Method for preparing cerebroside in cordyceps sinensis through genetically engineered bacteria

Abstract

The invention provides a method for preparing a cerebroside component in cordyceps sinensis through genetically engineered bacteria. The method comprises the following steps: fermenting genetically engineered bacteria for producing cerebroside components in cordyceps sinensis, extracting mycelia with an organic solvent to obtain an extract, performing chromatographic separation to obtain cerebroside component enriched parts, and finally performing high performance liquid chromatography separation to obtain the cerebroside compounds in cordyceps sinensis. According to the method, the problems of harsh growth conditions, long period and low yield in the process of obtaining cerebroside from cordyceps sinensis can be solved, and the method has a wide application prospect.

Description

Technical Field

[0001] The invention belongs to the field of biopharmaceuticals, and in particular relates to a method for preparing cordycerebrosides by genetically engineering bacteria. Background Art

[0002] Cordyceps sinensis is a precious traditional Chinese medicine with a long history and culture, wide public recognition, unique resource distribution and important economic and social value. It is known as the treasure of Chinese medicine. Cordyceps sinensis is a dried complex of the fruiting body and larval corpse of the Cordyceps sinensis (BerK.) Sacc. of the ergot family parasitizing on the larvae of the bat moth family insects. It has multiple pharmacological effects such as immune regulation, anti-tumor, and anti-inflammatory. Literature reports that the cerebroside components in Cordyceps sinensis have significant immunosuppressive activity (the use of a class of cerebroside compounds as immunosuppressants, Chinese patent CN115010775A). Compared with the cerebroside components of plants and animals, the cerebroside components in Cordyceps sinensis contain a double bond between C8 and C9 of the sphingosine chain, and C9 is connected to a methyl group.

[0003] Cordyceps sinensis has harsh growing conditions and only grows in the Qinghai-Tibet Plateau at an altitude of 3,000-5,000 meters. It is rare and precious. Therefore, it is challenging to obtain a large amount of active chemical components directly from Cordyceps sinensis. In response to the bottleneck of the source of cerebroside components in Cordyceps sinensis, we successfully constructed a genetically engineered bacterium that produces cerebroside components in Cordyceps sinensis. On this basis, it is of great significance to establish a fast and efficient method for preparing cerebroside components in Cordyceps sinensis using genetically engineered bacteria. Summary of the invention

[0004] The present invention provides a method for preparing cerebrosides in Cordyceps sinensis by genetically engineered bacteria, characterized in that the cerebrosides are of formula (I), formula (II), formula (III) or formula (IV).

[0005]

[0006]

[0007] In one embodiment, the chassis strain of the genetically engineered bacteria is selected from Escherichia coli, Saccharomyces cerevisiae or Aspergillus oryzae; preferably, the chassis strain of the genetically engineered bacteria is Aspergillus oryzae.

[0008] In one embodiment, the genetically engineered bacteria produces cerebrosides by liquid fermentation or solid fermentation; preferably, the genetically engineered bacteria produces the cerebroside component of Cordyceps sinensis by liquid fermentation.

[0009] In one embodiment, the method comprises the following steps:

[0010] (1) inoculating the genetically engineered bacteria producing cordycerebroside into a liquid culture medium, and culturing at 28-30° C. and 180-220 rpm in a shaking incubator for 1-3 days to obtain a seed solution of the strain;

[0011] (2) taking the strain seed solution obtained in step (1) and inoculating it into a liquid fermentation medium, and culturing it in a shaking incubator at 28-30° C. and 180-220 rpm for 5-8 days to obtain a fermentation liquid of the strain;

[0012] (3) taking the fermentation liquid obtained in step (2), filtering to obtain mycelium, extracting with 88% to 93% methanol, ultrasonically treating for 30 min, soaking overnight, and filtering to obtain mycelium extract;

[0013] (4) The mycelium extract is directly separated by reverse phase column chromatography and eluted with 93% to 95% methanol and 98% to 100% methanol in sequence, and the eluate obtained by elution with 98% to 100% methanol is collected, which is the cerebroside component enrichment site;

[0014] (5) The cerebroside-enriched fraction obtained in step (4) is first separated by gel column chromatography and eluted with pure methanol, then separated by silica gel column chromatography with an elution system of chloroform-methanol, and finally purified by high performance liquid chromatography to obtain the cerebroside monomer compound in Cordyceps sinensis.

[0015] In a preferred embodiment, the liquid culture medium in step (1) is DPY culture medium, which comprises: 2% dextrin, 1% polypeptide, 0.5% yeast extract, 0.05% MgSO4·7H2O, 0.5% KH2PO4; the culture temperature is 28°C; the culture shaker speed is 220 rpm; and the culture time is 2 days.

[0016] In a preferred embodiment, the culture medium in step (2) is CD-starch culture medium, which comprises: 0.3% NaNO3, 0.2% KCl, 0.05% MgSO4·7H2O, 0.1% KH2PO4, 0.002% FeSO4·7H2O, 1% polypeptide, 2% starch, pH 5.5; the culture temperature is 28°C; the fermentation broth culture shaker speed is 220rpm; and the strain is fermented for 6 days.

[0017] In a preferred embodiment, the methanol concentration for extracting the mycelium in step (3) is 90% methanol.

[0018] In a preferred embodiment, the step (4) is to load the mycelium extract in step (3) onto an ODS chromatographic column, and elute with 93% methanol and 100% methanol in sequence, and collect the eluate obtained by 100% methanol elution; more preferably, the eluate obtained by 100% methanol elution is further concentrated.

[0019] In a preferred embodiment, the step (5) is to subject the cordyceroside-enriched part in step (4) to gel column chromatography, methanol elution, thin layer chromatography TLC (developing solvent: chloroform: methanol: water = 9: 1.5: 0.05; target cerebroside component Rf value range is 0.4-0.7) for tracking, and the cerebroside-enriched part is obtained by merging, and further separated by silica gel column chromatography, the elution system is chloroform-methanol, and the elution volume ratio is (95: 5, 90: 10, 80: 20, 75: 25, 70: 30, 65: 35, 60: 40, v / v, 1-3 each) . times column volume), thin layer chromatography TLC is also used for tracking, cerebroside parts are combined, and cerebroside compounds are prepared by high performance liquid chromatography; more preferably, the preparative high performance liquid chromatography purification conditions in step (5) are: the chromatographic column is a C18 preparative column (5μm, 21.2×250mm), the mobile phase conditions are 92% methanol-water, the flow rate is 8mL / min, the detection wavelength λ=208nm, and isocratic elution is performed, and finally four Cordyceps sinensis cerebroside compounds of formula (I), formula (II) & formula (III) mixture, formula (IV), formula (I) (t R :73.0min); mixture of formula (II) & formula (III) (t R :90.0min); Formula (IV) (t R :115.0min); further, since the compounds of formula (II) and formula (III) have similar polarity, they were further separated and purified using a phenyl column (5μm, 4.6×250mm), with a mobile phase of 88% methanol-water, a flow rate of 1mL / min, and a detection wavelength of λ=208nm. Isocratic elution was performed to obtain the compounds of formula (II) (t R :22.5min) and formula (III) (t R :27.0min) compound. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 Schematic diagram of the insertion of two expression cassettes, CsCerS1 and CsCerS2, into the AoCerS1 cleavage site through homologous recombination. DETAILED DESCRIPTION

[0021] The embodiments of the present invention are described in detail below. It should be noted that the described embodiments are exemplary and intended to be used to explain the present invention, but should not be construed as limiting the present invention.

[0022] The scheme of the present invention will be explained below in conjunction with the examples. It will be appreciated by those skilled in the art that the following examples are only used to illustrate the present invention and should not be considered to limit the scope of the present invention, and other methods for preparing the compounds of the present invention are considered to be within the scope of the present invention. Where specific techniques or conditions are not indicated in the examples, the techniques or conditions described in the literature in this area or the product specifications are followed. Where the manufacturers of the reagents or instruments used are not indicated, they are all conventional products that can be obtained commercially.

[0023] The experimental instruments used in this embodiment are as follows:

[0024] EYELA rotary evaporator N-1001 (Rikakikai Co., Ltd., Tokyo); Dionex analytical and preparative high performance liquid chromatographs (Thermo Fisher Scientific, USA); Phenomenex Gemini C 18 Preparative (21.2×250 mm, 5 μm) chromatographic column (Phenomenex, USA); Phenomenex Biphenyl analytical (4.6×250 mm, 5 μm) chromatographic column (Phenomenex, USA).

[0025] The reagents used in this example are as follows:

[0026] Analytical grade chloroform and methanol were purchased from Tianjin Fuyu Fine Chemical Co., Ltd.; deuterated pyridine was purchased from Sigma-Aldrich, Germany; chromatographic grade methanol was purchased from Shandong Yuwang Industrial Co., Ltd.; gel (Sephadex LH20) and silica gel (100-200 / 200-300 mesh) were purchased from Qingdao Ocean Chemical Co., Ltd.; ODS (50 μm) was purchased from YMC, Japan;

[0027] The following abbreviations are used throughout this manual:

[0028] t R : Retention time

[0029] Rf value: ratio shift value

[0030] Unless otherwise specified, the detection wavelength of the liquid chromatography analysis in the present invention is 208 nm, and the column temperature of the chromatographic column is 30°C.

[0031] Example 1 Construction of Genetically Engineered Bacteria AO-CsCerS1 / 2 for Producing Cordyceps Sinensis Cerebrosides 1. Construction of Chassis Strain Aspergillus oryzaeΔpyrG

[0032] The chassis bacteria were constructed according to conventional technical means in the art. Specifically, the pyrG gene of Aspergillus oryzae JNU24XJ0557 (the strain has a deposit number of CGMCC 41560, a deposit date of October 30, 2024, and is classified and named Aspergillus oryzae, and the deposit unit is the General Microbiology Center of China Microbiological Culture Collection Administration Committee) was mined using local blast, and its sgRNA expression cassette was designed according to the pyrG gene, and constructed into a pBlue-Cas9 plasmid containing a plasmid autonomous replication element AMA1 and a Cas9 expression cassette to construct a knockout plasmid, which was transfected into Aspergillus oryzae JNU24XJ0557, and screened using an SCD+Ura plate containing 1.3 mg / mL 5-FoA, and the clones grown on the plate were picked for genomic PCR verification and sequencing to obtain Aspergillus oryzae in which the pyrG gene was successfully knocked out. oryzaeΔpyrG strain, and clones with successful knockout of the pyrG gene verified by sequencing were inoculated on DPY and DPY+Ura plates for secondary verification, and clones that could only grow on DPY+Ura plates but not on DPY plates were selected for subsequent directed integration.

[0033] 2. pBlue-gRNA AoCerS1 Construction of -pyrG-Cas9 plasmid

[0034] Using sgRNACas9 software to screen and obtain gRNA targeting AoCerS1 AoCerS1 , gRNA AoCerS1 The nucleotide sequence is TCAACGCTTGGTTAAGCGGT (SEQ ID NO.1). Then, using primers containing the target sequence and other related primers, the U6 promoter and gRNA Scaffold fragment were amplified from the template plasmid, and finally the gRNA expression cassette targeting AoCerS1 (SEQ ID NO.2) was obtained by fusion PCR. It was then inserted into a plasmid containing a pyrG (pyrG element sequence is shown in SEQ ID NO.3) defect screening tag and a Cas9 expression cassette to form a knockout plasmid pBlue-gRNA AoCerS1 -pyrG-Cas9 (SEQ ID NO. 4).

[0035] 3. pHS AoCerS1- Construction of CsCerS1-CsCerS2 plasmid

[0036] Amplify the homology arm fragments of 1300 bp upstream and downstream of the AoCerS1 cleavage site from the genome of the chassis strain, and then insert them into the plasmid pESC through In-fusion to form the recombinant plasmid pHS AoCerS1 CsCerS1 and CsCerS2 were amplified from the genome of Cordyceps sinensis, and then inserted into the pBlue-amyB plasmid containing the amylase promoter and terminator, respectively. The CsCerS1 and CsCerS2 expression cassettes were amplified (the CsCerS1 expression cassette sequence is shown in SEQ ID NO.5, and the CsCerS2 expression cassette sequence is shown in SEQ ID NO.6), respectively, and then inserted into pHS by In-fusion. AoCerS1 In the formation of pHS AoCerS1 -CsCerS1-CsCerS2 (SEQ ID NO. 7).

[0037] 4. Insert pBlue-gRNA AoCerS1 -pyrG-Cas9 and pHS AoCerS1 -CsCerS1-CsCerS2 were simultaneously transfected into the base strain Aspergillus oryzaeΔpyrG to obtain a gene strain producing cerebrosides ( Figure 1 ).

[0038] 1) Separately transfer the pBlue-gRNA AoCerS1 -pyrG-Cas9 and pHS AoCerS1 -CsCerS1-CsCerS2 E. coli host cells were inoculated into 20-30 mL of LB liquid medium containing 100 μg / mL ampicillin antibiotics and cultured overnight, and then high-concentration (>1 μg / μL) recombinant plasmids were extracted for subsequent transfection experiments;

[0039] 2) Pick an appropriate amount of mycelium from the bottom plate of A.oryzaeΔpyrG strain and place it in 10 mL DPY+Ura medium (2% dextrin, 1% polypeptide, 0.5% yeast extract, 0.05% MgSO4·7H2O, 0.5% KH2PO4, 0.2% uracil) and culture at 28°C with shaking at 200 rpm for 1-2 days;

[0040] 3) Add 10 mL of the above culture solution to 100 mL of DPY+Ura medium, mix well, and culture at 28°C and 180 rpm for 1 day;

[0041] 4) Prepare 10 mL of TF solution 1: weigh 0.79 g (NH4)2SO4 and 0.1 g Yatalase lyase in a 15 mL centrifuge tube, add 10 mL of TF solution 0, turn it upside down to dissolve, and filter it into a 50 mL centrifuge tube using a 0.22 μm microporous filter;

[0042] 5) According to the concentration of the bacterial solution, take an appropriate amount of the bacterial solution into a sterilized syringe, filter the bacterial solution, squeeze and collect the bacterial cells, take out the bacterial cells with a sterilized long bamboo stick, put them into a centrifuge tube containing 10mL TF solution 1, and culture them in a constant temperature box at 30℃ and 70rpm for 3h to break the cell wall; when the supernatant is obviously turbid and light red, filter the protoplasted bacterial solution through the syringe filter into a 50mL centrifuge tube;

[0043] 6) Add an equal amount of TF solution 2, mix by inverting, centrifuge at 4°C, 1500 rpm for 10 min, discard the supernatant, add 5 mL of TF solution 2 to the precipitate, mix by inverting, aspirate 10 μL, count the number of protoplasts under a microscope using a hemocytometer, centrifuge at 4°C, 1500 rpm for 10 min, discard the supernatant, and add an appropriate volume of TF solution 2 (according to the number of protoplasts counted above, dilute or concentrate appropriately to make the protoplast concentration between 1 and 5 × 10 7 / mL), mix by inverting;

[0044] 7) Take 200 μL of the protoplast solution into a 15 mL centrifuge tube, add 10 μL of the recombinant plasmid at a concentration of 1 μg / μL, mix well, and let stand on ice for 30 min. Add 250 μL, 250 μL, and 850 μL of TFsolution 3 to the suspension three times, respectively. After each addition, gently mix with a 1 mL pipette tip and let stand at room temperature for 20 min.

[0045] 8) After standing, add 5 mL of TF solution 2 to a 15 mL centrifuge tube, mix by inverting, centrifuge at 4°C, 1500 rpm for 10 min, discard the supernatant, add 200 μL of TF solution 2, gently suspend, add to the center of the lower culture medium, and quickly add the upper culture medium around it, and shake quickly;

[0046] 9) After the above culture medium plate is blown dry, it is wrapped with parafilm and placed upside down in a 28°C incubator for 3-7 days. The transformed strains are picked and then verified by PCR. The strains with positive PCR results are used for subsequent fermentation experiments.

[0047] Example 2 Fermentation and product enrichment of genetically engineered bacteria AO-CsCerS1 / 2

[0048] After the genetically engineered bacteria AO-CsCerS1 / 2 was activated by PDA slant, an appropriate amount of mycelium was picked out and placed in 10 mL DPY medium (2% dextrin, 1% polypeptide, 0.5% yeast extract, 0.05% MgSO4·7H2O, 0.5% KH2PO4), and cultured at 28°C and 200 rpm for 1-2 days; 10 mL of the above culture solution was added to 100 mL DPY medium, mixed and cultured at 28°C and 180 rpm for 1 day to obtain seed solution. According to the inoculum amount of 10mL seed liquid / bottle, it was inoculated into CD-starch fermentation medium (0.3% NaNO3, 0.2% KCl, 0.05% MgSO4·7H2O, 0.1% KH2PO4, 0.002% FeSO4·7H2O, 1% polypeptide, 2% starch, pH 5.5), and a total of 350 bottles were fermented in a shaking incubator at 220rpm and 28°C for 6 days.

[0049] The obtained fermentation liquid was filtered to obtain mycelium, which was then extracted three times with 90% methanol and water to obtain 35 L of bacterial extract. The extract was adsorbed on an ODS column and eluted with 93% methanol and 100% methanol in sequence. The 100% methanol eluate was collected to obtain the eluate, which was the cerebroside-enriched part. The solid product of about 7.30 g was obtained by concentration and drying.

[0050] The obtained solid product was further separated and purified by a gel column (Sephadex LH-20) and isocratically eluted with pure methanol to obtain four fractions, CSM-1 (1.21 g), CSM-2 (0.73 g), CSM-3 (4.35 g), and CSM-4 (0.33 g). The fractions where the target compound was located were tracked by TLC thin layer chromatography (developing solvent: chloroform: methanol: water = 9:1.5:0.05; Rf value range of target compound: 0.4-0.7), and it was found that the cerebroside compounds were mainly concentrated in the CSM-3 fraction. Next, the CSM-3 fraction was further separated by silica gel column chromatography (5*30 cm) in a chloroform-methanol elution system (95:5, 90:10, 80:20, 75:25, 70:30, 65:35, 60:40, v / v, 500 mL each) to obtain 5 fractions (CSM-3-1, CSM-3-2, CSM-3-3, CSM-3-4, CSM-3-5). The fraction containing the target compound was traced to CSM-3-4 by TLC thin layer chromatography (developing solvent: chloroform: methanol: water = 9:1.5:0.05; Rf value range of the target compound was 0.4-0.7). The CSM-3-4 fraction (2.06 g) was prepared by methanol-water (92:8, v / v) and further purified by a Pheromone C18 preparative column (21.2×250 mm) at a flow rate of 8 mL / min to obtain a mixture of cerebroside compounds of formula (I), formula (II) and formula (III), wherein formula (I) (t R :73.0min,460.3mg), mixture of formula (II) & formula (III) (t R :90.0min,850.8mg), formula (IV) (t R :115.0min,350.6mg). Further, since the polarity of formula (II) and formula (III) is similar, a phenomenyl analytical column (5μm, 4.6×250mm) is used to further separate and purify them. The mobile phase conditions are 88% methanol-water, the flow rate is 1mL / min, and the detection wavelength λ=208nm. Formula (II) (t R :22.5min,700.8mg), formula (III) (t R :27.0min,89.2mg). By comparing the NMR data of the cerebroside compounds of formula (I), formula (II), formula (III) and formula (IV) isolated from Cordyceps sinensis, the structures of the cerebroside compounds of formula (I), formula (II), formula (III) and formula (IV) isolated from the genetically engineered bacteria AO-CsCerS1 / 2 were determined. The results are shown in Tables 1, 2, 3 and 4.

[0051] Table 1 NMR data attribution of formula (I) (400MHz, in Pyr-d5)

[0052]

[0053]

[0054]

[0055]

[0056] * Signals may be interchanged within the same column

[0057] Table 2 NMR data assignment of formula (II) (400MHz, in Pyr-d5)

[0058]

[0059]

[0060]

[0061]

[0062] * Signals may be interchanged within the same column

[0063] Table 3 NMR data attribution of formula (III) (600MHz, in Pyr-d5)

[0064]

[0065]

[0066]

[0067]

[0068] * Signals may be interchanged within the same column

[0069] Table 4 NMR data attribution of formula (IV) (400MHz, in Pyr-d5)

[0070]

[0071]

[0072]

[0073]

[0074] *Signals may be interchanged within the same column

[0075] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. A method for preparing cerebrosides from Cordyceps sinensis by genetically engineering bacteria, characterized in that: The method comprises: introducing two ceramide synthase genes CsCerS1 and CsCerS2 derived from Cordyceps sinensis into the chassis strain, and the cerebroside is of formula (I), formula (II), formula (III) and formula (IV):

2. The method according to claim 1, characterized in that The chassis strain of the genetically engineered bacteria is selected from Escherichia coli, Saccharomyces cerevisiae, or Aspergillus oryzae.

3. The method according to claim 2, characterized in that The chassis strain of the genetically engineered bacteria is preferably Aspergillus oryzae.

4. The method according to claim 1, characterized in that The genetically engineered bacteria produces cerebrosides through liquid fermentation or solid fermentation.

5. The method according to any one of claims 1 to 4, characterized in that: The method comprises the following steps: (1) inoculating the genetically engineered bacteria producing cordycerebroside into a liquid culture medium, and culturing at 28-30° C. and 180-220 rpm in a shaking incubator for 1-3 days to obtain a seed solution of the strain; (2) inoculating the strain seed solution obtained in step (1) into a liquid fermentation medium, and culturing at 28-30° C. and 180-220 rpm in a shaking incubator for 5-8 days to obtain a fermentation liquid of the strain; (3) taking the fermentation liquid obtained in step (2), filtering to obtain mycelium, extracting with 88% to 93% methanol, ultrasonically treating for 30 min, soaking overnight, and filtering to obtain mycelium extract; (4) The mycelium extract is directly separated by reverse phase column chromatography and eluted with 93% to 95% methanol and 98% to 100% methanol in sequence, and the eluate obtained by elution with 98% to 100% methanol is collected, which is the cerebroside component enrichment site; (5) The cerebroside-enriched fraction obtained in step (4) is first separated by gel column chromatography and eluted with pure methanol, then separated by silica gel column chromatography with an elution system of chloroform-methanol, and finally purified by high performance liquid chromatography to obtain the cerebroside monomer compound in Cordyceps sinensis.

6. The method according to claim 5, characterized in that The liquid culture medium in step (1) is DPY culture medium, which comprises: 2% dextrin, 1% polypeptide, 0.5% yeast extract, 0.05% MgSO4·7H2O, 0.5% KH2PO4; the culture temperature is 28°C; the culture shaker speed is 220rpm; and the culture time is 2 days.

7. The method according to claim 5, characterized in that The culture medium in step (2) is CD-starch culture medium, which comprises: 0.3% NaNO3, 0.2% KCl, 0.05% MgSO4·7H2O, 0.1% KH2PO4, 0.002% FeSO4·7H2O, 1% polypeptide, 2% starch, and a pH of 5.5; the culture temperature is 28°C; the fermentation broth culture shaker speed is 220rpm; and the strain is fermented and cultured for 6 days.

8. The method according to claim 5, characterized in that The methanol concentration of the mycelium extracted in step (3) is 90% methanol.

9. The method according to claim 5, characterized in that The step (4) is to load the mycelium extract in step (3) onto an ODS chromatographic column, and sequentially elute with 93% methanol and 100% methanol, and collect the 100% methanol elution to obtain an eluate.

10. The method according to claim 5, characterized in that The step (5) is to subject the cordyceps sinensis cerebroside enriched part in step (4) to gel column chromatography, methanol elution, thin layer chromatography TLC tracking, merge to obtain cerebroside enriched parts, continue to separate through silica gel chromatography column, the elution system is chloroform-methanol, the elution volume ratio is 95:5, 90:10, 80:20, 75:25, 70:30, 65:35, 60:40, v / v, each 1-3 times column volume, and thin layer chromatography TLC is also used for tracking, cerebroside parts are merged, and cerebroside compounds are prepared by high performance liquid chromatography, and finally cerebroside compounds in cordyceps sinensis are obtained, which are respectively formula (I), formula (II), formula (III), and formula (IV).

Images