A method for increasing the production intensity of long-chain dibasic acids

Abstract

The present invention belongs to the technical field of fermentation engineering, and specifically relates to a method for improving the production intensity of long-chain dicarboxylic acid. The method comprises the following steps: fermenting and culturing a strain for producing long-chain dicarboxylic acid to obtain a fermentation product; adding a fermentation medium and an L-carnitine fumarate-long-chain alkane solution to the fermentation product and continuing the fermentation culture to obtain long-chain dicarboxylic acid; the L-carnitine fumarate-long-chain alkane solution is composed of a long-chain alkane and L-carnitine fumarate, and the long-chain alkane is any one or more of dodecane, tridecane or hexadecane. The present invention uses a fermentation strain for producing long-chain dicarboxylic acid. After fermentation and culture, a long-chain alkane containing 20 μmol / L L-carnitine fumarate is added to the obtained fermentation product, the conversion rate of the long-chain alkane is increased by more than 23.0%, the fermentation yield of the long-chain dicarboxylic acid is increased by more than 46.5%, and considering the above two aspects, the production intensity of the long-chain dicarboxylic acid is increased by more than 46.6%.

Description

Technical Field

[0001] The present invention belongs to the technical field of fermentation engineering, and particularly relates to a method for improving the production intensity of long-chain dicarboxylic acid. Background Art

[0002] Long-chain dicarboxylic acid refers to a dicarboxylic acid with 8-20 carbon atoms in the carbon chain, including saturated and unsaturated dicarboxylic acids. It is an industrial raw material with a wide range of uses and can be used in the fields of high-end engineering plastics, spices, coating synthesis, and biopharmaceutical production. Long-chain dicarboxylic acid has two carboxyl groups and typical properties of carboxylic acids. It can be condensed with hydroxyl groups to form esters under the action of enzymes or other chemical substances, and has a wide range of applications in industry. It can be used as a raw material for polyesters and polyamides. It plays an important role in the synthesis of high-grade engineering plastics, long-chain nylon products, and synthetic fibers. It can also be used as a lubricant, wax, and ingredient in cosmetics, and has important uses in the preparation of dyes, resins, and rubbers. Since long-chain dicarboxylic acid is a synthetic raw material for various substances, the current social demand for long-chain dicarboxylic acid is increasing day by day. How to improve its production efficiency and reduce its production cost is an urgent problem to be solved in the industrial field.

[0003] The production methods of long-chain dicarboxylic acid mainly include three categories: catalytic oil method, chemical synthesis method, and microbial fermentation method. The catalytic oil method mainly uses vegetable oils to produce acids, with fewer acid production categories, and vegetable oils are restricted by conditions such as climate, so its universality is not strong; the chemical synthesis method has a complex process and large environmental pollution. Currently, the production of long-chain dicarboxylic acid is gradually shifting from chemical synthesis to microbial fermentation. The microbial fermentation method has more advantages than chemical synthesis, such as high raw material conversion rate, low pollution, and low cost.

[0004] At present, the production of long-chain dicarboxylic acid by microbial fermentation has become a hot topic of research at home and abroad as an alternative green and environmental protection method. To obtain high-yield long-chain dicarboxylic acid through microbial fermentation, the strain and its metabolic pathway regulation are the key. The generation of long-chain dicarboxylic acid is closely related to the effective entry of long-chain alkanes into mitochondria for metabolic conversion. To improve the conversion efficiency of long-chain alkanes, it is necessary to increase the entry of long-chain alkanes into mitochondria for conversion to dicarboxylic acid as much as possible during the production process. This process is the alkane conversion rate, and its level is one of the key factors determining the fermentation production efficiency of long-chain dicarboxylic acid; at the same time, it is also necessary to minimize the β-oxidation decomposition of the converted long-chain dicarboxylic acid by yeast cells, so as to ultimately improve the conversion rate of long-chain alkanes and the yield and productivity of long-chain dicarboxylic acid in the fermentation production of dicarboxylic acid.

[0005] Selecting what kind of metabolic regulation intervention strategy to improve the production intensity of long-chain dicarboxylic acid is a scientific and technical problem that needs to be solved urgently by those skilled in the art. Summary of the Invention

[0006] To solve the defect of low production intensity of long-chain dibasic acids in existing production methods of long-chain dibasic acids, the present invention provides a fermentation method for improving the production intensity of long-chain dibasic acids.

[0007] The specific solution is as follows: The present invention provides a method for improving the production intensity of long-chain dibasic acids, comprising the following steps: fermenting and culturing a strain for producing long-chain dibasic acids to obtain a fermentation product; adding a fermentation medium and an L-carnitine fumarate-long-chain alkane solution to the fermentation product and continuing the fermentation culture to obtain long-chain dibasic acids; the L-carnitine fumarate-long-chain alkane solution is composed of a long-chain alkane and L-carnitine fumarate, and the long-chain alkane is any one or more of dodecane, tridecane or hexadecane.

[0008] Preferably, in the L-carnitine fumarate-long-chain alkane solution, the concentration of L-carnitine fumarate is 20 μmol / L 。

[0009] Preferably, the added amount of the fermentation medium is 2% of the volume of the fermentation product.

[0010] Preferably, the added amount of the L-carnitine fumarate-long-chain alkane solution is 2% of the total volume of the added fermentation medium and the fermentation product.

[0011] Preferably, the conditions for the fermentation culture are: 30 °C, 300 rpm.

[0012] Preferably, the preparation of the fermentation product comprises the following steps: inoculating a strain for producing long-chain dibasic acids into a seed medium, activating and culturing to prepare a seed solution; inoculating the seed solution into a fermentation medium for fermentation culture to obtain a fermentation product.

[0013] Preferably, each liter of the fermentation medium contains 120 g of glucose, 2 g of yeast extract, 2 g of corn steep liquor, 3.86 g of urea, MgSO 4 7H 2 00.8 g, KH 2 PO 4 2 g, CH 3 OONa 3 g, trace element solution 10 mL, vitamin solution 10 mL, and the solvent is water; each liter of the trace element solution contains MnCl 2 ·4H 2 O, 12 g; FeSO 4 ·7H 2 O, 2 g; CaCl 2 ·2H 2 O, 2 g; CuSO 4 ·5H 2 O, 0.05 g; ZnCl2 , 0.5 g, with water as the solvent; each liter of the vitamin solution contains 0.004 g of biotin, 0.75 mg of thiamine, 0.04 g of pyridoxine, 0.8 g of nicotinic acid, and water as the solvent.

[0014] Preferably, each liter of the seed culture medium contains 5 g of yeast extract, 3 g of corn steep liquor, 20 g of sucrose, 3 g of urea, KH 2 PO 4 8 g, with water as the solvent.

[0015] Preferably, when preparing the seed solution, the conditions for the activation culture are: 30 °C, 350 rpm, and culture for 24 h.

[0016] Compared with the prior art, the present invention has the following beneficial effects: The present invention provides a method for improving the production intensity of long-chain dibasic acids, including the following steps: fermenting and culturing a strain for producing long-chain dibasic acids to obtain a fermentation product; adding a fermentation medium and an L-carnitine fumarate-long-chain alkane solution to the fermentation product and continuing the fermentation culture to obtain long-chain dibasic acids; the L-carnitine fumarate-long-chain alkane solution is composed of a long-chain alkane and L-carnitine fumarate, and the long-chain alkane is any one or more of dodecane, tridecane, or hexadecane.

[0017] The present invention uses a fermentation strain for producing long-chain dibasic acids. After fermentation and culture, adding a long-chain alkane containing 20 μmol / L L-carnitine fumarate to the obtained fermentation product can enhance the efficiency of the long-chain alkane entering the mitochondria and increase the production intensity of long-chain dibasic acids. The improvement of the production intensity mainly includes two aspects: the increase in yield and the increase in conversion rate. By the method of the present invention, the conversion rate of the long-chain alkane is increased by more than 23.0%, the fermentation yield of the long-chain dibasic acid is increased by more than 46.5%, and considering the above two aspects, the production intensity of the long-chain dibasic acid is increased by more than 46.6%. Description of the Drawings

[0018] Figure 1 It is a schematic structural diagram of L-carnitine fumarate. Detailed Embodiments

[0019] The present invention will be described in detail below with reference to the drawings and specific embodiments, but it should not be construed as a limitation of the present invention.

[0020] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the technical field to which the present invention belongs. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention.

[0021] Unless otherwise specified or there is a contradiction, the terms or phrases used in the present invention have the following meanings:

[0022] As used herein, the optional ranges of the terms "and / or", "or / and", and "and / or" include any one of two or more related listed items, and also include any and all combinations of the related listed items. The said any and all combinations include combinations of any two related listed items, any more related listed items, or all related listed items.

[0023] In the present invention, "one or several" means any one, any two, or any two or more of the listed items. Among them, "several" means any two or more.

[0024] In the present invention, "its combination", "any combination thereof", "any combination mode thereof", etc. include all suitable combination modes of any two or any two or more items among the listed items.

[0025] In the present invention, in "suitable combination mode", "suitable mode", "any suitable mode", etc., the "suitable" is subject to being able to implement the technical solution of the present invention, solve the technical problems of the present invention, and achieve the expected technical effects of the present invention.

[0026] In the present invention, "preferred" only describes the embodiments or examples with better effects. It should be understood that it does not constitute a limitation on the protection scope of the present invention.

[0027] In the present invention, among the technical features described in an open-ended manner, it includes a closed technical solution composed of the listed features, and also includes an open-ended technical solution containing the listed features.

[0028] In the present invention, regarding the numerical range, unless otherwise specified, it includes both endpoints of the numerical range.

[0029] In the present invention, regarding the percentage content, unless otherwise specified, for solid-liquid mixing and solid-solid mixing, it refers to the mass percentage, and for liquid-liquid mixing, it refers to the volume percentage.

[0030] In the present invention, regarding the percentage concentration, unless otherwise specified, it all refers to the final concentration. The said final concentration refers to the proportion of the added component in the system after adding this component.

[0031] In the present invention, for the temperature parameters, unless otherwise specifically limited, it allows both constant temperature treatment and treatment within a certain temperature range. The said constant temperature treatment allows the temperature to fluctuate within the accuracy range controlled by the instrument.

[0032] In the present invention, the experimental methods without specific conditions and the reagents without specified formulations are carried out under conventional conditions, such as those described in the Experimental Tutorial of Medical Biochemistry and Molecular Biology, 2011 Edition, Higher Education Press.

[0033] The strain used in the present invention is a recombinant bacterium capable of producing long-chain dicarboxylic acid. This recombinant bacterium is prepared by introducing a recombinant plasmid into a mutant strain PF-UV-56 of Candida tropicalis, and the preservation number of PF-UV-56 is CGMCC NO.0356. The said recombinant plasmid carries the Inh1 gene, the vector is pGAPZαA, and the sequence of Inh1 is as shown in SEQ ID NO.1. The construction method of the said recombinant bacterium has been disclosed in the document with the application number 202410400413.2 and the patent name "A Recombinant Bacterium with Improved Production Intensity of Long-Chain Dicarboxylic Acid and Its Application". Referring to the above patent, therefore, the name of the recombinant bacterium in this application still follows the name in the above patent, and this recombinant bacterium is 0356-pGAPZαA / Inh1.

[0034] SEQ ID NO.1:

[0035] ATGTTACCACGTTCAGCATTAGCACGCTCATTGCAATTACAGCGCGGTGTGGCCGCAAGGTTCTACTCTGAAGGTTCTACCGGCACCCCAAGAGGGTCAGGCTCAGAGGATTCGTTTGTTAAAAGGGAAAGGGCCACGGAAGACTTCTTCGTTAGGCAGCGTGAGAAGGAGCAACTACGCCATTTGAAAGAACAACTGGAAAAACAACGAAAGAAGATTGATTCTTTGGAAAATAAAATTGACTCGATGACCAAATAA.

[0036] Determination of cell growth: Every day, 100 μL of samples are taken under sterile conditions in a laminar flow hood, added to 900 μL of sterile water, mixed thoroughly, and the OD value is measured at 570 nm using a UV7500 visible light spectrophotometer to plot the growth curve.

[0037] Determination of cell dry weight: Take a certain amount of bacterial suspension in a 10 mL volumetric flask, add 2 mL of 2 mol / L hydrochloric acid to dissolve the calcium carbonate in the suspension, make up the volume to 10 mL with deionized water, mix thoroughly, measure the OD value at 660 nm using a UV7500 visible light spectrophotometer, and calculate the cell dry weight using the cell dry weight standard curve.

[0038] Analysis of long-chain alkane concentration: Using n-tetradecane as the internal standard, making the ratio of n-dodecane, n-tridecane, and n-hexadecane between 0.5 and 2, measuring the peak area ratios of nC12, nC13, nC16, and nC14 respectively by gas chromatography, and calculating the volume percentage content X of nC12, nC13, and nC16 in the sample according to the added amount of nC14. The calculation formula is as follows:

[0039]

[0040] In the formula: X—volume percentage content of long-chain alkane, %.

[0041] F—relative correction factor, and F is measured to be 1.005 using the standard sample.

[0042] Ai—peak area of long-chain alkane; As—peak area of nC14; Vs—added volume of nC14, mL; V—sampling volume, mL.

[0043] The long-chain alkane is nC12, nC13, or nC16.

[0044] The specific operation is as follows: Adjust the pH value of the fermentation broth to 8.0, accurately pipette 10 mL of the fermentation broth into a separatory funnel, add 50 mL of ether, shake well and let it stand for stratification, then take 10 mL of the extract into a ground-glass test tube, add 0.2 mL of nC14 as the internal standard, mix well, analyze the sample by gas chromatography, and then calculate the volume percentage content of nC12, nC13, and nC16 respectively according to the above formula.

[0045] Gas chromatography conditions: Using n-hexane as the solvent, a 100% methyl polysiloxane SE30 packed column, column temperature 150 °C, injection temperature 200 °C.

[0046] Determination of long-chain dibasic acid: Accurately pipette 5 mL of the fermentation broth, add 0.5 mL of 4 mol / L NaOH solution, heat in a boiling water bath for 5 min, mix well, cool with tap water and then place it in a centrifuge tube, centrifuge at 4000 rpm for 10 min, pipette 4 mL of the middle aqueous phase into a 50 mL conical flask, add 3 mol / L sulfuric acid solution dropwise until the pH is acidic, generally 2, to completely crystallize out the dibasic acid. Filter by suction, and wash the conical flask and the filter cake with deionized water until the filtrate and the filter paper are neutral. Transfer the filter cake and the filter paper into a 150 mL conical flask, add 30 mL of 95% ethanol as the solvent, heat to completely dissolve the dibasic acid, add 3 drops of bromothymol blue as the indicator, and titrate to the end point with the NaOH standard solution.

[0047] Calculation formula for long-chain dibasic acid concentration:

[0048] Among them, H is the concentration of DCA12, DCA13 or DCA14, in g / L.

[0049] I—the normality for titration, in mol / L.

[0050] J—the volume of NaOH used for titration, in mL.

[0051] K—the sampling volume, in mL.

[0052] Remark: The determination methods of the dibasic acid yield mentioned in this method are all to measure the dibasic acid content in the whole fermentation broth. DCA is the English abbreviation of long-chain dibasic acid.

[0053] Conversion rate of long-chain alkane = residual amount of long-chain alkane / added amount of long-chain alkane × 100%.

[0054] Culture medium preparation:

[0055] Per liter of LB liquid culture medium: 10 g of yeast extract, 5 g of peptone, 10 g of NaCl, made up to 1 L with water, sterilized at 115 °C for 15 min.

[0056] LB solid culture medium: Based on the LB liquid culture medium, add agar powder equivalent to 2% of the mass fraction of the LB liquid culture medium, and sterilize at 115 °C for 15 min.

[0057] Per liter of YPD liquid culture medium: 10 g of yeast extract, 20 g of peptone, 20 g of glucose, made up to 1 L with water, sterilized at 115 °C for 15 min.

[0058] YPD solid culture medium: Based on the YPD liquid culture medium, add agar powder equivalent to 2% of the mass fraction of the YPD liquid culture medium, and sterilize at 115 °C for 15 min.

[0059] YPD plate culture medium: Add bleomycin Zeocin to the YPD solid culture medium to make the final concentration of Zeoci 100 μg / mL.

[0060] Per liter of seed culture medium: 5 g of yeast extract, 3 g of corn steep liquor, 20 g of sucrose, 3 g of urea, KH 2 PO 4 8 g, with water as the solvent, sterilized at 115 °C for 15 min. After the culture medium is cooled, add filtered sterile Zeocin with a final concentration of 50 μg / mL.

[0061] Per liter of fermentation culture medium: 120 g of glucose, 2 g of yeast extract, 2 g of corn steep liquor, 3.86 g of urea, MgSO 4 7H 2 O 0.8 g, KH 2 PO 4 2 g, CH3 3 g of OONa, 10 mL of trace element solution after filtration sterilization, 10 mL of vitamin solution after filtration sterilization, made up to 1 L with water, and sterilized at 115 °C for 15 min. 40 g / L of NaOH was added to adjust the pH to 6.0, and NaOH was sterilized separately.

[0062] The formula for each liter of trace element solution is: MnCl 2 ·4H 2 O, 12 g; FeSO 4 ·7H 2 O, 2 g; CaCl 2 ·2H 2 O, 2 g; CuSO 4 ·5H 2 O, 0.05 g; ZnCl 2 , 0.5 g, dissolved with 2 mol / L HCl and made up to 1 L.

[0063] The formula for each liter of vitamin solution: biotin 0.004 g, thiamine 0.75 mg, pyridoxol 0.04 g, nicotinic acid 0.8 g, dissolved with 2 mol / L HCl and made up to 1 L.

[0064] L-carnitine fumarate - dodecane solution, L-carnitine fumarate - tridecane solution or L-carnitine fumarate - hexadecane solution: dodecane, tridecane or hexadecane was sterilized at 115 °C for 15 min. After L-carnitine fumarate was filtered and sterilized, it was prepared into a 1 mol / L stock solution and stored, and then added to the above-mentioned high-pressure sterilized dodecane, tridecane or hexadecane so that the final concentration of L-carnitine fumarate was 20 μmol / L.

[0065] The inventive concept of the present invention is as follows: Long-chain alkanes need to enter the mitochondria for conversion into long-chain dicarboxylic acids, and the entry into the mitochondria requires the assistance of carnitine acyltransferase I and II. The activities of carnitine acyltransferase I and II are the key to the efficiency of long-chain alkanes entering the mitochondria. Fumarate is a small molecule that can promote the tricarboxylic acid cycle in mitochondria, and its molecular structure plays an important role in maintaining and enhancing mitochondrial metabolic functions; while carnitine is beneficial for long-chain alkanes to enter the mitochondria. Therefore, the addition of L-carnitine fumarate to the fermentation broth will significantly improve the efficiency of long-chain alkanes entering the mitochondria for conversion. The structural formula of L-carnitine fumarate is as Figure 1As shown; at the same time, in combination with the engineering strain 0356-pGAPZαA / Inh1, by overexpressing 0356-pGAPZαA / Inh1, the activity of mitochondrial ATP synthase was inhibited. Mitochondrial ATP synthase is also known as mitochondrial respiratory chain complex V, which is repressed at the end of the mitochondrial respiratory chain electron transport chain, redirecting the metabolic flux to glycolysis, thereby enhancing both the conversion and production of long-chain dicarboxylic acids and reducing the tendency of them to enter the tricarboxylic acid cycle through β-oxidation. Ultimately, the conversion rate of long-chain alkanes and the yield and productivity of long-chain dicarboxylic acids were significantly increased.

[0066] The molecular general formula of long-chain dicarboxylic acid is: HOOC-(CH 2 )n-COOH, where n is 8 - 20. In the present invention, the long-chain dicarboxylic acids include dodecane long-chain dicarboxylic acid, tridecane long-chain dicarboxylic acid, and hexadecane long-chain dicarboxylic acid.

[0067] The following further describes the present invention in detail with reference to examples, but the implementation manners of the present invention are not limited thereto. Unless otherwise specified, the technical means used in the following examples are conventional means well-known to those skilled in the art; the experimental methods used are all conventional methods.

[0068] Example 1

[0069] A method for increasing the production intensity of long-chain dicarboxylic acid is specifically described as follows:

[0070] S1: Ferment and culture the strain for producing long-chain dicarboxylic acid to obtain a fermentation product. The method is as follows:

[0071] Pick a single colony of the strain 0356-pGAPZαA / Inh1 for producing long-chain dicarboxylic acid from a YPD plate containing Zeocin onto a seed medium, and activate and culture it at 30°C and 350 rpm for 24 h to prepare a seed solution.

[0072] Inoculate the seed solution into the fermentation medium at an inoculation amount of 20%, and carry out fermentation culture at 30°C and 300 rpm. After 48 h of fermentation, a fermentation product is obtained.

[0073] S2: Supplement the fermentation medium and L-carnitine fumarate-dodecane solution to the fermentation product, and continue fermentation culture to obtain long-chain dicarboxylic acid. The method is as follows:

[0074] According to the volume of the fermentation product, fresh fermentation medium was supplemented daily, and the addition amount of the fresh fermentation medium was 2% of the volume of the fermentation product, and it was continuously supplemented for 4 days; at the same time, a dodecane solution containing 20 μmol / L of L-carnitine fumarate was supplemented daily, and the addition amount of the dodecane solution was 2% of the total volume of the supplemented fresh fermentation medium and the fermentation product, and it was continuously supplemented for 96 h, that is, 4 days, and cultured for a total of 144 h to obtain a fermentation product containing dodecane long-chain dicarboxylic acid.

[0075] Example 2

[0076] A method for improving the production intensity of long-chain dicarboxylic acid is specifically described as follows:

[0077] S1: Ferment and culture the strain for producing long-chain dicarboxylic acid to obtain a fermentation product. The method is as follows:

[0078] Pick a single colony of the strain 0356-pGAPZαA / Inh1 for producing long-chain dicarboxylic acid from a YPD plate containing Zeocin onto a seed medium, and activate and culture it at 30 °C and 350 rpm for 24 h to prepare a seed solution.

[0079] Inoculate the seed solution into the fermentation medium at an inoculation amount of 20%, and carry out fermentation culture at 30 °C and 300 rpm. After 48 h of fermentation, a fermentation product was obtained.

[0080] S2: Supplement the fermentation medium and L-carnitine fumarate-tridecane solution to the fermentation product, and continue fermentation culture to obtain long-chain dicarboxylic acid. The method is as follows:

[0081] According to the volume of the fermentation product, fresh fermentation medium was supplemented daily, and the addition amount of the fresh fermentation medium was 2% of the volume of the fermentation product, and it was continuously supplemented for 4 days; at the same time, a tridecane solution containing 20 μmol / L of L-carnitine fumarate was supplemented daily, and the addition amount of the tridecane solution was 2% of the total volume of the supplemented fresh fermentation medium and the fermentation product, and it was continuously supplemented for 96 h, that is, 4 days, and cultured for a total of 144 h to obtain a fermentation product containing tridecane long-chain dicarboxylic acid.

[0082] Example 3

[0083] A method for improving the production intensity of long-chain dicarboxylic acid is specifically described as follows:

[0084] S1: Ferment and culture the strain for producing long-chain dicarboxylic acid to obtain a fermentation product. The method is as follows:

[0085] Pick a single colony of the strain 0356-pGAPZαA / Inh1 for producing long-chain dicarboxylic acid from a YPD plate containing Zeocin onto a seed medium, and activate and culture it at 30 °C and 350 rpm for 24 h to prepare a seed solution.

[0086] Inoculate the seed solution into the fermentation medium at an inoculum size of 20%, and carry out fermentation culture at 30 °C and 300 rpm. After 48 h of fermentation, a fermentation product is obtained.

[0087] S2: Add the fermentation medium and L-carnitine fumarate-hexadecane solution to the fermentation product, and continue fermentation culture to obtain long-chain dicarboxylic acid. The method is as follows:

[0088] According to the volume of the fermentation product, add fresh fermentation medium every day. The addition amount of the fresh fermentation medium is 2% of the volume of the fermentation product, and it is continuously added for 4 days; at the same time, add a hexadecane solution containing 20 μmol / L of L-carnitine fumarate every day. The addition amount of the hexadecane solution is 2% of the total volume of the added fresh fermentation medium and the fermentation product, and it is continuously added for 96 h, that is, 4 days, and a total of 144 h of culture is carried out to obtain a fermentation product containing hexadecane long-chain dicarboxylic acid.

[0089] To prove the effect of the present invention, the inventors made Comparative Examples 1 to 3.

[0090] Comparative Example 1

[0091] A fermentation method for producing long-chain dicarboxylic acid, namely conventional fermentation, is specifically described as follows:

[0092] S1: Ferment and culture the strain for producing long-chain dicarboxylic acid to obtain a fermentation product. The method is as follows:

[0093] Pick a single colony of the strain 0356-pGAPZαA / Inh1 for producing long-chain dicarboxylic acid from a YPD plate containing Zeocin onto a seed medium, and activate and culture it at 30 °C and 350 rpm for 24 h to prepare a seed solution.

[0094] Inoculate the seed solution into the fermentation medium at an inoculum size of 20%, and carry out fermentation culture at 30 °C and 300 rpm. After 48 h of fermentation, a fermentation product is obtained.

[0095] S2: Add the fermentation medium and dodecane to the fermentation product, and continue fermentation culture to obtain long-chain dicarboxylic acid. The method is as follows:

[0096] According to the volume of the fermentation product, add fresh fermentation medium every day. The addition amount of the fresh fermentation medium is 2% of the volume of the fermentation product, and it is continuously added for 4 days; at the same time, add dodecane every day. The addition amount of dodecane is 2% of the total volume of the added fresh fermentation medium and the fermentation product. Continuously add for 96 h, that is, 4 days, and a total of 144 h of culture is carried out to obtain a fermentation product containing dodecane long-chain dicarboxylic acid.

[0097] Comparative Example 2

[0098] A fermentation method for producing long-chain dicarboxylic acid, namely conventional fermentation, is described as follows:

[0099] S1: Ferment and culture the strain for producing long-chain dicarboxylic acid to obtain a fermentation product. The method is as follows:

[0100] Pick a single colony of the strain 0356-pGAPZαA / Inh1 for producing long-chain dicarboxylic acid from a YPD plate containing Zeocin onto a seed medium, and activate and culture it at 30 °C and 350 rpm for 24 h to prepare a seed solution.

[0101] Inoculate the seed solution into the fermentation medium at an inoculation amount of 20%, and carry out fermentation culture at 30 °C and 300 rpm. After 48 h of fermentation, a fermentation product is obtained.

[0102] S2: Supplement the fermentation medium and tridecane in the fermentation product, and continue fermentation culture to obtain long-chain dicarboxylic acid. The method is as follows:

[0103] According to the volume of the fermentation product, supplement fresh fermentation medium every day. The addition amount of the fresh fermentation medium is 2% of the volume of the fermentation product, and it is continuously supplemented for 4 days; at the same time, supplement tridecane every day. The addition amount of tridecane is 2% of the total volume of the supplemented fresh fermentation medium and the fermentation product. Continuously supplement for 96 h, that is, 4 days, and culture for a total of 144 h to obtain a fermentation product containing tridecane long-chain dicarboxylic acid.

[0104] Comparative Example 3

[0105] A fermentation method for producing long-chain dicarboxylic acid, namely conventional fermentation, is described as follows:

[0106] S1: Ferment and culture the strain for producing long-chain dicarboxylic acid to obtain a fermentation product. The method is as follows:

[0107] Pick a single colony of the strain 0356-pGAPZαA / Inh1 for producing long-chain dicarboxylic acid from a YPD plate containing Zeocin onto a seed medium, and activate and culture it at 30 °C and 350 rpm for 24 h to prepare a seed solution.

[0108] Inoculate the seed solution into the fermentation medium at an inoculation amount of 20%, and carry out fermentation culture at 30 °C and 300 rpm. After 48 h of fermentation, a fermentation product is obtained.

[0109] S2: Supplement the fermentation medium and hexadecane in the fermentation product, and continue fermentation culture to obtain long-chain dicarboxylic acid. The method is as follows:

[0110] According to the volume of the fermentation product, fresh fermentation medium was supplemented every day. The addition amount of the fresh fermentation medium was 2% of the volume of the fermentation product, and it was continuously supplemented for 4 days. At the same time, hexadecane was supplemented every day, and the addition amount of hexadecane was 2% of the total volume of the supplemented fresh fermentation medium and the fermentation product. It was continuously supplemented for 96 h, that is, 4 days, and cultured for a total of 144 h to obtain a fermentation product containing long-chain dicarboxylic acid with 16 carbon atoms.

[0111] After the fermentation was completed, the conversion rate of long-chain alkanes and the yields of long-chain dicarboxylic acid of dodecane, tridecane or hexadecane in the fermentation products obtained in Examples 1 to 3 and Comparative Examples 1 to 3 were measured.

[0112] The fermentation results of Example 1 and Comparative Example 1 are shown in Table 1. After the supplementation of L-carnitine fumarate, the conversion rate of long-chain alkanes and the yield of dodecane long-chain dicarboxylic acid were increased by 19.3% and 28.1% respectively compared with the conventional fermentation conditions.

[0113] The fermentation results of Example 2 and Comparative Example 2 are shown in Table 2. After the supplementation of L-carnitine fumarate, the conversion rate of long-chain alkanes and the yield of tridecane long-chain dicarboxylic acid were increased by 18.4% and 16.3% respectively compared with the conventional fermentation conditions.

[0114] The fermentation results of Example 3 and Comparative Example 3 are shown in Table 3. After the supplementation of L-carnitine fumarate, the conversion rate of long-chain alkanes and the yield of hexadecane long-chain dicarboxylic acid were increased by 23.0% and 46.5% respectively compared with the conventional fermentation conditions.

[0115] Table 1 Comparison of dodecane long-chain dicarboxylic acid fermentation between the control strain and the fed-batch of L-carnitine fumarate

[0116]

[0117] Table 2 Comparison of tridecane long-chain dicarboxylic acid fermentation between the control strain and the fed-batch of L-carnitine fumarate

[0118]

[0119] Table 3 Comparison of hexadecane long-chain dicarboxylic acid fermentation between the control strain and the fed-batch of L-carnitine fumarate

[0120]

[0121] It should be noted that when the claims of the present invention involve numerical ranges, it should be understood that any value between the two endpoints of each numerical range and the two endpoints can be selected. In order to prevent redundancy, preferred embodiments of the present invention are described.

[0122] Although the preferred embodiments of the present invention have been described, additional changes and modifications can be made to these embodiments by those skilled in the art once they learn the basic creative concept. Therefore, the appended claims are intended to be construed to include the preferred embodiments as well as all changes and modifications that fall within the scope of the present invention.

[0123] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalent technologies, the present invention is also intended to include these modifications and variations.

Claims

1. A method for improving the production intensity of long carbon chain dibasic acids, characterized in that: The following steps are involved: Fermenting and culturing a strain producing a long-chain dibasic acid to obtain a fermentation product; Adding fermentation medium and L-carnitine fumarate-long carbon chain alkane solution to the fermentation product, continuing fermentation culture, and obtaining long carbon chain dibasic acid; The L-carnitine fumarate-long carbon chain alkane solution is composed of long carbon chain alkane and L-carnitine fumarate, and the long carbon chain alkane is any one or more of dodecane, tridecane or hexadecane; The amount of fermentation medium added is 2% of the volume of the fermentation product; The amount of the L-carnitine fumarate-long carbon chain alkane solution added is 2% of the total volume of the fermentation medium and the fermentation product; In the L-carnitine fumarate-long carbon chain alkane solution, the concentration of L-carnitine fumarate is 20 μmol / L; The fermentation culture conditions are: 30°C, 300rpm; Each liter of the fermentation medium contains 120 g of glucose, 2 g of yeast extract, 2 g of corn steep liquor, 3.86 g of urea, 0.8 g of MgSO47H20, 2 g of KH2PO4, 3 g of CH3OONa, 10 mL of trace element solution, 10 mL of vitamin solution, and the solvent is water; Each liter of the trace element liquid contains 12 g of MnCl2·4H2O, 2 g of FeSO4·7H2O, 2 g of CaCl2·2H2O, 0.05 g of CuSO4·5H2O, and 0.5 g of ZnCl2, and the solvent is water; Each liter of the vitamin solution contains 0.004 g of biotin, 0.75 mg of thiamine, 0.04 g of pyridoxine, and 0.8 g of nicotinic acid, and the solvent is water.

2. The method according to claim 1, characterized in that The preparation of the fermentation product comprises the following steps: Inoculating a strain producing a long carbon chain dibasic acid into a seed culture medium, activating the culture, and preparing a seed solution; The seed liquid is inoculated into a fermentation medium for fermentation culture to obtain a fermentation product.

3. The method according to claim 2, characterized in that Each liter of the seed culture medium contains 5g of yeast extract, 3g of corn steep liquor, 20g of sucrose, 3g of urea, 8g of KH2PO4, and the solvent is water.

4. The method according to claim 2, characterized in that When preparing the seed solution, the activation culture conditions are: 30° C., 350 rpm, and culture for 24 hours.

Images