0016] B3) A fusion protein obtained by connecting a protein tag to the N-terminus or / and C-terminus of B1) or B2).

[0017] The protein mentioned above is derived from sorghum.

[0018] The one or more amino acid residues mentioned above may specifically be within ten amino acid residues.

[0019] The above proteins can be artificially synthesized, or their encoding genes can be synthesized first and then expressed biologically.

[0020] In the above proteins, the protein tag refers to a polypeptide or protein that is fused and expressed with the target protein using DNA in vitro recombination technology to facilitate the expression, detection, tracing and / or purification of the target protein. The protein tag can be a Flag tag, a His tag, an MBP tag, an HA tag, a Myc tag, a GST tag and / or a SUMO tag, etc.

[0021] In the above application, the nucleic acid molecule encoding protein SBDG2 is any one of the following nucleic acid molecules C1)-C3):

[0022] C1) The coding region includes the nucleic acid molecule shown in sequence 1, 2 or 3 in the sequence list;

[0023] C2) a nucleic acid molecule that hybridizes with the DNA sequence defined in C1) under stringent conditions and encodes a protein having the same function;

[0024] C3) is a nucleic acid molecule that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% homology with the DNA sequence defined in C1) and encodes a protein with the same function.

[0025] The term "identity" refers to sequence similarity to a natural nucleic acid sequence. Identity can be evaluated by the naked eye or by computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0026] In the above, the nucleic acid molecule may be a DNA or cDNA or CDS molecule.

[0027] In a second aspect, the present invention provides a substance for inhibiting or reducing the activity or content of the protein SBDG2 described in the first aspect, or a substance for inhibiting the expression of a nucleic acid molecule encoding the protein SBDG2 described in the first aspect, in any of the following uses:

[0028] F1) Increase the number of grains per ear in plants;

[0029] F2) Increase plant yield;

[0030] F3) causes abnormal development of spikelet floral organs in plants;

[0031] F4) promotes the formation of double seeds in plant spikelets.

[0032] In the above, causing the plant spikelet floral organ to develop abnormally means causing the pistil and / or stamen of the plant spikelet to develop abnormally, which is specifically embodied in that the pistil and / or stamen of the spikelet develop abnormally compared with the wild-type plant.

[0033] In the application described above, the substance is a crisp system that inhibits the expression of the nucleic acid molecule encoding the protein SBDG2;

[0034] The crisp system includes sgRNA targeting SBDG2,

[0035] The target sites of the sgRNA are shown at positions 400-419 and / or positions 652-671 in Sequence Listing 1.

[0036] In the above application, the substance for reducing the expression of the gene may be an agent for knocking out the nucleic acid molecule encoding the protein SBDG2, such as an agent for knocking out the gene by homologous recombination, or an agent for knocking out the gene by CRISPR / Cas9. The agent for inhibiting or reducing the expression of the gene may comprise a polynucleotide targeting the gene, such as siRNA, shRNA, sgRNA, miRNA or antisense RNA.

[0037] In an embodiment of the present invention, the material crisp system includes a pYLCRISPR / Cas9 Pubi-B-SbDG2 vector, which contains the target sites of the sgRNA shown at positions 400-419 and / or positions 652-671 of Sequence Listing 1.

[0038] In a third aspect, the present invention provides a method for cultivating a transgenic plant with two spikelets and two seeds, which is as follows D1) or D2):

[0039] D1) The method comprises the following steps: reducing or inhibiting the content and / or activity of the protein SBDG2 in the target plant to obtain a transgenic plant;

[0040] D2) The method comprises the following steps: reducing or inhibiting the expression of a nucleic acid molecule encoding protein SBDG2 in a target plant to obtain a transgenic plant;

[0041] The transgenic plant is a spikelet-two-seed plant;

[0042] The protein SBDG2 is as follows B1) or B2):

[0043] B1) a protein consisting of the amino acid sequence shown in Sequence 4 in the sequence list;

[0044] B2) A protein derived from B1) with the same function as that of B1) by replacing and / or deleting and / or adding one or more amino acid residues in the amino acid sequence shown in Sequence 4 in the sequence listing.

[0045] In a fourth aspect, the present invention provides a method for cultivating transgenic plants with increased grain number per ear, which is as follows D1) or D2):

[0046] D1) The method comprises the following steps: reducing or inhibiting the content and / or activity of the protein SBDG2 in the target plant to obtain a transgenic plant;

[0047] D2) The method comprises the following steps: reducing or inhibiting the expression of a nucleic acid molecule encoding protein SBDG2 in a target plant to obtain a transgenic plant;

[0048] The transgenic plant has a greater number of grains per ear than the target plant;

[0049] The protein SBDG2 is as follows B1) or B2):

[0050] B1) a protein consisting of the amino acid sequence shown in Sequence 4 in the sequence list;

[0051] B2) A protein derived from B1) with the same function as that of B1) by replacing and / or deleting and / or adding one or more amino acid residues in the amino acid sequence shown in Sequence 4 in the sequence listing.

[0052] In a fifth aspect, the present invention provides a method for cultivating transgenic plants with increased yield, which is as follows D1) or D2):

[0053] D1) The method comprises the following steps: reducing or inhibiting the content and / or activity of the protein SBDG2 in the target plant to obtain a transgenic plant;

[0054] D2) The method comprises the following steps: reducing or inhibiting the expression of a nucleic acid molecule encoding protein SBDG2 in a target plant to obtain a transgenic plant;

[0055] The transgenic plant has a greater yield than the target plant;

[0056] The protein SBDG2 is as follows B1) or B2):

[0057] B1) a protein consisting of the amino acid sequence shown in Sequence 4 in the sequence list;

[0058] B2) A protein derived from B1) with the same function as that of B1) by replacing and / or deleting and / or adding one or more amino acid residues in the amino acid sequence shown in Sequence 4 in the sequence listing.

[0059] In the above, the reduction or inhibition of the content and / or activity of the protein SBDG2 in the target plant, or the reduction or inhibition of the expression of the nucleic acid molecule encoding the protein SBDG2 in the target plant, can be the inhibition or reduction of at least one of the following 6 regulatory substances: 1) regulation at the transcription level of the gene; 2) regulation after transcription of the gene (that is, regulation of the splicing or processing of the primary transcript of the gene); 3) regulation of RNA transport of the gene (that is, regulation of the transport of the mRNA of the gene from the nucleus to the cytoplasm); 4) regulation of the translation of the gene; 5) regulation of the degradation of the mRNA of the gene; 6) post-translational regulation of the gene (that is, regulation of the activity of the protein translated from the gene).

[0060] In the above application, the reduction or inhibition of the expression of the nucleic acid molecule encoding the protein SBDG2 in the target plant can be achieved by gene knockout or gene silencing.

[0061] The gene knockout refers to the phenomenon of inactivating a specific target gene through homologous recombination. Gene knockout is the inactivation of a specific target gene by changing the DNA sequence.

[0062] The gene silencing refers to the phenomenon of making the gene non-expressed or low-expressed without damaging the original DNA. Gene silencing is based on the premise of not changing the DNA sequence, making the gene non-expressed or low-expressed. Gene silencing can occur at two levels, one is gene silencing at the transcriptional level caused by DNA methylation, heterochromatinization and position effect, and the other is post-transcriptional gene silencing, that is, at the level after gene transcription, the gene is inactivated by specifically inhibiting the target RNA, including antisense RNA, co-suppression, gene repression, RNA interference (RNAi) and microRNA (miRNA)-mediated translation inhibition, etc.

[0063] The above-mentioned reduction or inhibition of the content and / or activity of the protein SBDG2 in the target plant, or the reduction or inhibition of the expression of the nucleic acid molecule encoding the protein SBDG2 in the target plant is achieved by knocking out the gene encoding the protein mentioned above in the target plant. Specifically, a substance that reduces or inhibits the expression of the gene encoding the protein mentioned above is introduced into the recipient plant.

[0064] The reduction or inhibition of the expression level of the protein encoding gene or the activity or content of the protein in the recipient plant mentioned above can be achieved by any method in the prior art, so that the gene produces a deletion mutation, an insertion mutation or a base conversion mutation, thereby achieving a reduction or loss of gene function, specifically chemical mutagenesis, physical mutagenesis, RNAi, genome site-directed editing or homologous recombination, etc.

[0065] In the above-mentioned genome fixed-site editing method, zinc finger nuclease (ZFN) technology, transcription activator-like effector nuclease (TALEN) technology or clustered regularly interspaced short palindromic repeats and their related systems (Clustered regularly interspaced short palindromic repeats / CRISPR associated, CRISPR / Cas9 system) technology, and other technologies that can achieve genome fixed-site editing can be used. Regardless of which method is adopted, the entire coding gene of the protein described above can be used as a target, and each element that regulates the expression of the protein coding gene described above can be used as a target, as long as the gene function loss or reduction can be achieved. For example, the exon or 5'UTR of the coding gene of the protein described above can be used as a target.

[0066] The invention hybridizes two sorghum materials with double-grain traits (W060 (PI 221608), P034 (PI533838)) with three sorghum materials with single-grain traits (P210 (PI 613536), P243 (PI 655993) and P252 (PI 656003)) to create F1 plants and F2 segregation populations, and finally obtains a key site controlled by a single recessive site and regulating the double-grain trait of sorghum by positional cloning, and names it DG2 (Double-Grain 2). The candidate gene of the DG2 site is a transcription factor SbDG2 (Sobic.003G282400) encoding a MADS-box protein, and the encoding gene is an important factor that negatively regulates the formation of double-grain seeds in sorghum spikelets. When the gene mutates, it can cause abnormal development of the superior flower of the sessile spikelet, forming two pistils, thereby producing the double-grain trait. The invention innovatively clones a gene SbDG2 that controls the double-grain trait of sorghum. Using this coding gene for genetic breeding can effectively increase the number of grains per ear and production yield of sorghum. The sorghum germplasm resources used in the present invention are introduced from the germplasm resource bank of the United States Department of Agriculture. (References: Morris GP, Ramu P, et al. (2013) Population genomic and genome-wide association studies of agroclimatic traits in sorghum. Proc Natl Acad Sci USA 110: 453-458; Burks PS, Kaiser CM, et al. (2015) Genome-wide association for sugar yield in sweet sorghum. Crop Sci 55: 2138-2148.) BRIEF DESCRIPTION OF THE DRAWINGS

[0067] Figure 1 The figures are the phenotypes of the double-grain sorghum material W060, the single-grain sorghum material P252 and their hybrid F1 generation sorghum spikelets; A is the double-grain spikelet in the W060 spikelet, and the single-grain spikelet in the P252 spikelet; the upper ruler is 1 cm long, and the lower ruler is 5 mm long; B is the proportion of double-grain spikelets in W060, P252 and their F1 (W060×P252).

[0068] Figure 2 The scanning electron microscope observations of spikelets of the single-grain sorghum material P252 and the double-grain sorghum material W060. A and B are the second and third stages of the development of the spikelet of P252, respectively; C and D are the second and third stages of the development of the spikelet of W060, respectively. The scale bar length is 50 μm.

[0069] Figure 3 The stamen and pistil structures of the spikelets of the single-grain sorghum material P252 and the double-grain sorghum material W060; A is the spikelet of P252, which contains 3 stamens and 1 pistil, and the pistil consists of an ovary, two stigmas and a style; B is the spikelet of W060, which contains 3 stamens, and there are 3 types of pistils: the same as the wild-type P252 pistil; two pistils, each consisting of an ovary, two stigmas and a style; one pistil, consisting of an ovary, three stigmas and a style. The scale length of the picture is 1 mm.

[0070] Figure 4 Fine mapping of the DG2 locus that controls double-grain sorghum traits.

[0071] Figure 5 Figure 2 shows the sequence differences of SbDG2 between different double-grain sorghum materials; A is the schematic diagram of the SbDG2 gene in the single-grain sorghum material P252, which consists of 5 exons and 4 introns; in the double-grain sorghum material W060, there is a single base insertion at 2293 bp of the SbDG2 coding gene; and in the double-grain sorghum material P034, there is an 18 bp deletion at 431 bp of the SbDG2 coding gene; B is the schematic diagram of the SbDG2 gene in the single-grain sorghum material P Schematic diagram of the structure of SbDG2 protein in P252 and double-grain sorghum materials W060 and P034; in P252, the 1st to 57th amino acids of SbDG2 protein are the MADS region, the 58th to 87th amino acids are the K region, the 88th to 171th amino acids are the I region, and the 172th to 191th amino acids are the C-terminus; in W060, the SbDG2 protein lacks the C region, and in P034, the SbDG2 protein lacks 6 amino acids in the K region.

[0072] Figure 6 The knockout target design of SbDG2 and the editing form of its knockout strain; A is the knockout target design information of SbDG2 gene; B is the editing form of the knockout strain of SbDG2 gene; C is the sequence alignment of SbDG2 protein among the knockout strains; green represents the MADS region, orange represents the I region, blue represents the K region, and pink represents the C terminus.

[0073] Figure 7 Observation of spikelets of wild-type sorghum and SbDG2 gene knockout lines; A is a wild-type spikelet, containing 3 stamens and 1 pistil; B is a SbDG2 gene knockout line DG2 KO-1Several common variant types of spikelets (B1 has no stamens and forms two pistils; B2 has no stamens and has three stigmas on the ovary; B3 has one stamen, the ovary has abnormal morphology and has three stigmas. B4 has no stamens, the ovary has four stigmas, and there is a lodicet-like tissue in the middle of the four styles; B5 has an abnormal ovary morphology and a swollen lodicet-like structure next to the pistil; B6 has one stamen and one pistil); C is the knockout strain DG2 of the SbDG2 gene KO-2 Several common variation types of spikelets (C1 has no stamens and forms two pistils; C2 has no stamens and three stigmas are attached to the ovary; C3 forms one stamen and one pistil; C4 forms one stamen and a mass-like structure is formed on the side of the pistil; C5 has no stamens, the ovary, style and stigma in the pistil are abnormal in morphology, and an enlarged lodicule-like tissue is formed next to the pistil; C6 has no stamens, and two spikelet structures appear next to the stamens); the scale bar length is 1 mm; D is a comparison of spikelet seeds between the wild type and the SbDG2 gene knockout strain, and the scale bar length is 3 mm.

[0074] Figure 8 is the expression pattern of SbDG2; A is the relative expression level of SbDG2 in different sorghum tissues, and the expression level of SbDG2 gene was analyzed in roots, stems, leaves, panicles less than 1 cm, panicles 1 cm-2 cm, panicles greater than 2 cm, panicles at flowering stage, seeds at filling stage and mature stage; BF are the expression patterns of SbDG2 in spikelets of P252 and W060, among which B and C are the expression patterns of SbDG2 in the second and third periods of spikelet development of P252, respectively, D and E are the expression patterns of SbDG2 in the second and third periods of spikelet development of W060, respectively, and F is the negative control; the scale length of the picture is 50 μm.

[0075] Fig. 9 The wild-type sorghum and the SbDG2 knockout line DG2 KO-2 Expression analysis of MADS-box family genes in rice. Fluorescence quantitative PCR was used to analyze the expression levels of SbMADS13 (homologous gene of rice OsMADS13), SbMADS47 (homologous gene of rice OsMADS47), SbMADS3 (homologous gene of rice OsMADS3), SbMADS16 (homologous gene of rice OsMADS16), SbMADS22 (homologous gene of rice OsMADS22), and SbMADS56 (homologous gene of rice OsMADS56). DETAILED DESCRIPTION

[0076] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0077] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0078] Unless otherwise specified, the quantitative tests in the following examples were performed three times and the results were averaged.

[0079] In the following examples, the extraction of RNA from sorghum spikelets was performed using the Beijing Huayueyang Polysaccharide and Polyphenol Plant RNA Extraction Kit, and the specific operation was as follows:

[0080] (1) Take a fresh plant sample in a mortar and add liquid nitrogen to grind it thoroughly. Put about 50-100 mg of the sample into a centrifuge tube, add 1 mL of cell lysis buffer A, and shake vigorously.

[0081] (2) Transfer the liquid in the centrifuge tube to a new 1.5 mL centrifuge tube, add 300 μL of deproteinized solution B and 200 μL of chloroform, shake vigorously, and let stand for 3 min.

[0082] (3) Centrifuge at 12000 rpm for 15 min, take no more than 700 μL of the upper layer solution and add it to another new 1.5 mL centrifuge tube.

[0083] (4) Add an equal amount of supernatant volume of rinse solution C, mix well, transfer the liquid to the adsorption column, centrifuge at 12000 rpm for 1 min, and discard the waste liquid.

[0084] (5) Add 500 μL of column washing solution D, centrifuge at 12,000 rpm for 1 min, and discard the waste liquid; repeat this step once more and centrifuge at 12,000 rpm for 1 min.

[0085] (6) DNA digestion: Add 7 μL RNase-Free DNase I to 43 μL DNase buffer, mix well, incubate at 37°C in a water bath for 1 min, add to the center of the adsorption column, and let stand for 6 min.

[0086] (7) Add 500 μL of enzyme removal solution E, mix well, centrifuge at 12000 rpm for 1 min, and discard the waste liquid. Repeat the above steps once.

[0087] (8) Incubate at 12000 rpm for 2 min, discard the waste liquid, open the lid and let stand for 2 min to completely dry the adsorption column.

[0088] (9) Place the adsorption column in a new RNase-Free 1.5 mL centrifuge tube, add 30-80 μL RNA Elution Buffer F to the center of the column, let stand for 4 min, and centrifuge at 12,000 rpm for 1 min to obtain RNA. Repeat the elution once to increase the concentration. Measure the RNA concentration using a NanoDrop 2000 spectrophotometer and store at -80°C.

[0089] In the following examples, RNA extraction from sorghum leaves, roots, stems and other tissues was performed using the Plant Ultrapure RNA Extraction Kit of Kangwei Century, and the specific operation was as follows:

[0090] (1) Take a fresh plant sample, grind it thoroughly in liquid nitrogen, put about 50-100 mg of the sample into a centrifuge tube, add 1 mL of TRIzon Reagent, mix it with a pipette, and let it stand for 4 minutes.

[0091] (2) Add 200 μL of chloroform, vortex for 40 seconds, and let stand for 2 minutes.

[0092] (3) Centrifuge at 4°C, 12,000 rpm for 15 min. RNA is now present in the upper layer solution. Take an appropriate amount of the upper layer solution and add it to another new 1.5 mL RNase-Free centrifuge tube.

[0093] (4) Add an equal volume of 70% ethanol to the upper solution and mix thoroughly.

[0094] (5) Place the adsorption column into a collection tube, transfer the mixed solution to the same adsorption column twice, centrifuge at 12,000 rpm for 30 seconds, and discard the waste liquid.

[0095] (6) Add 700 μL buffer RW1, centrifuge at 12,000 rpm for 30 s, and discard the waste liquid.

[0096] (7) Add 500 μL buffer RW2 (add anhydrous ethanol before the first use), centrifuge at 12,000 rpm for 30 s, and discard the waste liquid; add 500 μL buffer RW2 and repeat this step once.

[0097] (8) Incubate at 12000 rpm for 2 min, discard the waste liquid, open the lid and let stand for 2 min to allow the adsorption column to dry completely.

[0098] (9) Place the adsorption column in another new RNase-Free 1.5 mL centrifuge tube, add 30-50 μL RNase-Free double distilled water, let stand for 2 min, centrifuge at 12,000 rpm for 1 min, and collect RNA. Repeat the collection to increase the RNA concentration. Use NanoDrop 2000 spectrophotometer to measure RNA concentration and store at -80°C.

[0099] In the following example, the reverse transcription of sorghum RNA into cDNA was completed using Tiangen's Fast Quant RT Kit. Thaw 10×Fast RT Buffer, RT Enzyme Mix, Q-RT Primer Mix and RNase-Free double distilled water on ice. Prepare a 10μL reaction system: 2μg RNA, 2μL 10×Fast RT Buffer, 2μL Q-RT Primer Mix, 1μL RT Enzyme Mix, add RNase-Free double distilled water to 10μL, mix well and centrifuge quickly. The reaction procedure is: incubate at 42℃ for 15min; incubate at 95℃ for 3min. After the reaction is completed, put it on ice immediately to obtain cDNA, which is stored at -20℃.

[0100] In the following examples, fluorescent quantitative PCR was performed using the Talent qPCR PreMix kit from Tiangen. First, prepare a 20 μL reaction system: 10 μL of 2×Talent qPCR PreMix, 3 μL of 20-fold diluted cDNA, 0.6 μL of each forward and reverse primer, and 5.8 μL of RNase-Free double distilled water. After mixing, centrifuge quickly and perform quantitative analysis using a two-step method on a Biorad CFX 96 instrument. The reaction procedure is: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 5 s, annealing / extension at 60°C for 15 s, and 45 cycles; prepare a melting curve at 65-95°C. A single peak in the curve indicates that the system is specifically amplified.

[0101] The operation method of the in situ hybridization experiment in the following examples is as follows:

[0102] (1) Use the digoxigenin in situ hybridization probe synthesis kit to synthesize the probe. Transcription system: 2μg template DNA, 2μL transcription buffer, 2μL nucleotides (UTP and dig-UTP mix), 1μL RNASIN (RNase inhibitor), 2μL RNA polymerase, and make up to 20μL with DEPC water.

[0103] (2) After the transcription is completed, take an appropriate amount of product, add loading buffer, and detect the size and brightness of the RNA band by electrophoresis. Usually, about 2 μg of RNA is synthesized in 2 hours. Add 1 μL of 100 mg / mL tRNA, 5 U of DNase and 80 μL of DEPC water, and incubate at 37°C for 10 minutes. Add 100 μL of 4M NH4OAc and 400 μL of anhydrous ethanol, place at -20°C for 20 minutes, and rotate at the highest speed for 10 minutes. Wash once with 70% ethanol and place on a clean bench to dry.

[0104] (3) Dissolve RNA in 100 μL DEPC water, add 100 μL carbonate buffer (80 mM NaHCO3 and 120 mM Na2CO3), keep warm at 60°C, add 10 μL 10% acetic acid. Add 1 / 10 volume of 3M NaOAc with a pH of 5.2 and two volumes of anhydrous ethanol, incubate at -20°C for 20 min. Dissolve RNA in 50% deionized formamide at a concentration of 1 μL / piece.

[0105] (4) The sectioning method is the same as above, except that all reagents and procedures must be RNAase-Free.

[0106] (5) Dewax the sections with xylene and rehydrate them with gradient concentrations of ethanol.

[0107] (6) Protease digestion of proteins on RNA. Preheat protease buffer (50 mM EDTA and 100 mM pH=8 Tris), take 400 mL of buffer and 80 μL of 5 mg / mL proteinase K stock solution and mix well. Place in a slice rack containing slices and treat at 37°C for 30 min.

[0108] (7) Take 6.6 mL of 0.1 M triethanolamine and add it to 500 mL of water. Adjust the pH to 8.0. Place an empty slice rack in the container as a support. Add 2.5 mL of acetic anhydride and quickly place it in the slice rack containing the slices. Gently shake for 10 min.

[0109] (8) Lay the slide flat on the bottom layer in a plastic box filled with anhydrous ethanol. Seal the box with Parafilm and store at 4°C.

[0110] (9) Hybridization: Add appropriate amount of 1% Blocking Reagent in 100mM Tris (pH=7.5) and 150mM NaCl (freshly prepared), and gently shake at room temperature for 45 minutes. Dissolve 1% BSA solution in 100mM Tris (pH=7.5), 150mM NaCl and 0.3% Triton X-100 solution, and continue to gently shake in this solution for 45 minutes. Dilute the antibody in the BSA / Tris / Triton solution at a ratio of 1:1250, take 150μL and add it to each slide, cover with Parafilm, and lay the slide flat in a wet box containing BSA / Tris / Triton solution, and seal it at room temperature for 2 hours.

[0111] (10) Gently shake the sample 4 times for 15 minutes each. Wash the sample once in 100 mM Tris (pH = 9.5), 100 mM NaCl and 50 mM MgCl2 for 10 minutes each. Then wash the sample once in Tris, NaCl and MgCl2 solutions of the same concentration. Electrophoresis at 150 V for 1 hour.

[0112] (11) Dilute NBT / BCIP with Tris, NaCl, and MgCl2 solutions of the same concentration at a ratio of 1:50. Add 200 μL to each slide, gently cover with Parafilm, lay flat in a humidified box, seal and protect from light at room temperature for 3 days. Observe and photograph under an optical microscope.

[0113] Example 1: Discovery and cloning of the DG2 gene controlling the double-grain trait in sorghum

[0114] 1. Phenotypic analysis of double-grain sorghum materials

[0115] The sessile spikelet of sorghum is a solid spikelet, which contains two florets, the superior flower and the inferior flower. The inferior flower usually aborts, leaving only one lemma; while the superior flower develops normally, forming the lemma, palea, two lodicules, three stamens and one pistil, producing one seed. After field phenotypic observation of all collected sorghum germplasm resources at the seed maturity period, two sorghum materials with double-grain traits were found, which were named W060 (PI 221608) and P034 (PI 533838), respectively. In addition, three sorghum materials with single-grain traits (P210 (PI 613536), P243 (PI 655993) and P252 (PI656003)) were selected as controls.

[0116] The observation results showed that, compared with the P252 material, some spikelets of the W060 material showed the phenomenon of double grains in one shell, and the statistical results showed that the proportion of double-grain spikelets in the W060 spikelets was 73.7% ( Figure 1). Then, the early development process of spikelets in W060 and P252 materials was observed using scanning electron microscopy ( Figure 2 ). The results showed that in the second stage of spikelet development (i.e., the period of glume and palea formation), the spikelets of P252 material produced outer glume, inner glume, first lemma and second lemma primordia. Similarly, the spikelets of W060 material also formed outer glume, inner glume, first lemma and second lemma primordia, and there was no structural difference with P252, and no additional floral meristem was observed. In the third stage of spikelet development, it can be observed that the floral meristem of the spikelets of P252 formed three stamens and one pistil primordia in the middle, while three stamens and two pistil primordia in the middle were observed in some spikelets of W060. Finally, the spikelets of the W060 and P252 materials at the upper, middle and lower parts of the panicle during the flowering period were observed under a stereomicroscope. It was found that the spikelets of the single-grain sorghum material P252 contained three stamens and one pistil, each pistil including one ovary and two stigmas; the spikelets of the double-grain sorghum material W060 also contained three stamens, but the number and morphology of the pistils in some spikelets varied: about 20% of the spikelets had the same morphology and number of pistils as the wild type, and the remaining about 75% of the spikelets formed two pistils in the middle of the three stamens, and about 5% of the spikelets were observed to have three stigmas on one ovary ( Figure 3 ). Based on the above observations, it was proved that the double-grain spikelet phenotype of the double-grain sorghum material W060 was caused by the development of two pistil primordia in the upper flower at the original pistil position.

[0117] 2. Map-based cloning of the DG2 locus controlling the double-grain trait in sorghum

[0118] 1. Genetic analysis of double-grain sorghum materials

[0119] Two double-grain sorghum materials (W060 (PI 221608) and P034 (PI 533838)) were used as the female and male parents, and were hybridized with three single-grain sorghum materials (P210 (PI 613536), P243 (PI 655993) and P252 (PI 656003)). After investigating the ear phenotypes of the F1 plants, it was found that the three F1 ears with W060 as the parent and the three F1 ears with P034 as the parent all showed single-grain traits, indicating that the double-grain phenotypes of W060 and P034 were controlled by recessive loci (Table 1). The F1 generation plants of the double-grain sorghum material W060 and the single-grain sorghum material P252 were further self-pollinated to obtain the F2 (W060×P252) population, and the ear phenotypes of all individual plants in the F2 population were investigated at the seed maturity stage. The results showed that in the F2 population, the ears showed separation of double-grain and single-grain traits. The chi-square test found that the separation ratio of plants showing single-grain traits and double-grain traits was 3:1 (Table 2), indicating that the double-grain trait of W060 was controlled by a single recessive locus, which was named Double-Grain 2 (DG2).

[0120] Table 1 shows the genetic analysis of three double-grain sorghum materials

[0121]

[0122] Table 2 shows the genetic segregation of the F2 populations from W060 and P252

[0123] <![CDATA[F2 population]]> Single grain Double Grain <![CDATA[χ 2 0.05 =3.84]]> W060×P252 170 54 0.55

[0124] 2. Preliminary and fine mapping of the DG2 locus controlling the double-grain trait in sorghum

[0125] First, 45 pairs of polymorphic SSR markers were identified and screened in the parental materials W060 and P252. Then, these SSR markers were used to detect 224 F2 (W060×P252) segregating populations. The results showed that the marker S3-19 located at the end of chromosome 3 was closely linked to the double-grain phenotype. Subsequently, markers were encrypted near S3-19, and recombinant plants were screened. DG2 was located in the initial positioning interval of about 1053kb between SSR3-68 and SSR3-123 markers (Table 3). In order to further fine-tune the DG2 locus, five plants with heterozygous genotypes in the DG2 interval, F2-63, F2-69, F2-177, F2-179 and F2-201, were selected from the F2 population and self-pollinated, and finally five F3 segregating populations and a total of 3217 plants were obtained. Based on the sequencing data of the whole genome of the parents, 15 pairs of Indel primers and 10 pairs of SNP primers were designed between the SSR3-68 and SSR3-123 markers, of which 5 pairs of Indel markers and 3 pairs of SNP markers showed polymorphism between the parents. All the individuals in the above F3 population were identified using these polymorphic markers. The results showed that 6 exchange individuals were identified at the position of marker Indel3-1, 5 exchange individuals were identified at Indel3-11, 5 exchange individuals were identified at the position of Indel3-14, 8 exchange individuals were identified at the position of SSR3-73, and 2 exchange individuals were identified at the position of SNP3-7. Through these five different types of recombinant individuals, the candidate interval was narrowed down to an interval of about 48kb between markers SNP3-7 and Indel3-11. In the five F3 populations derived from the two-grain sorghum material W060 and the one-grain sorghum material P252, there were a total of 3217 plants. After screening the recombinant plants, the DG2 locus was located in the 48kb interval between markers SNP3-7 and Indel3-11, which contained 6 annotated genes. According to the reference genome annotation information, the candidate interval contained 6 coding genes, namely Sobic.003G282100, Sobic.003G282200, Sobic.003G282300, Sobic.003G282400, Sobic.003G282500 and Sobic.003G282600 ( Figure 4 ).

[0126] The DNA used in the above process was extracted by CTAB method. Take an appropriate amount of sorghum leaves and put them into a 2mL centrifuge tube and add 5mm steel beads. After freezing in liquid nitrogen for 5min, use a high-speed sample crusher at 900rpm for 90s to grind the sample. After grinding, add 600μL of preheated CTAB extraction solution (1% CTAB, 1.4M NaCl, 2% PVP 4000, 20mM pH 8.0 EDTA, 100mM pH 8.0 Tris-HCl and 2% β-mercaptoethanol), shake vigorously and incubate in a 65℃ oven for 50min, invert and mix 2-3 times during the period. Then add 600μL of chloroform solution to the centrifuge tube, mix and centrifuge at 12000rpm for 15min. Pipette the supernatant into a new 1.5mL centrifuge tube, add an equal amount of supernatant volume of isopropanol solution, gently invert and mix, and place in a -20℃ refrigerator for more than 20min. Centrifuge at 8000rpm for 10min and discard the supernatant. Wash the precipitate twice with 1mL 70% ethanol. After discarding the supernatant, dry the remaining liquid, add 200μL double distilled water to dissolve the DNA, use NanoDrop 2000 to determine the DNA concentration, and store at -20℃ for future use.

[0127] The SSR markers used in the above process were identified by non-denaturing polyacrylamide gel electrophoresis. The PCR reaction system used was: 5 μL of 2×Taq PCR StarMix for PAGE, 0.1 μL of 10 μM forward and reverse primers, 50-100 ng DNA template, and double distilled water were added to 10 μL in a 10 μL reaction system. The amplification program used was: 94°C pre-denaturation for 5 min; 94°C denaturation for 30 s, 55°C annealing for 30 s, 72°C extension for 30 s, 35 cycles; 72°C extension for 7 min, -20°C storage. Finally, non-denaturing polyacrylamide gel electrophoresis was used to detect the PCR product: prepare a gel with a concentration of 8%, measure 12 mL of 40% acrylamide (Acr:Bis=39:1), 12 mL of 5×TBE solution, 600 μL of 20% ammonium persulfate, 50 μL of TEMED, and double distilled water to 60 mL. Take 4 μL of PCR product and spot it, adjust the voltage to 110V, and run the electrophoresis for 4 hours. After the electrophoresis, carefully remove the gel plate and use the silver staining method to develop the gel: place the gel in a 0.1% silver nitrate solution (1g of silver nitrate dissolved in 1L of double distilled water) for silver staining for 20 minutes; pour out the staining solution and wash the gel twice with double distilled water; add the developer (20g NaOH, 0.8g of anhydrous sodium carbonate, 1.5mL of formaldehyde solution, 1L of double distilled water) and place it on an oscillator for development for 20 minutes; pour out the developer, wash the gel twice with double distilled water, and take pictures and record.

[0128] The design steps of InDel markers used in the above process are: after resequencing the DNA of the parental materials, the Select Variants function of the GATK software is used to extract the InDel variant sites, and then the InDel sites with differences in the two parents and a length greater than 15bp are extracted using the Perl script. Finally, primers are designed near these InDel sites to perform PCR amplification on the parental DNA, and the primers that differ between the parents are selected as InDel markers. The PCR reaction system used is: add 10μL of 2×Taq PCRStarMix, 0.6μL of 10μM forward and reverse primers, 100-200ng DNA template, and add sterile double distilled water to make up to 20μL. The amplification program used is: 94℃ pre-denaturation for 5min; 94℃ denaturation for 30s, 57℃ annealing for 30s, 72℃ extension for 30s, 35 cycles; 72℃ extension for 7min, and storage at 4℃. The final PCR product is detected by agarose gel electrophoresis and photographed and recorded.

[0129] The SNP marker used in the above process is to extract the DNA of the parental materials, randomly design specific primers in the target interval according to the physical position, and perform PCR fragment amplification. The reaction system and procedure are the same as the above InDel marker. Finally, after sequencing the PCR product, the primers that show SNP differences between the two parents are found as SNP markers.

[0130] Table 3 shows some of the primers used in the DG2 locus localization process

[0131] Primer name Primer sequences S3-19F ATTCAGAGTTCGTCAGGAAA S3-19R TCAGGTAGTGCTTTGGACTT SSR3-68F AGCTCCAGTGATCACCCATT SSR3-68R CGCAAAGTTCTCCTTTCCAG SSR3-123F ATATCCGGACGGATGGTACA SSR3-123R GGATCAAAATGGGCATGAAG SSR3-73F CATCTCCGGCTCTTGTCAAC SSR3-73R CGAGGGCTTGAGAAATTACG Indel3-1F ATTAGTAGCGCCACGTCACAA Indel3-1R CCAGGCGATTCCCAAAGAGAT Indel3-11F CCTAAAGTTTACCGTCTGACCCA Indel3-11R GTGGGTCCTCATGTCGCATC Indel3-14F CCAAAGCACAGGTCTTGAGGG Indel3-14R CACTGATAATTTGGACCCGCCT SNP3-7F CCCAAATGGAACCCGGAAAC SNP3-7R TGGGGATTACCAGGAAAAGATTGA

[0132] 3. Identification of sequence differences of candidate gene SbDG2 among different sorghum materials

[0133] Using the genomic DNA of the parental materials as a template, primers were designed to amplify and identify the six coding genes contained in the candidate interval. The final sequencing results showed that only one gene (gene number Sobic.003G282400) had a difference in the coding region sequence between the single-grain and double-grain parents. Compared with the wild type, the Sobic.003G282400 gene caused a frameshift mutation due to the insertion of a single base in the fourth exon, and was finally identified as the candidate gene SbDG2 of the DG2 locus. The SbDG2 gene contains 5 exons and 4 introns. It is a MADS-box family transcription factor that encodes 197 amino acids. Its full-length protein contains 4 domains, namely the MADS region, K region, I region and C region. In the double-grain sorghum material W060, SbDG2 mutation caused a frameshift mutation, and it was predicted that a protein with a full length of 227 amino acids would be formed; while in P034, SbDG2 lacked 18bp in the second exon, and the translated protein lacked 6 amino acids in the K region ( Figure 5 ).

[0134] The gene sequence cloning in the above process is done using KOD FX Neo or KOD One TM PCR Master Mix high-fidelity enzyme was used for PCR amplification. The reaction system of KOD FX Neo high-fidelity enzyme is: 2×KOD FX Neo buffer 25μL, 2mM dNTPs 10μL, 10mM forward and reverse primers 1.5μL each, template 100-200ng, KOD FX Neo 1μL, add double distilled water to 50μL, and mix well. The PCR amplification program is: 94℃ pre-denaturation for 5min; 98℃ denaturation for 10s, 55℃-60℃ annealing for 30s, 68℃ extension for 1min / kb, 30-35 cycles; 68℃ extension for 7min, and storage at 4℃. KOD One TM The reaction system of PCR Master Mix high-fidelity enzyme is: KOD One TM PCR Master Mix 25μL, 10mM forward and reverse primers 1.5μL each, template 100-200ng, add deionized water to 50μL, mix well. The PCR amplification program is: 94℃ pre-denaturation for 3min; 98℃ denaturation for 10s, 55℃-60℃ annealing for 10s, 68℃ extension for 10s / kb, 30-35 cycles; 68℃ extension for 7min, 4℃ storage. Finally, add appropriate amount of loading buffer to the PCR product for agarose gel electrophoresis, or directly send the PCR product to a sequencing company for sequencing.

[0135] The genomic sequence of the SbDG2 gene is sequence 1, its transcript sequence is sequence 2, its CDS sequence is sequence 3, and the amino acid sequence of the protein encoded by it is sequence 4.

[0136] Example 2: Acquisition and functional verification of candidate gene SbDG2 knockout strain

[0137] In order to verify the function of the DG2 gene, the present invention used sorghum material Wheatland (kindly donated by the U.S. germplasm resource bank USDA, document: Population genomic and genome-wide association studies of agroclimatic traits in sorghum. (2013). Proceedings of the National Academy of Science of the United States of America 110: 453-458., hereinafter also referred to as wild-type sorghum) as the recipient material to carry out a DG2 gene knockout experiment.

[0138] 1. Obtaining the knockout strain of candidate gene SbDG2

[0139] 1. Construction of knockout vector

[0140] Then, CRISPR / Cas9 gene editing technology was used to knock out the SbDG2 gene to verify its gene function. First, two specific targets (Target1: 5'-GGACATGGTCGAGAGGTACG-3' (Sequence 1, 400-419); Target2: 5'-GGACGACGGGGAGCAGTACA-3' (Sequence 1, 652-671)) were designed at the first exon and the second exon of SbDG2 to construct its knockout vector.

[0141] The gene editing vectors used in the knockout process were pYLCRISPR / Cas9 Pubi-B and the intermediate vectors pYLsgRNA-OsU3 and pYLsgRNA-OsU6a (Xingliang Ma et al. (2015). A Robust CRISPR / Cas9 System for Convenient, High-Efficiency Multiplex Genome Editing in Monocot and Dicot Plants. Molecular Plant, 8(8), 1274-1284). The specific operation method of vector construction is as follows:

[0142] (1) Small-scale plasmid extraction: Streak the bacterial strain onto an LB plate containing the corresponding antibiotics. After colonies have grown, pick out a single clone and shake culture it in LB liquid containing the corresponding antibiotics to extract the plasmid.

[0143] (2) Preparation of target linkers: Add sterile double distilled water to the designed target linker primers to 100 μM. Then add 0.5 μL of forward and reverse primers to 49 μL of sterile double distilled water, heat at 90°C for 30 seconds, and cool to room temperature to obtain the target linkers SbDG2-KO-Target1 (obtained by annealing SbDG2-KO-F1 / R1) and SbDG2-KO-Target2 (obtained by annealing SbDG2-KO-F2 / R2).

[0144] The target primers are shown in Table 4.

[0145] Table 4 shows the SbDG2 gene knockout target linker primers

[0146]

[0147] (3) Enzyme digestion of sgRNA vector: Take 2 μg of pYLgRNA-OsU3 and pYLgRNA-OsU6a plasmids, add 20 U of BsaI-HF, prepare 50 μL system, digest for 20 min, and store at -20°C to obtain enzyme-digested plasmids.

[0148] (4) Connection of sgRNA expression cassette: Take the restriction enzyme-cut plasmid and connect it with the corresponding target linker (SbDG2-KO-Target1 connects to pYLgRNA-OsU3, SbDG2-KO-Target2 connects to pYLgRNA-OsU6a) to obtain the connection products sgRNA1 expression cassette connection product and sgRNA2 expression cassette connection product.

[0149] The reaction system is: 20ng of digested plasmid, 0.5μL target linker, 0.2μL T4 DNA ligase and 1μL 10×T4 DNA ligase Buffer, add deionized water to 10μL. After mixing, connect at 25℃ for 15min.

[0150] (5) PCR amplification of sgRNA expression cassette: divided into two rounds of amplification, the first round of amplification: the sgRNA1 expression cassette ligation product and the sgRNA2 expression cassette ligation product obtained in step (4) were subjected to the first round of PCR amplification, and the obtained amplification products were named product 1 and product 2, respectively. In the reaction system, 0.5 μL of ligation product, 0.2 μM primers UF and gRNA-R, 2×PCR buffer 7.5 μL, 2mM dNTPs 3 μL, KOD FX Neo 0.3 μL, and deionized water was added to 15 μL. The PCR reaction program was: 94°C 10 s, 60°C 15 s, 68°C 20 s, 28 cycles. Second round of amplification: Using B1' / B2 as primers, the second round of PCR amplification was performed on product 1, and the product was named sgRNA1 expression cassette (containing SbDG2-KO-Target1); using B2' / BL as primers, the second round of PCR amplification was performed on product 2, and the product was named sgRNA2 expression cassette (containing SbDG2-KO-Target2).

[0151] PCR amplification was performed using KOD FX Neo high-fidelity enzyme, and the reaction system was the same as above. The reaction program was: 95°C for 10 s, 58°C for 15 s, 68°C for 20 s, and 20 cycles.

[0152] The nucleotide sequences of the primers are as follows:

[0153] UF: 5'-CTCCGTTTTACCTGTGGAATCG-3';

[0154] gRNA-R: 5'-CGGAGGAAAATTCCATCCAC-3';

[0155] B1': 5'-TTCAGAggtctcTctcgCACTGGAATCGGCAGCAAAGG-3';

[0156] B2: 5'-AGCGTGggtctcGtcagGGTCCATCCACTCCAAGCTC-3';

[0157] B2': 5'-TTCAGAggtctcTctgaCACTGGAATCGGCAGCAAAGG-3';

[0158] BL: 5'-AGCGTGggtctcGaccgGGTCCATCCACTCCAAGCTC-3'.

[0159] (6) Connect the sgRNA1 expression cassette and the sgRNA2 expression cassette to the pYLCRISPR / Cas9 Pubi-B vector: Use the cutting and ligation method, and the reaction system is: in a 15μL reaction system, add 15ng of sgRNA1 expression cassette and sgRNA2 expression cassette, 80ng of pYLCRISPR / Cas9 Pubi-B plasmid, 1.5μL of 10×Cut Smart Buffer, 1.5μL of 10mM ATP, 0.2μL of BsaI-HF, and 0.2μL of T4 DNA ligase. The reaction program is: 37℃ 5min, 10℃ 5min, 20℃5min, 15 cycles; 37℃ 5min.

[0160] (7) The ligation product was transformed into E. coli and cultured upside down on a LB solid medium plate containing kanamycin. A single colony on the plate was picked and cultured overnight in a LB liquid medium containing kanamycin. PCR verification was performed using SP1 and SP2 as primers.

[0161] Wherein, the nucleotide sequences of primers SP1 and SP2 are as follows:

[0162] SP1: 5'-CCCGACATAGATGCAATAACTTC-3';

[0163] SP2: 5'-GCGCGGTGTCATCTATGTTACT-3'.

[0164] The reaction system is: add 10μl 2×Taq mix, 0.4μl each of 10μM SP1 and 10μM SP2, and 2μl bacterial solution to a 20μl reaction system. Amplification program: 94℃5min; 94℃30s, 57℃30s, 72℃45s, 30 cycles; 72℃5min, 4℃ storage. Use agarose gel electrophoresis to identify the plasmid extracted from the bacterial solution with the target band of 1.2kb, and the correct one identified by sequencing is pYLCRISPR / Cas9 Pubi-B-SbDG2.

[0165] 2. Sorghum genetic transformation

[0166] The successfully constructed plasmid pYLCRISPR / Cas9 Pubi-B-SbDG2 was transformed into Agrobacterium competent cells EHA105, and the positive Agrobacterium identified by PCR was renamed as recombinant Agrobacterium EHA105 / pYLCRISPR / Cas9Pubi-B-DG2-sgRNA, and stored at -80°C after using 50% glycerol to preserve the bacteria. The recombinant Agrobacterium was mainly used for subsequent genetic transformation of young embryos of sorghum recipient material Wheatland (hereinafter referred to as wild-type sorghum), and the T0 generation transgenic plant SbDG2-KO was screened on a medium containing glyphosate resistance.

[0167] The specific operation method of the above sorghum genetic transformation is as follows:

[0168] (1) Preparation of sorghum recipient material: Wheatland sorghum plants were grown in a greenhouse. When they reached the 15th day of flowering, the ears were cut and the immature embryos in the grains were squeezed out as much as possible in a sterile clean bench and evenly placed on the callus medium for callus culture.

[0169] (2) Preparation of infection culture: The recombinant Agrobacterium stored at -80°C was streaked in YEP solid medium supplemented with Kan. The grown single colony was inoculated into 10 mL YEP liquid medium (containing Kan) for activation (28°C, 220 rpm overnight). The activated culture was inoculated into 80 mL YEP liquid medium (containing Kan) at a ratio of 1:1000 and cultured at 28°C, 220 rpm until the OD reached 0. 600nm It is 0.8-1.0.

[0170] (3) Infection process: The Agrobacterium culture liquid that reaches the required OD value is transferred to a 50 mL centrifuge tube and centrifuged at 5000 rpm for 10 min to enrich the bacteria. Then the bacteria are fully resuspended with resuspension buffer, and the grown callus tissue is added to the resuspended infection liquid for infection and transformation. The infected callus is transferred to the differentiation and regeneration medium. After regeneration, the callus is transferred to the rooting medium (containing glyphosate resistance) for rooting culture. If the medium turns brown, it is necessary to transfer the rooting medium multiple times.

[0171] (4) Transplant the transformed T0 generation sorghum seedlings with a plant height of about 5-7 cm and good root growth into the soil, cultivate them in a greenhouse, and maintain a certain humidity to ensure the survival rate of the regenerated seedlings. After they are cultivated to maturity, the mature seeds are harvested, which are the T0 generation transgenic seeds.

[0172] 3. Obtaining SbDG2 gene knockout plants in sorghum

[0173] The genomic DNA of the T0 generation SbDG2-KO sorghum seedlings was extracted and identified using SP1 and SP2 as primers. The plants that amplified the target fragment of 1.2 kb were the T0 transgenic positive plants. The SbDG2 gene sequence amplification primers DG2-F and DG2-R were used to PCR amplify and sequence the DNA of the T0 transgenic positive plants to detect whether the target site was edited.

[0174] The nucleotide sequences of the primers are as follows:

[0175] SP1: 5'-CCCGACATAGATGCAATAACTTC-3';

[0176] SP2: 5'-GCGCGGTGTCATCTATGTTACT-3';

[0177] DG2-F: 5'-GCTCAGGGAGGTGAAGTAGC-3';

[0178] DG2-R: 5'-TGAGCTCCTCCTAGCACCAT-3'.

[0179] The PCR reaction system is as follows: in a 50 μl reaction system, add KOD PCR Master mix 25μl, 10μM DG2-F, 1.5μl DG2-R, 1μl DNA. Reaction program: 94℃3min; 98℃10s, 54℃15s, 68℃45s, 30 cycles; 68℃5min, 4℃ storage.

[0180] Select T0 positive plants with edited target sites and self-pollinate to obtain T1 seeds. Plant T1 transgenic plants and perform PCR amplification and sequencing with primers DG2-F and DG2-R. Select plants with homozygous mutations in the target site DG2 KO-1 and DG2 KO-2 For these two mutant strains, the target fragment of 1.2kb could not be amplified using sp1 and sp2 as primers, and the glyphosate BAR rapid test strips were negative, indicating that the two homozygous edited strains had separated the vector sequence.

[0181] The nucleotide sequences of the primers are as follows:

[0182] DG2-F: 5'-GCTCAGGGAGGTGAAGTAGC-3';

[0183] DG2-R: 5'-TGAGCTCCTCCTAGCACCAT-3';

[0184] SP1: 5'-CCCGACATAGATGCAATAACTTC-3';

[0185] SP2: 5'-GCGCGGTGTCATCTATGTTACT-3'.

[0186] DG2 KO-1 Compared with wild-type sorghum, the SbDG2 gene in the genome of the plant had a frameshift mutation due to the presence of a single base insertion (one base inserted between positions 669 and 670 of sequence 1) at the second target site, resulting in premature termination of translation.

[0187] DG2 KO-2 Compared with the wild-type sorghum, the SbDG2 gene in the genome of the plant had a frameshift mutation due to a 25bp deletion at the second target site (25 bases deleted from position 646 to 670 of sequence 1).

[0188] Both types of editing mentioned above mutate at the second target site located in the protein K region of the protein encoded by the SbDG2 gene. KO-1 In DG2, translation terminates in the K region, and the MADS and I regions are consistent with the wild type. KO-2 In the case of , the amino acid sequence changes in the K region, while the MADS region and I region are consistent with the wild type ( Figure 6 ).

[0189] DG2 KO-1 Plants and DG2 KO-2 All plants were knockout strains of the candidate gene SbDG2.

[0190] 2. Phenotypic identification of candidate gene SbDG2 knockout strains

[0191] Wild-type sorghum, DG2 KO-1 Plants and DG2 KO-2 Plants are cultivated after seeds are sown.

[0192] Using a stereo microscope, we observed the growth of wild-type sorghum, DG2 KO-1 Plants and DG2 KO-2 The spikelet floral organs of the plants were observed.

[0193] The results showed that the wild-type sorghum spikelet contained three stamens and one pistil, while DG2 KO-1 and DG2 KO-2 Spikelets show various forms of pistil and stamen developmental abnormalities ( Figure 7 ). KO-1Among the spikelets, about 27% of the spikelets developed normally, forming 3 stamens and 1 pistil, while the remaining 73% of the spikelets showed different forms of morphological or numerical abnormalities in the stamens and pistils, and additional tissue development could be observed in the pistils. Some common variation types include: (1) no stamens, forming 2 pistils; (2) no stamens, and 3 stigmas on the ovary; (3) forming 1 stamen, with abnormal ovary morphology and 3 stigmas. (4) no stamens, 4 stigmas on the ovary, and lodicule-like tissue in the middle of the 4 styles; (5) abnormal ovary morphology, and an enlarged lodicule-like structure formed next to the pistil; (6) forming 1 stamen and 1 pistil. In DG2 KO-2 Among the spikelets, almost all of them showed abnormal development of stamens and pistils, and additional organs were observed to form on the side of the pistil. Some common variant types are: (1) no stamens, and two pistils were formed; (2) no stamens, and three stigmas were born on the ovary; (3) one stamen and one pistil were formed; (4) one stamen was formed, and a mass-like structure formed on the side of the pistil; (5) no stamens, the ovary, style and stigma in the pistil were abnormal in morphology, and swollen lodicule-like tissue formed next to the pistil; (6) no stamens, and two spikelet structures appeared next to the stamen. At the seed maturity stage, it was observed that only one seed was produced in a single spikelet of the wild type, but in DG2 KO-1 and DG2 KO-2 The double-grain phenomenon was observed in the spikelets ( Figure 7 ).

[0194] In addition, knocking out SbDG2 affected the development of stamens and pistils, and even seriously affected the determination of floral meristems, not only producing a double pistil phenomenon, but also forming spikelet structures, cluster structures different from the floral organs of each whorl, and enlarged lodice structures next to the pistil, ultimately leading to a significant decrease in the fruit set rate of the spikelets of the knockout plants.

[0195] In summary, the present invention further verified the function of controlling sorghum stamen development, pistil development and floral meristem determination by knocking out SbDG2.

[0196] Example 3. Expression pattern and protein evolution analysis of candidate gene SbDG2

[0197] Using fluorescent quantitative PCR technology, the expression level of SbDG2 was detected in various sorghum tissues and organs of Wheatland, including roots, stems, leaves, young panicles at different developmental stages, panicles at flowering stage, seeds at filling stage, and seeds at maturity stage.

[0198] The results showed that SbDG2 was specifically expressed in the panicle stage, but was almost not expressed in the roots, stems, leaves, flowering, filling and mature seeds. The expression levels of SbDG2 in panicles at different developmental stages were different. The highest expression level was found in panicles less than 1 cm, i.e., during the development of lemma and palea primordia, and the expression level was slightly lower in panicles 1-2 cm in size, i.e., during the formation of stamen and pistil primordia. The expression level of SbDG2 decreased significantly in panicles greater than 2 cm, i.e., during the development and expansion of various organs ( Figure 8 A). The expression of SbDG2 in the spikelet stage was further observed by in situ hybridization experiments. The results showed that in the wild-type material P252, SbDG2 was highly expressed in the floral meristem during the second stage of spikelet development, and in the stamens and pistils during the third stage of spikelet development. The expression of SbDG2 in the double-grain material W060 was consistent with that in P252. These results indicate that SbDG2 is highly expressed in the floral meristem, stamens and pistils of sorghum spikelets, and this expression pattern is consistent with its function ( Figure 8 ).

[0199] Protein sequence analysis showed that SbDG2 encodes a MADS-box transcription factor, and the translated protein contains MADS region, K region, I region and C terminus.

[0200] In addition, the present invention also shows that wild-type sorghum and knockout plants DG2 KO-2 The expression levels of 33 MADS-box genes were detected in the spikelets of DG2 to better understand whether SbDG2 plays a role in the early development of spikelets by regulating its MADS-box genes. The results showed that 6 MADS-box genes were expressed in wild type and DG2 KO-2 There were differences in the expression levels in sorghum ( Fig. 9 ). Compared with the wild type, in DG2 KO-2 The expression levels of SbMADS13 and SbMADS47 increased significantly, while the expression levels of SbMADS3, SbMADS16, SbMADS22 and SbMADS56 decreased significantly.

[0201] These results suggest that SbDG2 may control the development of stamens and pistils and peanut tissue determination by regulating the expression of these sorghum MADS-box genes.

[0202] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. Use of any of the following substances A1)-A3) in any of the following E1-E4: E1) Regulate the number of grains per ear in plants; E2) regulating plant yield; E3) regulates the development of plant spikelet floral organs; E4) regulates the formation of double seeds in plant spikelets; A1) Protein SBDG2; A2) a nucleic acid molecule encoding protein SBDG2; A3) a recombinant vector, expression cassette or recombinant bacterium containing a nucleic acid molecule encoding protein SBDG2; The protein SBDG2 is as follows B1) or B2) or B3): B1) a protein consisting of the amino acid sequence shown in Sequence 4 in the sequence list; B2) a protein derived from B1) with the same function as the amino acid sequence shown in Sequence 4 in the sequence list, wherein one or more amino acid residues are substituted and / or deleted and / or added; B3) A fusion protein obtained by connecting a protein tag to the N-terminus or / and C-terminus of B1) or B2).

2. The use according to claim 1, characterized in that: The nucleic acid molecule encoding protein SBDG2 is any one of the following nucleic acid molecules C1)-C3): C1) The coding region includes the nucleic acid molecule shown in sequence 1, 2 or 3 in the sequence list; C2) a nucleic acid molecule that hybridizes with the DNA sequence defined in C1) under stringent conditions and encodes a protein having the same function; C3) is a nucleic acid molecule that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% homology with the DNA sequence defined in C1) and encodes a protein with the same function.

3. A substance that inhibits or reduces the activity or content of the protein SBDG2 described in claim 1, or a substance that inhibits the expression of a nucleic acid molecule encoding the protein SBDG2 described in claim 1, in any of the following uses: F1) Increase the number of grains per ear in plants; F2) Increase plant yield; F3) causes abnormal development of spikelet floral organs in plants; F4) promotes the formation of double seeds in plant spikelets.

4. The use according to claim 3, characterized in that: The substance is a crisp system that inhibits the expression of the nucleic acid molecule encoding the protein SBDG2; The crisp system includes sgRNA targeting SBDG2, The target sites of the sgRNA are shown at positions 400-419 and / or positions 652-671 in Sequence Listing 1.

5. A method for cultivating a transgenic plant with two spikelets and two seeds, comprising the following steps D1) or D2): D1) The method comprises the following steps: reducing or inhibiting the content and / or activity of the protein SBDG2 in the target plant to obtain a transgenic plant; D2) The method comprises the following steps: reducing or inhibiting the expression of a nucleic acid molecule encoding protein SBDG2 in a target plant to obtain a transgenic plant; The transgenic plant is a spikelet-two-seed plant; The protein SBDG2 is as follows B1) or B2): B1) a protein consisting of the amino acid sequence shown in Sequence 4 in the sequence list; B2) A protein derived from B1) with the same function as that of B1) by replacing and / or deleting and / or adding one or more amino acid residues in the amino acid sequence shown in Sequence 4 in the sequence listing.

6. A method for cultivating transgenic plants with increased grain number per ear, comprising the following steps D1) or D2): D1) The method comprises the following steps: reducing or inhibiting the content and / or activity of the protein SBDG2 in the target plant to obtain a transgenic plant; D2) The method comprises the following steps: reducing or inhibiting the expression of a nucleic acid molecule encoding protein SBDG2 in a target plant to obtain a transgenic plant; The transgenic plant has a greater number of grains per ear than the target plant; The protein SBDG2 is as follows B1) or B2): B1) a protein consisting of the amino acid sequence shown in Sequence 4 in the sequence list; B2) A protein derived from B1) with the same function as that of B1) by replacing and / or deleting and / or adding one or more amino acid residues in the amino acid sequence shown in Sequence 4 in the sequence listing.

7. A method for cultivating transgenic plants with increased yield, comprising the following D1) or D2): D1) The method comprises the following steps: reducing or inhibiting the content and / or activity of the protein SBDG2 in the target plant to obtain a transgenic plant; D2) The method comprises the following steps: reducing or inhibiting the expression of a nucleic acid molecule encoding protein SBDG2 in a target plant to obtain a transgenic plant; The transgenic plant has a greater yield than the target plant; The protein SBDG2 is as follows B1) or B2): B1) a protein consisting of the amino acid sequence shown in Sequence 4 in the sequence list; B2) A protein derived from B1) with the same function as that of B1) by replacing and / or deleting and / or adding one or more amino acid residues in the amino acid sequence shown in Sequence 4 in the sequence listing.

Images