Method for detecting target nucleic acid molecule

Abstract

The present invention relates to a method for reading or decoding nucleotide barcode sequences. In particular, the present invention provides a method of detecting a target nucleic acid molecule, comprising using a signal code sequence corresponding to the nucleic acid molecule and a plurality of labeled detection probes, the detection probes generating a signal constituting the signal code sequence. In particular, the present invention provides a continuous barcoding and decoding scheme that employs a hybridization sequencing (SBH) strategy to sequence and decode nucleotide barcode sequences and distinguish the nucleotide barcode sequence from other nucleotide barcode sequences. In an extension of the method, the present application also provides a new coding scheme for providing a target nucleic acid having a code based on detectable "color" (or similar signal).

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application is a divisional application of the Chinese patent application with application number 2020800405374 and invention name “Method for detecting target nucleic acid molecules”. The parent application is the PCT international patent application PCT / EP2020 / 065090 filed on May 29, 2020, which entered the Chinese national phase. Technical Field

[0003] The present invention relates to methods for reading or decoding nucleotide barcode sequences. In particular, the present invention provides a sequential barcoding and decoding scheme that utilizes a sequencing by hybridization (SBH) strategy to sequence and decode barcodes and distinguish the nucleotide barcode sequences from other nucleotide barcode sequences. The present invention is based on a novel design of barcode sequences and detection probes that hybridize to the barcode sequences in order to sequence the barcodes. In an extension of this method, the present invention also includes a novel encoding scheme for providing a detectable "color" (or similar signal) based code to a target nucleic acid. A more general method for detecting a target nucleic acid molecule is also disclosed herein. Background Art

[0004] Nucleotide barcoding systems are used in a variety of applications that require detection and / or quantification of specific nucleic acid molecules, such as transcriptional profiling and sequencing methods, or in fact in any nucleic acid analysis method that requires detection and differentiation of multiple different nucleic acids, including, for example, diagnostic applications. In short, each nucleic acid sequence to be detected or identified is assigned a unique barcode sequence. At its simplest, the barcode can be detected by a detection probe designed to specifically hybridize to a given barcode sequence. However, various sequencing strategies can be used to sequence and thereby identify the barcode sequence, including by SBH. In general, SBH involves the use of hybridization probes designed to hybridize and detect specific bases or specific sequences to detect and assemble sequences present in the target nucleic acid molecule. In the SBH strategy, the barcode sequence can be decoded or "read" using complementary labeled detection probes by observing which labeled detection probes hybridize to the barcode sequence. Typically, in SBH, each detection probe is designed to sequence or "read" one base at a time; a set of 4 probes contains different bases at positions complementary to the base to be sequenced, and detects which of the probes in the set at that position is hybridized. The sequence flanking the detection position in the detection probe can be complementary to a reference sequence of the target to allow the probe to hybridize with the target, or more generally to decode a barcode that can be degenerate. Therefore, the barcode typically, although not necessarily, comprises a continuous sequence of bases, each individual base corresponding to a position of the barcode, and a series of detection probes are used to sequence (read) a single base of the barcode sequence. The identity of the barcode sequence can thereby be determined, and therefore the identity of the related nucleic acid molecule. Discontinuous barcodes in which barcode positions are not adjacent and / or barcodes in which barcode positions can contain more than one base can be read similarly using a series of detection probe sets designed to read each barcode position.

[0005] The barcode sequence may be provided directly within the target molecule, for example it may be directly linked to the target nucleic acid molecule, for example by a ligation reaction, or it may be incorporated into, for example, an amplification product, for example by using a primer containing the barcode sequence, or it or its complement may simply be provided as part of the target molecule, for example when the target molecule is a probe or some other synthetic molecule. Alternatively, the barcode may be introduced or provided indirectly using an intermediate or "sandwich" probe that hybridizes to the target nucleic acid molecule. These probes typically contain a sequence complementary to a portion of their corresponding target nucleic acid molecule, and a separate non-target complementary sequence containing the barcode.

[0006] These intermediate or sandwich probes can be in the form of so-called "L-probes". The L-probe is the simplest version of the sandwich probe design. It consists of two parts, the first part contains a target nucleic acid recognition site that directly binds to the target nucleic acid molecule, and the second part does not hybridize with the target nucleic acid molecule, so a single-stranded overhang is formed when the probe hybridizes, and it contains a barcode sequence, thereby containing a binding site for the detection probe. The probe can thus be considered to form an L shape when hybridized with the target nucleic acid molecule. The barcode can be a continuous sequence (e.g., an adjacent series of bases), or it can be represented by two or more separate detection probe binding sites, which are provided separately in the overhang sequence.

[0007] As a modification of the L-probe, the sandwich probe can have a "U-probe" design, in which the target recognition site is flanked by two sequences that are non-target complementary sequences and that contain the sequence that constitutes the barcode. Having two flanking sequences instead of one (as in the L-probe) can increase the encoding capacity.

[0008] The encoding capacity of a nucleotide barcoding system using a continuous barcode sequence, i.e., the number of different barcode sequences that can be generated, and therefore the number of different nucleic acid sequences that can be distinguished, is limited by the length of the barcode sequence. For a system using a barcode sequence of length n nucleotides, the number of possible barcode sequences is 4 n Therefore, in applications requiring high diversity, that is, where a large number of nucleic acid sequences need to be distinguished, the length of the barcode sequence needs to be increased in order to assign a unique barcode to each nucleic acid sequence. The use of longer barcode sequences can cause problems with the specificity of the decoding system, because off-site binding of the detection probe becomes more common when the system contains multiple long barcode sequences that differ by only a single nucleotide.

[0009] In addition, the number of different barcode sequences that can be identified may be limited by the number of different labels available. If a large number of nucleic acid sequences need to be distinguished, it may not be possible to have probes with different labels for each sequence. Therefore, many barcoding methods use a limited pool of labels and require multiple detection cycles to decode the barcode sequence. These methods thus involve repeated hybridization of labeled detection probes, imaging the sample to detect the labels that have been hybridized, and removing the hybridized labeled detection probes so that the next cycle can be started. In this way, a specific sequence of labels, such as a color sequence that has been detected, can be detected to form a code composed of the label (e.g., a "color code" composed of a fluorophore label), which distinguishes a specific (i.e., target) nucleic acid.

[0010] Once the hybridized labeled detection probe has been presented, methods for removing or dehybridizing it may be difficult, and thus this step often involves the use of high temperatures and / or potentially toxic chemicals such as formamide to denature or destroy the hybridization between the barcode and the detection probe. However, these methods can damage the sample and may also interfere with the desired downstream reactions. For example, formamide stripping is known to damage proteins present in the sample. This may be particularly problematic if decoding methods are used in situ, such as transcriptional profiles for different cell types. The damage caused by formamide can affect the epitope recognition of the antibody and may thus destroy any subsequent immunohistochemical reactions that may be necessary. In addition, the use of high temperatures means that automation of the decoding method is much more difficult. Therefore, this makes the method more labor-intensive and thus more expensive.

[0011] In view of these problems, there is a need for alternative methods of encoding and decoding nucleotide barcode sequences, particularly cost-effective methods that are suitable for high multiplex situations and that provide high specificity and accuracy without damaging the sample of target nucleic acid molecules being analyzed. Summary of the invention

[0012] The inventors have developed a method for encoding and decoding nucleotide barcode sequences in nucleic acid molecules so as to distinguish the nucleotide barcode sequences from other nucleotide barcode sequences. The method is based on a nucleotide barcode sequence design comprising a plurality of consecutive barcode positions that can be queried separately and consecutively. The nucleotide barcode sequence is essentially divided into a plurality of consecutive barcode positions, wherein each barcode position comprises at least one barcode subunit. This sequential analysis of a plurality of barcode positions significantly improves the encoding capability of the system. In a representative example, a nucleotide barcode sequence according to the present invention can comprise any one of 16 barcode subunit sequences at each barcode position. Thus, if n is the number of positions measured, then relative to the 4 of the above method using a simple consecutive barcode sequence, the encoding capability of the barcode subunit can be increased by 1.5 times. n , the method of the present invention can encode 16 n Different barcode sequences. This increase in encoding power means that the method of the present invention can be applied to highly multiplexed situations without the need for long barcode sequences, thereby avoiding the aforementioned specificity problems. The increased diversity of the method also allows more nucleic acid molecules to be distinguished in parallel in a shorter time than the above method, thereby reducing the time and cost involved. Even in cases where multiplicity is not a limiting factor, the number of possible permutations of barcode sequences is significantly increased, meaning that barcode sequences assigned to nucleic acid sequences can be designed so that they are not too similar to each other. This reduces off-target binding of detection probes and therefore improves the specificity and accuracy of the method.

[0013] The present decoding method further involves contacting the nucleotide barcode sequence with the detection probe and detecting multiple cycles of signals (as described above) from the detection probe that has hybridized with the nucleotide barcode sequence. Importantly, according to the present invention, the detection probes are designed so that they can be used to remove or promote the removal of the prior detection probe by a process involving a chain displacement reaction. The chain displacement reaction can be triggered by a toehold exchange involving a subsequent detection probe, and when the subsequent detection probe hybridizes with the barcode sequence at the subsequent barcode position, it can invade the hybrid between the prior detection probe and the nucleotide barcode sequence, so that the hybrid between the nucleotide barcode sequence and the prior detection probe is destroyed. The prior detection probe can be completely replaced by the subsequent detection probe, or the partial destruction of the hybrid may be sufficient to subsequently cause the prior detection probe to dissociate from the nucleotide barcode sequence. The use of this chain displacement reaction avoids the use of destructive chemicals to remove hybridized detection probes, and provides an effective and efficient removal system. It further allows the method to be performed at room temperature.

[0014] Thus, in one aspect, the present disclosure and invention provide a method of decoding a nucleotide barcode sequence in a nucleic acid molecule so as to distinguish the nucleotide barcode sequence from other nucleotide barcode sequences, wherein the nucleotide barcode sequence comprises a plurality of consecutive barcode positions, each barcode position partially but not completely overlapping with an adjacent barcode position in the sequence, and each barcode position comprises at least one barcode subunit, wherein the barcode subunit is selected from a panel of barcode subunits, such that the order of the barcode positions (and therefore the order of the barcode subunits) in each nucleotide barcode sequence defines a signal code sequence comprising a signal code corresponding to each barcode position and distinct from a signal code sequence of other nucleotide barcode sequences, and identifying a given nucleotide barcode sequence, the method comprising:

[0015] (i) contacting the nucleic acid molecule with a first set of first detection probes to decode a nucleotide barcode sequence at a first contiguous barcode position, and hybridizing the detection probes to the nucleic acid molecule, wherein each detection probe in the set comprises a sequence complementary to a different barcode subunit in the small group and a reporter molecule, such that each detection probe is capable of hybridizing to and detecting a different barcode subunit at the first barcode position;

[0016] (ii) detecting a signal from the reporter molecule of the first detection probe, wherein the first detection probe has hybridized to the nucleotide barcode sequence at the first contiguous barcode position;

[0017] (iii) a signal code identifying the location of the first barcode from the signal detected in (ii);

[0018] (iv) contacting the nucleotide barcode sequence with a next set of subsequent detection probes to decode the nucleotide barcode sequence at the next consecutive barcode position and hybridizing the detection probes to the nucleic acid molecule, wherein each detection probe comprises a sequence complementary to a different barcode subunit in the small group and a reporter molecule, such that each detection probe is capable of hybridizing to and detecting a different barcode subunit at the barcode position, and wherein the subsequent detection probe that hybridizes to the barcode subunit at the next position is capable of hybridizing (or more specifically, hybridizing) to a sequence in an overlapping portion of the prior barcode position and thereby initiating a strand displacement reaction that displaces the hybridized prior detection probe;

[0019] (v) detecting a signal from the reporter molecule of the subsequent detection probe that has hybridized to the nucleotide barcode sequence at the next consecutive barcode position;

[0020] (vi) identifying the signal code of the next barcode position from the signal detected in (v);

[0021] (vii) repeating steps (iv)-(vi) to identify signal codes for subsequent consecutive barcode positions until a signal code sufficient to decode the nucleotide barcode sequence has been identified,

[0022] The first contiguous barcode position may be any barcode position in the nucleotide barcode sequence.

[0023] A barcode subunit is an element of a barcode, i.e., an element of a barcode that is read (i.e., decoded); the barcode contained in (or provided by) the nucleotide barcode sequence is composed of barcode subunits. In other words, the barcode subunits, and the order in which they appear, together constitute the barcode contained in the nucleotide barcode sequence. A barcode position may contain more than one barcode subunit, and / or it may contain a sequence that is not a barcode subunit sequence, such as a spacer sequence. Thus, although the barcode positions in the nucleotide barcode sequence partially overlap and are sequentially connected in the barcode sequence, the barcode subunits are not necessarily adjacent in the sequence, although in one embodiment they may be adjacent.

[0024] A barcode position is a subsequence of the nucleotide barcode sequence. Although overlapping, each barcode position is different from its immediate neighbors. A barcode position may be distinguished from an adjacent (i.e., adjacent) barcode position by its sequence, although the barcode subunit of a barcode position is not necessarily different from the barcode subunit of the immediate neighbor. A barcode position may have a different barcode subunit than an adjacent neighbor and / or a different spacer sequence than its adjacent neighbor.

[0025] Barcode positions partially overlap adjacent (i.e., neighboring) positions. Thus, a barcode position at the end of a barcode sequence overlaps one neighboring barcode position, while an interior barcode position (i.e., a barcode position located between the end barcode positions) partially overlaps an adjacent barcode position on each side. Thus, an interior barcode position may completely overlap when two adjacent positions are considered, but will not be completely overlapped by a single adjacent barcode position.

[0026] When a barcode position contains more than one subunit, a single subunit can overlap with an adjacent barcode position (or barcode subunit) as long as all barcode subunits of a position do not overlap with a single adjacent barcode position. Thus, each barcode position contains at least one barcode subunit that does not overlap with a single adjacent barcode position on one side (although different barcode subunits of a barcode position may overlap with adjacent barcode positions (barcode subunits) on each side). Thus, when a barcode position contains a single barcode subunit, the barcode subunits do not overlap. When a barcode position consists of only barcode subunits and has no spacer sequence, each barcode position differs from each other by at least one barcode subunit.

[0027] In a specific embodiment, the barcode positions comprise barcode subunits flanked by spacer sequences. In other words, the barcode subunits are separated by spacer sequences. The spacer sequences of adjacent barcode positions may overlap. In such embodiments, the nucleotide barcode sequence may be considered a discontinuous barcode sequence, wherein the barcode subunits are not adjacent. Figure 1 A schematic representation of the barcode positions (numbered) and arrangement of barcode subunits in such a configuration is shown in A.

[0028] Thus, in one such embodiment, the invention provides a method of decoding a nucleotide barcode sequence in a nucleic acid molecule to distinguish the nucleotide barcode sequence from other nucleotide barcode sequences, wherein the nucleotide barcode sequence comprises a plurality of consecutive barcode positions, each barcode position comprising a first spacer sequence, a barcode subunit, and a second spacer sequence, wherein the second spacer sequence from each barcode position at least partially overlaps with the first spacer sequence of an adjacent barcode position in the sequence, and wherein each barcode subunit is selected from a small group of barcode subunits such that the order of the barcode subunits in each barcode sequence is different from other barcode sequences, and identifying a given barcode sequence, the method comprising:

[0029] (i) contacting the nucleic acid molecule with a first set of first detection probes to decode the nucleotide barcode sequence at the first contiguous barcode position, and hybridizing the detection probes to the nucleic acid molecule, wherein each detection probe comprises a first flanking sequence complementary to at least a portion of the first spacer sequence at the first barcode position, a sequence complementary to a barcode subunit, a second flanking sequence complementary to at least a portion of the second spacer sequence at the first barcode position, and a reporter molecule, wherein each detection probe comprises a sequence complementary to a different barcode subunit in the small set, such that each detection probe is capable of hybridizing to and detecting a different barcode subunit at the first barcode position;

[0030] (ii) detecting a signal from the reporter molecule of the first detection probe, wherein the first detection probe has hybridized to the nucleotide barcode sequence at the first contiguous barcode position;

[0031] (iii) determining the identity of the first barcode subunit from the signal detected in (ii);

[0032] (iv) contacting the nucleotide barcode sequence with a next set of subsequent detection probes to decode the nucleotide barcode sequence at the next consecutive barcode position and hybridizing the detection probes to the nucleic acid molecule, wherein each detection probe comprises a first flanking sequence complementary to at least a portion of the first spacer sequence at the subsequent barcode position, a sequence complementary to a barcode subunit, a second flanking sequence complementary to at least a portion of the second spacer sequence at the subsequent barcode position, and a reporter molecule, wherein each detection probe comprises a sequence complementary to a different barcode subunit in the small group, such that each detection probe is capable of hybridizing to and detecting a different barcode subunit at the barcode position, and wherein the subsequent detection probe that hybridizes to the barcode subunit at the next position hybridizes to at least a portion of the second spacer sequence at the prior barcode position and thereby initiates a strand displacement reaction that displaces the hybridized prior detection probe;

[0033] (v) detecting a signal from the reporter molecule of the subsequent detection probe that has hybridized to the nucleotide barcode sequence at the next consecutive barcode position;

[0034] (vi) determining the identity of the next barcode subunit from the signal detected in (v);

[0035] (vii) repeating steps (iv)-(vi) to decode subsequent consecutive barcode positions until the identity of the position of the subunit barcode sequence sufficient to decode the nucleotide barcode sequence has been determined,

[0036] The first continuous barcode position can be any barcode position in the nucleic acid molecule.

[0037] In another embodiment, the barcode position does not contain any spacer sequence, or indeed any other sequence. Thus, in one embodiment, the nucleotide barcode sequence comprises only barcode subunits (or consists of barcode subunits). In such embodiments, to ensure that the barcode positions partially overlap, it can be seen that each barcode position contains more than one barcode subunit (i.e., at least 2 subunits). Thus, the barcode positions can overlap at the barcode subunits (or at least one subunit), but can also contain barcode subunits (or at least one subunit) that do not overlap with adjacent barcode positions. In such embodiments, the barcode sequence can be viewed as a continuous barcode sequence, in which the barcode subunits are adjacent to each other. In such embodiments, the barcode positions can be defined by specific combinations (e.g., pairs) of subunits. In Figure 1 A schematic representation of the barcode positions (numbered) and arrangement of barcode subunits in such a configuration is shown in B.

[0038] In such embodiments, the invention provides a method of decoding a nucleotide barcode sequence in a nucleic acid molecule to distinguish the nucleotide barcode sequence from other nucleotide barcode sequences, wherein the nucleotide barcode sequence comprises a plurality of consecutive barcode positions, each barcode position comprising a barcode subunit pair comprising a first barcode subunit and a second barcode subunit, wherein the second barcode subunit from each barcode position at least partially overlaps with the first barcode subunit of an adjacent barcode position in the sequence, such that the order of the barcode subunit pairs in each nucleotide barcode sequence defines a signal code sequence comprising a signal code corresponding to each barcode subunit pair and distinct from a signal code sequence of other nucleotide barcode sequences, and identifying a given nucleotide barcode sequence, the method comprising:

[0039] (i) contacting the nucleic acid molecule with a first set of first detection probes to decode the nucleotide barcode sequence at a first contiguous barcode position, and hybridizing the detection probes to the nucleic acid molecule, wherein each detection probe comprises a sequence complementary to a different barcode subunit pair and a reporter molecule, such that each detection probe is capable of hybridizing to and detecting a different barcode subunit pair at the first barcode position;

[0040] (ii) detecting a signal from the reporter molecule of the first detection probe, wherein the first detection probe has hybridized to the nucleotide barcode sequence at the first contiguous barcode position;

[0041] (iii) identifying a signal code for a first barcode subunit pair from the signal detected in (ii);

[0042] (iv) contacting the nucleotide barcode sequence with a next set of subsequent detection probes to decode the nucleotide barcode sequence at the next consecutive barcode position and hybridizing the detection probes to the nucleic acid molecule, wherein each detection probe comprises a sequence complementary to a different barcode subunit pair and a reporter molecule, such that each detection probe is capable of hybridizing to and detecting a different barcode subunit pair at the barcode position, and wherein the subsequent detection probe that hybridizes to the barcode subunit at the next position hybridizes to a sequence in an overlapping portion of the prior barcode position and thereby initiates a strand displacement reaction that displaces the hybridized prior detection probe;

[0043] (v) detecting a signal from the reporter molecule of the subsequent detection probe that has hybridized to the nucleotide barcode sequence at the next consecutive barcode position;

[0044] (vi) identifying the signal code of the next barcode subunit pair from the signal detected in (v);

[0045] (vii) repeating steps (iv)-(vi) to identify signal codes for barcode subunit pairs at subsequent consecutive barcode positions until a signal code sufficient to decode the nucleotide barcode sequence has been identified,

[0046] The first contiguous barcode position may be any barcode position in the nucleotide barcode sequence.

[0047] Other aspects and embodiments are also disclosed herein, including alternative methods of decoding nucleotide barcode sequences and detecting target nucleic acid molecules. These will be further described below.

[0048] The methods presented above will now be discussed in more detail.

[0049] It will be appreciated that in step (vii) of the method, the above steps (iv)-(vi) are repeated until sufficient signal codes have been identified to determine the signal code sequence. The nucleotide barcode sequence can be identified or decoded from the signal code sequence. Thus, sufficient signal codes can be identified until sufficient signal code sequences have been determined, from which the nucleotide barcode sequence can be identified and thus the nucleotide barcode sequence can be decoded. The method herein thus involves a series of cycles, which are sequentially performed to determine or generate a signal code sequence corresponding to (or representing) the nucleotide sequence barcode, and thereby decode the nucleotide barcode sequence. Steps (i)-(iii) can be considered as the first cycle of the method. Each repetition of steps (iv)-(vi) can thus be considered as a further cycle of the method. It is not necessary to read or decode all barcode positions to compile (or assemble) a complete signal code sequence, but in one embodiment this can be the case. In another embodiment, for example when there are a small number of barcodes, it may not be necessary to decode the complete barcode sequence in order to be able to distinguish them, and an incomplete number of cycles may be sufficient. Some barcodes in a sample may require a greater number of cycles in order to be distinguished from another barcode.

[0050] In some embodiments, the step of identifying the signal code can directly identify the barcode subunit at the position (i.e., the signal code can directly correspond to a specific barcode subunit that may be present at the position). In other embodiments, a given signal code at a position may not be used to identify a specific subunit at the position, and the identity of a series (i.e., sequence) of signal codes (i.e., signal code sequences, or sufficient portions thereof) may be required to identify a given nucleotide barcode sequence. Thus, the method essentially "converts" a nucleotide barcode sequence into a signal code sequence that identifies a specific nucleotide barcode sequence. A nucleotide barcode sequence can be assigned a signal code sequence corresponding to a barcode subunit present in the barcode. For example, a color code sequence BRYGBR (where B = blue, R = red, G = green, and Y = yellow) can be assigned to a nucleotide barcode sequence BC1-BC2-BC3-BC4-BC5-BC6 (where BCx represents one or more barcode subunits present at positions x = 1-6 in the barcode sequence). It can be seen that the same color (signal code) may need to be used for different subunits or different positions, but barcodes can be designed to produce unique signal code sequences that distinguish them from each other. In order to decode which nucleotide barcode sequence is present, the detection probe can be used to read the barcode sequence at each position and obtain a color code sequence that can thereby identify or determine the nucleotide barcode sequence.

[0051] Since the first continuous barcode position can be any barcode position, it can be seen that the barcode sequence can be read (decoded) in any order, thus, the first continuous barcode position can be a barcode position at or closest to the 5' or 3' end of the nucleic acid molecule. It can be the first barcode position or the last barcode position from the 5' end of the barcode sequence. In addition, the first continuous barcode position can be an "internal" barcode position of the barcode sequence. The method can be performed simultaneously or sequentially from more than one barcode position. In other words, the barcode can be read from different barcode positions. In such embodiments, the barcode position can be read more than once. The method can be used to detect nucleotide barcode sequences and distinguish nucleotide barcode sequences from other barcode sequences present in the sample being tested or studied. Therefore, the method can be performed on a sample containing a plurality of different nucleotide barcode sequences, or more particularly on a sample containing a plurality of nucleic acid molecules containing different nucleotide barcode sequences. "Multiple" or "multiplicity" as used herein refers to at least 2.

[0052] Since the consecutive barcode positions each partially but not completely overlap with the adjacent barcode position in the sequence, the barcode position thus comprises at least one overlapping region that overlaps with the adjacent barcode position in the sequence, and a non-overlapping region that does not overlap with the adjacent barcode position in the sequence. Thus, relative to one (i.e., relative to one or relative to a single) adjacent (adjacent) barcode position, a given barcode position comprises a region (i.e., a common region) that is identical or homologous in the sequence. The barcode position comprises another region that is non-overlapping and different from the non-overlapping region of the adjacent position. The common region is capable of hybridizing with the common complementary region in the two sets of detection probes used to detect each of the two barcode positions. In certain embodiments, the non-overlapping region cannot hybridize with the subsequent detection probe used to decode the next barcode position. However, in other embodiments, the non-overlapping region can hybridize with the subsequent detection probe used to decode the next barcode position. Therefore, in one embodiment, different regions cannot hybridize with the detection probe used for the adjacent barcode position, but this is not required. Different regions can include barcode subunits. The common region may comprise a barcode subunit (which is thus shared between two adjacent positions) or a spacer region (which is shared).

[0053] In one embodiment, non-overlapping (i.e., distinct) regions of a given barcode position may be capable of hybridizing to a subsequent detection probe used to decode the next barcode position. Figure 5This embodiment is illustrated in , which shows a barcode sequence consisting of 2 barcode positions, each barcode position comprising a barcode subunit (C or T) surrounded by a spacer sequence (xxxxx or zzzzz). A first detection probe complementary to the first barcode position hybridizes with the barcode sequence and detects a signal. The barcode sequence is then contacted with a second detection probe comprising a sequence complementary to both the second barcode position and the first barcode position. Therefore, the region of the second detection probe complementary to the second barcode position can act as a foothold, allowing the second detection probe to hybridize with the barcode sequence and remove the prior detection probe via strand displacement. The extended sequence of the second detection probe ensures that the prior detection probe is completely displaced. It can therefore be seen that the detection probe used to decode a given barcode position can also include a sequence complementary to the prior barcode position. The detection probe can include a sequence complementary to multiple adjacent barcode positions. In such a design, the region of the subsequent detection probe that is complementary to the barcode subunit of the prior detection probe can be located at the same position as the prior barcode subunit (such as Figure 5 Thus, a subsequent detection probe can be synthesized so that all 4 bases are incorporated at this position (in other words, the subsequent detection probe can be a mixture of probes containing different nucleotides at degenerate positions). Such an embodiment is less preferred because longer and more probes need to be manufactured.

[0054] The barcode position thus provides a recognition site (i.e., binding site, or hybridization site) for the detection probe, and conversely, the detection probe can be considered to contain a corresponding or homologous (i.e., complementary) recognition site for the barcode position. The complementary recognition (binding) sites for their corresponding detection probes in adjacent barcode positions partially overlap. Therefore, a subsequent detection probe for the next barcode position of the barcode sequence is able to hybridize with at least a portion of the binding site of the previous detection probe, i.e., hybridize with the sequence in the overlapping portion of the barcode position that has hybridized with the previous detection probe. This allows a toehold exchange reaction to occur, wherein the subsequent detection probe hybridizes with the barcode sequence and is able to invade the hybrid between the previous detection probe and the barcode sequence. As a further explanation, the recognition site (complementary region) in the detection probe for the non-overlapping region of the barcode position (i.e., the region that does not overlap with the adjacent, e.g., previous, barcode position) can be considered to provide a toehold for the detection probe, through which the detection probe can bind to the nucleotide barcode sequence (or more specifically to the barcode position). This is particularly applicable to the case of a subsequent detection probe that can bind to the next barcode position at a non-overlapping region while the prior barcode position is occupied by the prior detection probe. Conversely, the non-overlapping (e.g., different) region of the subsequent barcode position provides a toehold (or more precisely, a "toehold-complement") for the detection probe to be hybridized. The method can thus be viewed as involving a toehold-mediated strand displacement reaction. As described above, the prior detection probe does not have to be completely displaced by the subsequent detection probe. A toehold-mediated strand displacement reaction that results in the displacement of a portion of the prior detection probe may be sufficient to dissociate the prior detection probe from the barcode sequence. Thus, the subsequent detection probe can undergo a toehold exchange reaction, which results in (or it can cause or trigger) the displacement of the prior probe. Therefore, in other words, in step (iv) of the method herein, the subsequent detection probe that hybridizes to the barcode subunit at the next position is able to hybridize with the sequence in the overlapping portion of the prior barcode position and mediate a toehold exchange reaction that triggers the displacement of the hybridized prior detection probe.

[0055] As described above, the method of the present invention can be regarded as a method for sequencing by hybridization, wherein the nucleotide sequence barcode is decoded by a SBH reaction. The nucleic acid molecule, more particularly the nucleotide sequence barcode, can thus be regarded as a sequencing substrate. The detection probe can be regarded as a sequencing probe in the SBH method.

[0056] The number of barcode positions in the nucleotide barcode sequence can vary depending on the diversity required for a given application. For example, the nucleotide barcode sequence can contain at least 2, 3, 4, 5, 6, 7, 8, 9, 10, or 20 or more barcode positions.

[0057] The size of the barcode subunit can be from a single base to a longer base sequence, also depending on the exact nature of the method (e.g., whether a spacer is used) and the required complexity or diversity. The size of the barcode subunit can therefore be, for example, 1-20 bases, such as 1-15, 1-12, 1-10, 1-9, 1-8, 1-7, 1-6, 1-5, 1-4 or 1-3 bases. It is to be understood that the barcode position must have a size that allows overlap with adjacent barcode positions and allows the detection probe to specifically bind to the barcode position. When the barcode position contains a spacer sequence flanking the barcode subunit, the size of the barcode subunit can therefore be at the lower end of the range, such as 1-6 or less bases. When the barcode position consists only of barcode subunits, the barcode subunits will generally be longer, such as any of 6, 7, 8, 9 or 10 to any of 12, 15, 18 or 20.

[0058] In one embodiment, the barcode positions can have a size of 8-60 bases, such as 8, 9, 10, 12, 15 or 18 bases to 16, 18, 20, 22, 25, 26, 28, 30, 40 or 50 bases.

[0059] Each barcode position in the nucleotide barcode sequence contains at least one barcode subunit. The barcode subunit at each barcode position can be selected from a group of barcode subunits. The group is only a list, group or set of barcode subunits used in the barcode sequence. There is no limit to the barcode subunits that can be included in the group or can constitute the group. The term "group" does not imply any restrictions on the number or type of barcode subunits. In this way, the group does not have to include a limited number of barcode subunits that are reused (or repeated) at different barcode positions or in different barcode sequences, although this may certainly be the case (for example, where the barcode subunit is a single base, or a small amount of bases, such as 1-3 bases). In other embodiments, each barcode subunit in the group can be unique. The size of the group of barcode subunits can be changed according to the desired diversity. For example, a panel of barcode subunits can contain at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 50, or 100 or more barcode subunits.

[0060] Each barcode subunit can be used multiple times in a single nucleotide barcode sequence, that is, a given barcode subunit can appear in multiple barcode positions in the same nucleotide barcode sequence. In addition, each barcode subunit can be used for multiple different nucleotide barcode sequences. Alternatively, each barcode subunit in a given nucleotide barcode sequence can be unique, or further, each barcode subunit in each nucleotide barcode sequence is unique.

[0061] The barcode subunits in the nucleotide barcode sequence define a signal code sequence. The signal code sequence contains a signal code corresponding to each barcode position in the nucleotide barcode sequence and is different from the signal code sequences of other nucleotide barcode sequences. The signal code sequence is thus defined by the nucleotide barcode sequence and can be used to identify the nucleotide barcode sequence.

[0062] As described above, a nucleotide barcode sequence can be designed as a sequence having barcode positions that are designed to produce a specific signal code sequence, or in other words, correspond to a specific signal code sequence that can be decoded using a detection probe designed to bind to the consecutive barcode positions. The nucleotide barcode sequence can thus correspond to or represent a predetermined signal code sequence.

[0063] A signal code is assigned to each barcode position of each nucleotide barcode sequence. The signal code may be, but need not be, unique to a particular barcode position (or a particular barcode subunit). An individual signal code is in turn displayed by a given reporter molecule. The reporter molecule generates the signal code. Thus, a corresponding signal code sequence is assigned to each nucleotide barcode sequence, which consists of the signal code observed from the reporter molecule on the detection probe that hybridizes to each constituent barcode position.

[0064] Available signal codes may be limited by available reporter molecules, which can be used to generate signals that can be distinguished from each other. Therefore, multiple barcode positions in the same nucleotide barcode sequence and / or multiple barcode positions in different nucleotide barcode sequences can be assigned to a given signal code. In addition, the same signal code can be assigned to different subunits or subunit combinations. Therefore, each reporter molecule can be observed at multiple barcode positions of a single nucleotide barcode sequence and / or at a given barcode position of multiple different nucleotide barcode sequences. Therefore, as explained above, it is impossible to determine the identity of a barcode subunit in a given barcode position only from the signal detected by the detection probe hybridized to the barcode position.

[0065] Alternatively, it is possible that each signal code in a given nucleotide barcode sequence is unique to that nucleotide barcode sequence.

[0066] The method for decoding a nucleotide barcode sequence in a nucleic acid molecule includes a first step of contacting the nucleic acid molecule with a first group of first detection probes to decode the first continuous barcode position. The detection probe is thus an oligonucleotide probe comprising a sequence or domain that can hybridize with the barcode position. Each detection probe comprises a sequence complementary to a combination of different barcode subunits or barcode subunits in a barcode subunit group (or in other words, each detection probe in the group comprises a sequence complementary to different barcode subunits that may be present at the first position in the group). The complementary sequence can be regarded as a binding site or binding domain (or recognition site) of the detection probe. Thus, a group of detection probes is designed to detect which possible subunit is present at the query position in a given barcode that may be present at a query position of a group of barcodes, or which possible subunit may be present, or to assign a specific signal code to the subunit present at the position, by which the barcode can be decoded. The detection probe may therefore also be referred to as a query probe, or a decoding probe.

[0067] In addition to the complementary sequence (i.e., the binding domain), each detection probe comprises a reporter molecule indicating a specific signal code, as outlined above. Thus, each detection probe is capable of hybridizing and detecting a different barcode subunit at the first continuous barcode position. Each detection probe can comprise a different reporter molecule. Alternatively, some detection probes can comprise the same reporter molecule.

[0068] The term "reporter molecule" as used herein refers to the detection probe region responsible for providing a detectable signal. The signal is generally provided by a detectable moiety. Therefore, the signal may include a signal detectable from a detectable moiety, and different detectable moieties may provide different signals, which may be distinguished, for example, by color. It is to be understood that the absence of a signal may also be detected, and the detected signal may be the absence of a signal. Therefore, in the detection probe group, the reporter molecule of one of the probes may be the absence of a reporter molecule, or the reporter molecule may lack a detectable moiety. Alternatively, in the method herein, each detection probe in the detection probe group may include a reporter molecule, or one of the detection probes may lack a reporter molecule, and other detection probes may each include a reporter molecule. Consistently, step (ii) may include the absence of a detection signal, or may be alternatively defined as detecting a signal from a reporter molecule, or the absence of a signal.

[0069] The detectable portion can be directly or indirectly linked to a reporter molecule (or to a binding domain of the detection probe). The reporter molecule can thus provide a signal directly or indirectly. Figure 3In the different detection probe designs showing the reporter molecules connected directly or indirectly are shown. In some embodiments, the detectable part is incorporated into the reporter region of the detection probe, or is conjugated to the binding domain. For example, the reporter molecule can be a mark directly or via a linker connected to the binding domain, and may include the absence of a mark, which is detected by the absence of a signal. Therefore, in a group of detection probes, one of the probes may lack a mark, and other probes in the group may carry a mark. And in one embodiment, the marks of the probes in the probe group can be distinguished from each other, as explained above, in other embodiments, different detection probes in the probe group can have the same mark (because the signal code sequence detected from the continuous detection probe can be used to decode the nucleotide barcode sequence). Figure 3 Describes the method for decoding discontinuous barcode sequences (such as Figure 3 The detection probe set shown in A). Figure 3 The probe set shown in B shows a detection probe directly provided with a colorimetric label that acts as a reporter molecule.

[0070] Alternatively, the reporter molecule can provide a signal indirectly, i.e., it may require the addition of additional components to generate a signal. For example, the reporter molecule of the detection probe can be a domain capable of binding to a species comprising a detectable portion. In a preferred embodiment, the reporter molecule comprises a binding site for a reporter probe comprising a detectable portion. More particularly, the reporter molecule can comprise a binding site in the form of a nucleotide sequence comprising a region or domain to which a complementary reporter probe can hybridize. The nucleotide sequence will not be complementary and will not be able to hybridize with the nucleotide barcode sequence (or more generally with a nucleic acid molecule containing the barcode sequence therein).

[0071] Thus, the reporter molecule can be in the form of an overhang region at one end of the detection probe, which is not complementary to the nucleotide barcode sequence, but contains a binding site that is complementary to the sequence of the reporter probe. In this case, the reporter probe contains a homologous sequence that is complementary to the sequence of the binding site in the reporter molecule, and a detectable portion. In this format, the detection probe can be regarded as taking the form (i.e., structure) of an L probe. In some embodiments, the detection probe can include reporter overhang regions at both ends, so that two reporter probes can bind to each detection probe to increase the intensity of the signal provided. In this format, the detection probe can be regarded as taking the form (i.e., structure) of a U probe. For example, in Figure 2 The L probe is depicted in Figure 3 Indirect detection probes with L-probe and U-probe configurations are further shown in C and 3D.

[0072] The step (i) of contacting the nucleic acid molecule with the first group of first detection probes may therefore further comprise contacting the nucleic acid molecule with a group of reporter probes, which are homologous to the detection probes. "Homologous" means that the reporter probes correspond to specific detection probes and are designed to bind specific detection probes. Each reporter probe in the group comprises a sequence complementary to the sequence of the reporter probe binding site in different detection probes. In one embodiment, each reporter probe may comprise a detectable portion. The detectable portion may be different. In another embodiment, when the absence of a signal is to be detected, the reporter probes in the group all comprise a detectable portion except one, and one of the reporter probes may lack a detectable portion. In another embodiment, the reporter probe group may lack a reporter probe corresponding to one of the detection probes. Thus, the detection probe "reported" by the absence of a signal may lack a binding site for a reporter probe. An embodiment comprising the absence of a detection signal is less preferred. The first group of first detection probes and the reporter probe group may be added simultaneously or sequentially. In one embodiment, the first set of first detection probes can be contacted with the reporter probe set before the detection probes are contacted with the nucleic acid molecule comprising the nucleotide barcode sequence (ie, the reporter probes can be pre-hybridized with the detection probes).

[0073] The use of indirect "labeling" via reporter probes means that the detectable portion can be reused to provide signals at multiple barcode positions. Although the detection probes differ from each other in the sequence that hybridizes to the nucleotide barcode sequence, the reporter probe binding site, i.e., the sequence of the reporter overhang region (and the complementary reporter probe) can be conserved at different barcode positions. This means that although a different detection probe is required for each barcode position, the direct reporter probe can be reused to decode multiple barcode positions. This significantly reduces the cost of the method.

[0074] According to the methods herein, the detectable moiety that can be used in the detection probe or in the reporter probe includes any part that can provide a signal that can be detected, such as a fluorescent molecule (e.g., a fluorescent protein or an organic fluorophore), a colorimetric part (e.g., a colored molecule or nanoparticle), a particle (e.g., a gold or silver particle), a quantum dot, a radioisotope, a chemiluminescent molecule, etc. The detectable moiety can be considered as a label, and any detectable label can be used. In particular, any part that can be detected by spectrophotometry or optical methods can be used. The detectable moiety can be distinguished by color, but any other parameter, such as size, can also be used.

[0075] In a preferred embodiment, the reporter molecule or the reporter probe comprises a fluorescent molecule, such as a fluorophore. Fluorescent molecules that can be used to label nucleotides are well known in the art. Exemplary fluorophores include ATTO425, Cy3, Cy5, Cy7, and AF488, although any suitable fluorophore can be used. Fluorophores have been identified with excitation and emission spectra of ultraviolet to near infrared wavelengths. Thus, the fluorophore can have excitation and / or emission wavelengths within the ultraviolet, visible, or infrared spectrum. The fluorophore can be a peptide, a small organic compound, a synthetic oligomer, or a synthetic polymer. In some embodiments, the fluorophore is a small organic compound.

[0076] Alternatively, as described above, the reporter or reporter probe may comprise a non-detectable moiety. In this case, the signal reported is the absence of any detectable moiety, which can be distinguished from any number of different positive detectable moieties.

[0077] When the reporter or reporter probe comprises a fluorophore, the signal code for each barcode position can be the color of the fluorophore of the reporter / reporter probe of the detection probe hybridized to the barcode position. Thus, each nucleotide barcode sequence has a corresponding signal code sequence that can comprise a specific color sequence that is different from the color sequence of the signal code sequence that constitutes each other nucleotide barcode sequence.

[0078] When the nucleic acid molecule comprising the nucleotide barcode sequence is contacted with the first set of detection probes, a detection probe having a sequence complementary to the barcode subunit at the first continuous barcode position can hybridize with the nucleic acid molecule at the first continuous barcode position. The signal can then be detected by the reporter molecule of the first detection probe, which has hybridized with the nucleotide barcode sequence at the first continuous barcode position. It is to be understood that the step of detecting the signal from the reporter molecule includes detecting the signal from the reporter probe, if a reporter probe is used. The signal can be detected by any method known in the art suitable for detecting the relevant detectable portion. In some embodiments, the signal can be detected by imaging a sample of the target nucleic acid molecule. In some embodiments, the steps (ii) and (v) of detecting the signal from the reporter molecule of the hybridized detection probe can include imaging the sample multiple times. For example, if the detectable portion is a fluorophore, a fluorescent microscope can be used to detect the signal to determine the identity of the fluorophore, or the absence of the fluorophore. It is obvious that other imaging techniques known in the art suitable for identifying signals from suitable detectable portions can be used in the method of the present invention to detect signals from the reporter molecule of the hybridized detection probe.

[0079] The step (ii) and / or step (v) of detecting the signal from the reporter molecule of the detection probe may further include the step of removing the unhybridized detection probe before detecting the signal. Removing the unhybridized probe can increase the intensity of the detected signal, or the signal-to-noise ratio. The removal step can be performed by washing the nucleic acid molecule with an appropriate washing buffer. The step of washing the solid substrate can be repeated multiple times, for example 2, 3, 4, 5 times or more, which is necessary to obtain a clear signal from the reporter molecule.

[0080] However, such removal steps are optional and may not be necessary, or may not always be desirable or appropriate. For example, rather than detecting the signal as an endpoint measurement, the signal is measured over time, for example as a series of measurements at spaced time points. Such time-resolved measurements are described in WO 2017 / 222453, which is incorporated herein by reference. In such procedures, images are taken when all detection probes are present (excess or unhybridized detection probes are not removed).

[0081] The step of detecting the signal from the reporter molecule of the first detection probe allows the signal code of the first consecutive barcode position of the nucleotide barcode sequence to be identified. The steps of hybridizing the detection probe to the barcode position, detecting the signal from the detection probe, and thereby identifying the signal code of the barcode position are then effectively repeated to identify the signal code of the subsequent barcode position. It is desirable to remove the previous hybridization detection probe from the nucleotide barcode sequence before attempting to detect the signal from the subsequent detection probe. According to the method of the present invention, this is achieved at least in part by a chain displacement reaction, which is initiated or mediated by the subsequent detection probe, which is used to destroy the hybridization of the previous detection probe (i.e., destroy the hybrid between the previous detection probe and the nucleotide barcode sequence).

[0082] After the first cycle, the method herein includes a step of contacting the nucleotide barcode sequence with the next group of subsequent detection probes to decode the next continuous barcode position. Again, each subsequent detection probe of the group contains a sequence complementary to a different barcode subunit in the group of barcode subunits (or more particularly to a different barcode subunit in the group that may be present at the next position). Therefore, each subsequent detection probe is able to hybridize and detect different barcode subunits or different combinations of barcode subunits at the next continuous barcode position. The subsequent detection probe that hybridizes with the nucleotide barcode sequence at the next continuous barcode position is also able to hybridize with the sequence within the overlapping portion of the previous barcode position. By hybridizing with the target barcode subunit at the next continuous position, the subsequent detection probe obtains a foothold and is able to invade the hybrid between the previous detection probe and the nucleotide barcode sequence. The invasion destroys the hybrid between the previous detection probe and the nucleotide barcode sequence in the overlapping portion of the previous barcode position, and can thus cause the displacement of the hybridized previous probe.

[0083] Once the chain invasion of the subsequent detection probe has destroyed the hybrid between the prior detection probe and the nucleotide barcode sequence in the overlapping portion of the previous barcode position, the prior detection probe hybridizes with the nucleotide barcode sequence only at the non-overlapping region of the previous barcode position. This partial destruction of the hybrid may be sufficient to cause the prior detection probe to dissociate from the nucleotide barcode sequence. In many cases, the remaining interaction between the prior detection probe and the nucleotide barcode sequence is not sufficient to maintain a stable hybrid. Once the subsequent detection probe has hybridized with the overlapping portion of the previous barcode position, the melting temperature of the hybrid between the prior detection probe and the nucleotide barcode sequence may be relatively low, whereby the prior detection probe will dissociate relatively quickly.

[0084] However, in some cases, the prior detection probe may remain hybridized to the nucleotide barcode sequence via interactions in the non-overlapping region of the previous barcode position. This may occur at longer barcode positions where there may be a greater number of interactions between the partially displaced detection probe and the nucleotide barcode sequence. In this case, it may be helpful or desirable to use additional displacer probes to remove the prior detection probe.

[0085] The displacement probes can be designed to have sequences complementary to the detection probes so that they can hybridize with the detection probes to mediate the necessary displacement reactions. The detection probes can therefore be designed so that two separate displacement reactions can be triggered to remove them from the nucleotide barcode sequence, one from either end of the hybrid between the detection probe and the nucleotide barcode sequence. First, the subsequent detection probe can invade the hybrid by hybridizing with the nucleotide barcode sequence at the overlapping region between the previous barcode position and the subsequent barcode position to be read. In addition, the additional displacement probe can invade the hybrid at the opposite end by hybridizing with the hybridized detection probe. In order to provide a foothold for the displacement probe to bind, the detection probe can include an overhang region (so-called "displacer foothold overhang") that does not hybridize with the nucleotide barcode sequence. If there is an overhang to provide a binding site for the reporter probe, such a displacement foothold overhang for the displacement probe will be separated from the "reporter overhang". In other words, the detection probe can be designed to have a U probe configuration when hybridized with the nucleotide barcode sequence. Thus, in one embodiment, the detection probe can hybridize to a barcode position with two single-stranded overhangs, one for the reporter probe and the other for the displacer probe. The detection probe according to this design is shown in Figure 3D. Therefore, in some embodiments of the present invention, step (iv) further includes contacting the nucleotide barcode sequence with a displacement probe set to replace the previous detection probe set. The displacement probes are designed to be homologous to the detection probe set they are to replace. In the displacement probe set, each displacement probe may include a first domain and a second domain, wherein the first domain includes (or is) a displacement sub-toehold binding region complementary to the toehold sequence in the displacement sub-toehold protrusion of the previous detection probe, and the second domain includes a sequence complementary to the sequence in the barcode position binding site (recognition site) of the detection probe designed to replace it. Thus, once bound to the displacement sub-toehold, the displacement sub-probe can invade the hybrid between the detection probe and the nucleotide barcode sequence. A group of displacement sub-probes will thus each contain a different second domain complementary to at least a portion of the barcode position binding site of different detection probes. In this regard, it may be desirable that the displacement sub-probe is complementary to a sequence in the barcode position binding site that is not complementary to the barcode subunit. Thus, such embodiments using displacer probes are particularly contemplated for use in the methods discussed above, wherein the nucleotide barcode positions are discontinuous and the barcode positions comprise barcode subunits flanked by spacer regions. More particularly, the second domain of the displacer probe can be complementary to (and can hybridize with) a portion of the barcode position binding site of the detection probe, a portion of the barcode position binding site of the detection probe hybridizing to the first spacer region of the barcode position. The first domain (displacer toehold binding region) can be the same or different in different displacer probes in the group. By inference, the displacer toehold overhang region of a detection probe group (or indeed all detection probe groups) can be common to all detection probes, or each detection probe can have a unique displacer toehold overhang region.

[0086] Once a signal has been detected from the reporter molecule of the detection probe hybridized to the nucleotide barcode sequence, the nucleotide barcode sequence can be contacted with a displacement probe set, each of which contains a sequence complementary to the sequence of a different detection probe (second domain). This can be done before, during or after contact with the next set of subsequent detection probes. Preferably, the nucleotide barcode sequence is contacted with the displacement probe set before or during contact with the next set of subsequent detection probes. A displacement probe having a sequence complementary to the detection probe sequence that has been hybridized to the nucleotide barcode sequence can invade the hybrid between the nucleotide barcode sequence and the detection probe and hybridize with the detection probe, displacing the nucleotide barcode sequence and thereby assisting in the removal of the detection probe.

[0087] The method may further include the step of washing the nucleotide barcode sequence with an appropriate wash buffer after detecting a signal from a set of detection probes. This washing step may be performed in addition to the previously described step of washing the nucleotide barcode sequence once the detection probes have been added in order to remove any unhybridized detection probes or previous detection probes that have been partially displaced but not yet completely dissociated from the nucleotide barcode sequence, prior to detecting a signal from a subsequent detection probe that has hybridized to the nucleotide barcode sequence. Washing the nucleotide barcode sequence in this manner means that the concentration of the previous detection probe is maintained at a low level, thereby minimizing the likelihood that the previous detection probe will hybridize again with the nucleotide barcode sequence or, once dissociated, be replaced by another copy of the same detection probe.

[0088] By varying the number of barcode positions in each nucleotide barcode sequence and / or the number of barcode subunits in the group, the method of the present invention can be adapted to accommodate different numbers of nucleotide barcode sequences. If more barcode positions and / or barcode subunits are used in each nucleotide barcode sequence, the total number of possible unique nucleotide barcode sequences will be higher, and the number of nucleic acid molecules that can be distinguished will be higher. Therefore, by varying the number of barcode positions or the number of barcode subunits, the method can be adapted to systems with different levels of diversity. In cases where the number of nucleic acid molecules to be distinguished is close to or equal to the number of possible nucleotide barcode sequences that have been generated, it may be necessary to identify the signal code for each barcode position of each nucleotide barcode sequence to decode the nucleotide barcode sequence. Conversely, as described above, in cases where a large number of barcode positions and / or barcode subunits are used but relatively few nucleotide barcode sequences are to be distinguished, it may not be necessary to identify the signal code for each barcode position to identify a given nucleotide barcode sequence. Therefore, the steps of the present method can be repeated until a signal code sufficient to decode the nucleotide barcode sequence has been identified. Figure 4 A schematic reaction scheme is shown in , which shows the process of decoding barcode sequences using cycles of hybridization, imaging, and displacement of detection probes.

[0089] As further noted above, the first continuous barcode position, i.e., the barcode position that is read first, can be any barcode position in the nucleotide barcode sequence. The nucleotide barcode sequence can thus be read in either direction, i.e., from 5' to 3' or from 3' to 5'. The nucleotide barcode sequence can also be read in two directions sequentially or simultaneously. The nucleotide barcode sequence can be read starting at any position. The first continuous barcode position does not have to be one of the two terminal barcode positions, i.e., the barcode position closest to the 5' end of the nucleotide barcode sequence or the barcode position closest to the 3' end of the nucleotide barcode sequence. Non-terminal barcode positions can be referred to as internal barcode positions. If the first barcode position is not one of the two terminal barcode positions, it may be necessary to repeat the method of the present invention from more than one starting point or in more than one direction to identify the signal code for each barcode position in the nucleotide barcode sequence.

[0090] As described above, in one embodiment, the method can be used to decode discontinuous nucleotide barcode sequences, and in particular wherein each barcode position comprises a first spacer sequence, a barcode subunit, and a second spacer sequence (i.e. wherein each barcode position comprises a barcode subunit flanked by a first and a second spacer region, respectively). The design of such a barcode sequence and a detection probe for decoding it is shown in Figure 3 In addition, Figure 4 Steps in the operation of such a method are shown. The second spacer sequence of each barcode position at least partially overlaps with the first spacer sequence of the adjacent barcode position in the sequence. In a preferred embodiment, the second spacer sequence of each barcode position completely overlaps with the first spacer sequence of the adjacent barcode position, so that the second spacer sequence of one barcode position forms the first spacer sequence of the adjacent barcode position. Therefore, the terminal barcode position has an overlapping region comprising the spacer sequence in this embodiment, and a non-overlapping region comprising a barcode subunit and a spacer sequence. The non-terminal (or internal) barcode position comprises two overlapping regions (each of which comprises a spacer sequence) and a non-overlapping region comprising a barcode subunit.

[0091] In this embodiment, the spacer sequence between each barcode subunit in a given nucleotide barcode sequence is different. In other words, in a nucleotide barcode sequence, for a given barcode position, the spacer sequence is specific or particular. However, the spacer sequence is common to all nucleotide barcode sequences (i.e., the spacer is common between different nucleotide sequences). In other words, all nucleotide barcode sequences have the same spacer sequence in each corresponding barcode position. Thus, in the nucleotide barcode sequence in such an embodiment, each barcode position has a combination of a first and a second spacer sequence, which is unique to the position and different from the combination of other positions. The barcode position can be defined and distinguished by its spacer sequence. In different nucleotide barcode sequences, the spacer sequence at each position is the same. Therefore, different nucleotide barcode sequences vary only in the barcode subunit sequence. This means that the flanking sequence in the detection probe complementary to the spacer sequence in the barcode position is conserved. The detection probe in the group has a specific flanking region, which is common to each probe in the group (for a specific barcode position). The flanking regions of the probes in one set are different from those in the other sets. Hybridization of the flanking sequences of the detection probes to the corresponding spacer sequences in the nucleotide barcode sequence guides the order in which the nucleotide barcode sequence is read and ensures that each detection probe hybridizes at the correct barcode position.

[0092] In such embodiments, it can be seen that the binding sites (complementary regions) in the detection probes of the second spacer sequence (particularly in the subsequent detection probes) provide a foothold for the binding of the subsequent detection probes, while the prior barcode position is occupied by the prior detection probe.

[0093] The length of the spacer sequence can vary. In some embodiments, the length of the spacer sequence can be about 2 to about 100 nucleotides, including a length of about 2 to about 50 nucleotides, such as a length of about 2 to about 40 nucleotides, such as a length of about 2 to about 30 nucleotides, a length of about 2 to about 20 nucleotides, a length of about 4 to about 15 nucleotides, a length of about 4 to about 10 nucleotides, a length of about 4 to about 8 nucleotides, etc. In some embodiments, the length of the spacer sequence can be 6 nucleotides. The spacer sequences at different positions in a given nucleotide barcode sequence can all be the same length, or they can be different in length at each position.

[0094] The barcode subunit at each barcode position is selected from a small group of barcode subunits. As described above, the size of the small group of barcode subunits can vary depending on the desired diversity. For example, the small group of barcode subunits can contain at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40 or 50 or more barcode subunits.

[0095] The length of the barcode subunit sequence can also vary. In some embodiments, the length of the barcode subunit sequence can be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more nucleotides. When the length of the barcode subunit sequence is 2 nucleotides, the first and second nucleotides in each barcode subunit sequence can be the same or different. The barcode subunit sequence can be composed of only four conventional nucleotides, i.e., a nucleotide containing one of the four bases present in DNA; adenine, guanine, cytosine and thymine (A, T, C and G). Alternatively, as known in the art, the barcode subunit sequence can contain unconventional nucleotides, such as uracil, or non-naturally occurring nucleotides.

[0096] The length of the barcode subunit determines the number of different possible subunits that can be generated and therefore provides an upper limit on the size of the panel. In a preferred embodiment, the barcode subunit sequence is 3 nucleotides in length and thus there are 64 different possible barcode subunit sequences.

[0097] The barcode subunit sequences that make up the group are all different from each other, and therefore each barcode subunit must contain at least 1 mismatch relative to each other barcode subunit. In some embodiments, each barcode subunit may contain 2, 3, 4, 5 or more mismatches relative to each other barcode subunit. In a more preferred embodiment, the barcode subunit is three nucleotides in length, and each barcode subunit has at least 2 bases that are mismatched relative to each other sequence. In other words, no barcode subunit in the group can be distinguished from another barcode subunit by only a single base substitution. In this case, when the barcode subunit sequence is 3 nucleotides in length and each barcode subunit contains at least 2 mismatches relative to each other barcode subunit, there are 16 different possible barcode sequences. A list of all possible ternary combinations (4 possible groups) is provided in the table below.

[0098] Table 1: All possible groups of triplets with a minimum of 2 base mismatches. There are 16 such triplets per group (column) that have 2 mismatches relative to the other triplets.

[0099]

[0100] This design of barcode subunit sequences with at least 2 mismatches makes it easier to distinguish different barcode sequences and thus reduces off-site binding of the detection probe. In turn, this allows the method to have a reduced overall error rate and improved specificity relative to methods in which different barcode subunit sequences differ by only a single nucleotide. However, single base barcode subunits are not excluded.

[0101] As described earlier, each barcode subunit can be used multiple times in a single nucleotide barcode sequence, that is, a given barcode subunit can appear at multiple barcode positions in the same nucleotide barcode sequence. In addition, each barcode subunit can be used for multiple different nucleotide barcode sequences.

[0102] In this embodiment, a nucleic acid molecule comprising the nucleotide barcode sequence is contacted with a first group of first detection probes to decode the first continuous barcode position. Each first detection probe comprises a first flanking sequence complementary to at least a portion of the first spacer sequence of the first barcode position, a sequence complementary to the barcode subunit, and a second flanking sequence complementary to at least a portion of the second spacer sequence of the first barcode position. Each first detection probe comprises a sequence complementary to a different barcode subunit in the group, so that each detection probe can hybridize and detect a different barcode subunit at the first barcode position. In this embodiment, the detection probe group will generally contain at least as many members as the group of barcode subunits, so that there is a complementary detection probe for each barcode subunit. In some embodiments, the first flanking sequence and / or the second flanking sequence may be complementary to the entire sequence of the corresponding spacer sequence, that is, the first flanking sequence may be complementary to the entire sequence of the first spacer sequence, and / or the second flanking sequence may be complementary to the entire sequence of the second spacer sequence.

[0103] Alternatively, the flanking sequences can be shorter than the corresponding spacer sequences, i.e., the first flanking sequence can be shorter than the first spacer sequence and / or the second flanking sequence can be shorter than the second spacer sequence. Detection probes having flanking sequences shorter than the corresponding spacer sequences have improved discrimination and reduced off-site binding rates because the sequence complementary to the barcode subunit constitutes a greater proportion of the total length of the detection probe, and thus binding to a barcode position comprising a mismatched barcode subunit is less favorable.

[0104] When the nucleic acid molecule comprising the nucleotide barcode sequence contacts the first group of detection probes, a detection probe having a sequence complementary to the barcode subunit at the first continuous barcode position can hybridize with the nucleic acid molecule at the first continuous barcode position. The signal can then be detected by the reporter molecule of the first detection probe, which has hybridized with the nucleotide barcode sequence at the first continuous barcode position. The detection probes can each contain different reporter molecules so that each barcode subunit directly corresponds to a single reporter molecule. As described above, the reporter molecule may cause the report to lack a signal (i.e., the reporter molecule may not exist or may lack a detectable portion). Alternatively, a plurality of detection probes may contain the same reporter molecule. In this case, multiple hybridization cycles of the detection probe may be required to decode each barcode position.

[0105] In a representative example, each barcode position can contain a barcode subunit selected from a small group of 16 barcode subunits. The barcode position can therefore be decoded using a single set of 16 detection probes, each detection probe containing a sequence complementary to a different barcode subunit and a different reporter molecule. The nucleotide barcode sequence will be contacted with the set of detection probes, washed to remove unhybridized detection probes, and a signal will then be detected by the hybridized detection probes. The identity of the signal will then provide the identity of the barcode subunit present at the barcode position.

[0106] Alternatively, the same barcode position can be decoded in 2 stages, using 16 detection probes, divided into 2 groups, 8 probes in each group. Each detection probe will contain a sequence complementary to a different barcode sequence, and a reporter selected from 8 possible reporters, so that each reporter is present in 2 probes. The detection probes are then divided into two groups, so that each group contains 8 detection probes with 8 different reporters. The nucleotide barcode sequence is contacted with the first group of 8 detection probes and washed to remove any unhybridized detection probes. Then an attempt is made to detect the signal from any potential hybridized detection probe. If a signal is detected, the identity of the barcode subunit at the barcode position can be determined based on the identity of the observed reporter. If no signal is detected, the nucleotide barcode sequence is contacted with a second group of 8 detection probes and washed to remove any unhybridized detection probes. The signal is then detected from the hybridized detection probe, and the identity of the barcode subunit present at the barcode position can be determined thereby. It is to be understood that in such embodiments, the first group of probes will not include reporters for which the signal is not present.

[0107] It is obvious that the principle of using smaller sets of detection probes to decode a barcode position in stages can be extended. For example, 16 detection probes divided into 4 sets of 4 probes can be used in 3 stages to decode a barcode position containing 1 of 16 possible barcode subunits.

[0108] This method of decoding barcode positions may be necessary when the number of barcode subunits in the group is greater than the number of different reporters available. However, it can also be used in situations where this is not the case because it can provide a greater signal-to-noise ratio. For example, when a barcode position containing 1 of 16 possible barcode subunits is decoded in stages using a detection probe containing only 4 different reporters, it is easier to detect the signal from the hybridization detection probe than when decoding using a detection probe containing 16 different reporters. Therefore, this method is particularly useful in high-density applications where a large number of nucleotide barcode sequences are present in a small sample.

[0109] An alternative method for decoding barcode positions where the number of barcode subunits in the panel is greater than the number of different reporter molecules available can involve the use of displacer probes to remove hybridized detection probes. Displacer probes are described above in the context of helping to remove hybridization probes that have been read. However, they can also be used in a different context to expand encoding capabilities. By detecting a first signal from a hybridized detection probe, using an appropriate displacer probe to potentially remove the hybridization detection probe, and attempting to detect subsequent signals from potentially hybridized detection probes, the number of barcode subunits that can be distinguished by a detection probe set with a limited number of different reporter molecules is increased.

[0110] In a representative example, using this method, a barcode position containing 1 of 16 possible barcode subunits can be decoded with a set of 16 detection probes containing only 8 different reporters and a set of 16 corresponding displacement subprobes. The detection probes are designed so that each detection probe contains a sequence complementary to a different barcode subunit and a reporter selected from 8 possible reporters, wherein each reporter is present in 2 detection probes. As outlined above, the displacement subprobes each contain a sequence complementary to a different detection probe. The nucleotide barcode sequence can be contacted with a set of 16 detection probes and washed to remove unhybridized detection probes. The first signal can then be detected by the detection probe that has hybridized to the nucleotide barcode sequence. Assuming that the detection probes are designed so that each reporter corresponds to only 2 barcode subunits, the identity of the signal can be used to determine that the barcode subunit present at a given barcode position must be 1 of the 2 specific barcode subunits. The nucleotide barcode sequence can then be contacted with a displacement subprobe complementary to 1 of the 2 barcode subunits and washed. Then, an attempt can be made to detect a subsequent signal from a reporter molecule of a potential hybridization detection probe. If the nucleotide barcode sequence is contacted with a displacement probe complementary to the hybridization detection probe, the displacement probe will invade the hybrid between the nucleotide barcode sequence and the hybridization detection probe, thereby mediating the displacement of the detection probe. In this case, no subsequent signal will be detected because there will be no detection probe hybridized to the nucleotide barcode sequence.

[0111] In contrast, if the nucleotide barcode sequence is contacted with a displacement probe that is not complementary to the hybridized detection probe, a strand displacement reaction will not occur, the detection probe will remain hybridized, and a subsequent signal identical to the first signal will be detected. Thus, after adding the relevant displacement probe, the identity of the barcode subunit at a given barcode position can be determined based on the presence or absence of the detected first signal combined with the subsequent signal, i.e., the disappearance or maintenance of the first signal combined with the signal.

[0112] In one embodiment, the detection probe and the barcode subunit panel are designed so that each barcode subunit in the panel corresponds to a single specific reporter. Each reporter then corresponds to one (and only one) barcode subunit in the panel, which means that the signal detected by the reporter can determine the identity of the barcode subunit at a given barcode position. It can be seen that in this embodiment, assuming that each reporter corresponds to only a single barcode subunit, the identity of a given barcode subunit can be determined based on the signal from a single detection probe.

[0113] Once the identity of the barcode subunit at a given barcode position has been determined, the nucleotide barcode sequence is then contacted with the next set of subsequent detection probes to decode the next consecutive barcode position. Again, each subsequent detection probe comprises a first flanking sequence complementary to at least a portion of the first spacer sequence of the next consecutive barcode position, a sequence complementary to the barcode subunit, and a second flanking sequence complementary to at least a portion of the second spacer sequence of the next consecutive barcode position. Each subsequent detection probe is therefore capable of hybridizing and detecting a different barcode subunit. The subsequent detection probe that hybridizes to the barcode subunit at the next consecutive barcode position hybridizes to the sequence in the overlapping region of the prior barcode position, and thereby invades the hybrid between the hybridized prior detection probe and the nucleotide barcode sequence to displace the hybridized prior probe.

[0114] The hybridization of the subsequent detection probe thus constitutes a chain displacement reaction, in which the hybridized prior detection probe is displaced from the nucleotide barcode sequence. In the chain displacement reaction, the sequence complementary to the subsequent barcode subunit and the second flanking sequence of the subsequent detection probe act as a foothold, hybridizing with the nucleotide barcode sequence and allowing the first flanking sequence to invade the adjacent hybrid formed between the prior detection probe and the nucleotide barcode sequence at the overlapping area between the previous barcode position and the read barcode position. The chain invasion of the first flanking sequence of this subsequent detection probe destroys the hybridization between the second flanking sequence of the prior detection probe and the nucleotide barcode sequence, and thus promotes the displacement of the prior detection probe. As described above, this partial invasion of the hybrid between the nucleotide barcode sequence and the prior detection probe may be sufficient to cause the prior detection probe to dissociate from the nucleotide barcode sequence. If this is not the case, and despite the replacement of the second flanking sequence, the prior detection probe remains hybridized with the nucleotide barcode sequence, an additional displacement subprobe can be used. As described above, each displacement subprobe contains a sequence complementary to a different barcode subunit. When the displacer probe is used to displace a hybridized detection probe, after detecting the signal from the reporter molecule of the probe, the nucleotide barcode sequence can be contacted with a specific displacer probe comprising a sequence complementary to the hybridized detection probe, or with a whole group of displacer probes each comprising a sequence complementary to a different barcode subunit.

[0115] The detection probes used in this embodiment can be designed so as to promote the strand displacement reaction. In particular, it may be desirable to design the detection probes so that the first flanking sequence of each subsequent detection probe has a higher affinity for the spacer sequence in the overlapping region between the prior barcode position and the read barcode position than the second flanking sequence of the prior detection probe. In a preferred embodiment, the affinity of the first flanking sequence of each detection probe to the first spacer sequence of the corresponding barcode position is higher than the affinity of the second flanking sequence of the detection probe to the second spacer sequence of the corresponding barcode position. This increased affinity will drive the first flanking sequence of the subsequent detection probe to invade the hybrid between the nucleotide barcode sequence and the prior detection probe, and thus facilitate the subsequent detection probe to invade the hybrid between the nucleotide barcode sequence and the prior detection probe. If the prior detection probe is more easily displaced, the decoding method can be completed faster.

[0116] Therefore, the detection probe used in the present invention can have an asymmetric design. In one embodiment, the first flanking sequence of each detection probe can be longer than the second flanking sequence. In one embodiment, the first flanking sequence of each detection probe is the same length as the spacer sequence, so that the first flanking sequence of each detection probe can hybridize with the entire length of the complementary first flanking sequence of the relevant barcode subunit. In particular, the first flanking sequence of the subsequent detection probe can hybridize with the entire length of the second spacer sequence at the previous barcode position. The second flanking sequence of each detection probe can be at least 1, 2, 3, 4, 5 or more nucleotides shorter than the first flanking sequence. In addition, the second flanking sequence of each detection probe can be at least 1, 2, 3, 4, 5 or more nucleotides shorter than the spacer sequence. In a representative embodiment, the length of the first flanking sequence of each detection probe is 6 nucleotides. In a representative embodiment, the length of the second flanking sequence of each detection probe is 4 nucleotides.

[0117] Alternatively, the chain displacement reaction can be promoted by changing the length of the continuous detection probe. By improving the length of the continuous detection probe (and the continuous corresponding spacer sequence), it is conducive to the sequential displacement of each probe by the next probe. In one embodiment, the detection probe for the continuous barcode position can increase 2 nucleotides in length. For example, for a system with 5 groups of detection probes, groups 1 to 5 can respectively include probes with a length of 14, 16, 18, 20 and 22 nucleotides.

[0118] In addition, as mentioned above and Figure 5 As shown in , subsequent detection probes can have an extended binding site that also comprises a complementary region capable of hybridizing to a non-overlapping region of a prior barcode position.

[0119] As further shown above, also provided herein are methods of decoding contiguous nucleotide barcode sequences in which the barcode subunits overlap. Figure 2 Such a method is depicted in , which shows such a barcode sequence design and sequential detection probes for decoding it. Figure 6 Also shown is the operation of 2 cycles of such a method. In such a method, each barcode position comprises a barcode subunit pair comprising a first barcode subunit and a second barcode subunit, wherein the second barcode subunit from each barcode position at least partially overlaps with the first barcode subunit of an adjacent barcode position in the sequence. The order of the barcode subunit pairs in each nucleotide barcode sequence defines a signal code sequence that comprises a signal code corresponding to each barcode subunit pair and that is different from the signal code sequences of other nucleotide barcode sequences and identifies a given nucleotide barcode sequence.

[0120] In this embodiment, there are no spacer sequences between the barcode subunits. In a preferred embodiment, the second barcode subunit from each barcode position completely overlaps with the first barcode subunit of the adjacent barcode position, such that the second barcode subunit of one barcode position forms the first barcode subunit of the adjacent barcode position. In this case, the terminal barcode position contains an overlapping region containing one barcode subunit, and a non-overlapping region containing the second barcode subunit, while the non-terminal (or internal) barcode position has two overlapping regions, each containing one barcode subunit, and no non-overlapping region. Effectively, adjacent barcode positions have one different barcode subunit and one common barcode subunit.

[0121] Each barcode subunit can be used multiple times in a single nucleotide barcode sequence, or can be used in multiple different nucleotide barcode sequences. In one embodiment, each nucleotide barcode sequence is completely unique, i.e., each barcode subunit is used only once and only appears in a single nucleotide barcode sequence.

[0122] The order of the barcode subunit pairs in each nucleotide barcode sequence defines a signal code sequence, which contains a signal code corresponding to each barcode subunit pair. The signal code sequence of a given nucleotide barcode sequence is different from the signal code sequences of other nucleotide barcode sequences, and the nucleotide barcode sequence can be identified thereby. Therefore, in the practice of such methods, the nucleotide barcode sequence can be designed to produce a unique signal code sequence, which can be used to distinguish the nucleotide sequence barcode.

[0123] A signal code can be assigned to each barcode subunit pair in each nucleotide barcode sequence, and each individual signal code can in turn be indicated by a given reporter molecule. Thus, each nucleotide barcode sequence can be assigned a corresponding signal code sequence consisting of the signal codes observed from the reporter molecule on the detection probe hybridized to each constituent barcode position.

[0124] A given signal code can be assigned to multiple barcode subunit pairs in the same nucleotide barcode sequence, and / or to multiple barcode subunit pairs in different nucleotide barcode sequences. Each reporter molecule can therefore be observed at multiple barcode positions in a single nucleotide barcode sequence and / or at a given barcode position in multiple different nucleotide barcode sequences. As described above, it is therefore not possible to determine the identity of the barcode subunit pair in a given barcode position solely from the signal detected by the detection probe hybridized to the barcode position, but rather requires reading the signal code sequence to decode the nucleotide barcode sequence.

[0125] In the method, a nucleic acid molecule comprising the nucleotide barcode sequence is contacted with a first set of first detection probes to decode the first continuous barcode position. Each detection probe comprises a sequence complementary to a different barcode subunit pair and a reporter molecule, so that each detection probe can hybridize and detect a different barcode subunit pair at the first barcode position. As described above, the detection probe may further comprise a displacement subtoehold overhang region.

[0126] Once a signal is detected from the reporter molecule of the first detection probe that has hybridized to the nucleotide barcode sequence at the first consecutive barcode position, and the signal code of the first barcode subunit pair has been identified, the nucleotide barcode sequence is contacted with the next set of subsequent detection probes to decode the next consecutive barcode position. The subsequent detection probe that hybridizes to the barcode subunit at the next consecutive barcode position is able to hybridize with the sequence in the overlapping region between the previous barcode position and the read barcode position. Therefore, when the subsequent detection probe hybridizes to the nucleotide barcode sequence, it invades the hybrid between the hybridized previous detection probe and the nucleotide barcode sequence, and thereby triggers a strand displacement reaction, which destroys the hybrid between the previous detection probe and the nucleotide barcode sequence, and thus replaces the previous detection probe.

[0127] It will be seen that the subsequent detection probe hybridizes to the barcode subunit at the next sequential position different from the previous position. It is also able to hybridize to the common barcode subunit in the previous barcode position (occupied by the previous detection probe). Once hybridized to a different barcode subunit, the subsequent detection probe can therefore hybridize to the common subunit to displace (or at least induce displacement) the previous detection probe. In other words, a toehold exchange occurs.

[0128] Thus, in such embodiments, it can be seen that the binding site (complementary region) of the detection probe (particularly in the subsequent detection probe) to the second subunit of the subunit pair (the first and second are defined relative to the direction in which the barcode sequence is decoded) provides a foothold for the binding of the subsequent detection probe, while the prior barcode position is occupied by the prior detection probe.

[0129] As described above, the steps of hybridizing the detection probe to the barcode position, detecting the signal from the detection probe, and thus identifying the signal code of the barcode position are then effectively repeated to identify the signal code of the subsequent barcode position. Once the signal has been detected by its reporter molecule, the previous hybridization detection probe is removed from the nucleotide barcode sequence via a strand displacement reaction. As described above, additional displacement probes can be used if necessary. The steps of the method are repeated until the signal code has been identified in terms of a sufficient number of barcode positions to decode the nucleotide barcode sequence.

[0130] The barcode subunit in such methods can be any length that allows specific hybridization of the detection probe. For example, it can be at least 8 bases long, more particularly at least 9 or 10 bases long. For example, it can be 8-20, 8-15, 8-12, 9-20, 9-18, 9-15 or 9-12 bases long. In one embodiment, it can be 10 bases long.

[0131] As described above, it can be seen that the decoding process of the method herein involves converting a nucleotide barcode sequence into a signal code sequence that identifies the barcode sequence. This can be particularly considered to be applicable to the above-mentioned method for decoding a continuous barcode sequence consisting of a pair of overlapping barcode subunits in one barcode subunit. In the presence of multiple barcode subunits, and in particular multiple unique barcode subunits, the available reporter molecules must be "reused" to read the barcode. Thus, a unique signal code sequence is required to distinguish the nucleotide barcode sequence. This can be viewed from the opposite point of view, that is, in order to distinguish a variety of different target nucleic acid molecules in a sample, a unique signal code sequence (e.g., a unique color code sequence, such as composed of yellow, green, blue and red) is assigned to each target nucleic acid. The nucleotide barcode sequence can be designed to correspond to each unique signal code sequence, and the target nucleic acid molecules in the sample can each have a different nucleotide barcode sequence. The barcode sequence corresponds to or represents a signal code sequence. The barcode subunits of the sequence can be unique (but not necessarily so). Different barcode subunit pairs can be "read" by different detection probes carrying the same reporter molecules to produce the same signal code. Therefore, individual subunit pairs cannot be distinguished by the signal codes they produce, but the sequence of the barcode subunits in the sequence barcode can be designed to produce a specific, unique signal code sequence. Therefore, the barcode sequence can be queried using a detection probe that matches the barcode sequence. In other words, each position can be queried in turn using a detection probe that is homologous or unique to the subunit pair at each position and the signal code sequence can be obtained. In this sense, it can be seen that the method involves querying to see if a specific signal code sequence can be detected by a nucleotide barcode sequence.

[0132] exist Figure 7 In FIG. 1 , a decoding scheme involving barcode pairs is shown. This general decoding scheme allows the use of a barcode containing 6 barcode positions to decode a target sequence. Each barcode position contains two different subunits, each selected from a set of 4 potential subunits. Figure 7 As shown in , each subunit is assigned a label of a different color. This scheme relies on each detection L-probe having 2 adjacent sequences. The first of these sequences is complementary to the first barcode subunit in the relevant barcode position, which is common to the previous detection L-probe, and the second sequence is complementary to the second barcode subunit in this position, which is common to the next detection L-probe. The detection probes each further contain a detectable label in the form of a fluorophore, which corresponds to the second barcode subunit to which they are complementary.

[0133] The decoding method includes first contacting the barcode sequence with a set of probes comprising sequences complementary to the subunits constituting the first barcode position. In this scheme, there are 4 possible detection L-probes for the first position, each comprising a sequence complementary to a pair of barcode subunits assigned the same color label (i.e., AF, BG, CH, DI). The first detection probe comprising a sequence complementary to the barcode sequence hybridizes at the first barcode position and can then be detected. The signal detected by the label of the detection probe that has hybridized to the first barcode position can be used to determine the identity of the two barcode subunits in the first barcode position.

[0134] This information also provides the identity of the first barcode subunit in the second barcode position (because the positions overlap). The signal detected from the detection probe hybridized to the barcode sequence at the first barcode position can therefore be used to determine which detection probes are necessary to investigate the identity of the second barcode position. For example, if a yellow signal from Cy3 is observed after the first contacting step, this indicates that the first barcode position contains subunit AF. In this example, the next step of the protocol will involve contacting the nucleotide barcode sequence with detection probes, each of which contains a first sequence (binding / recognition site) complementary to the sequence of subunit F and a second sequence (binding / recognition site) complementary to one of subunits J, K, L or M. The second sequence of the subsequent detection probe complementary to the barcode sequence (i.e., the binding site complementary to the second subunit of the second barcode position present) can directly hybridize to the barcode and act as a foothold, mediating the displacement of the prior detection probe by the first sequence of the subsequent detection probe complementary to the sequence of subunit F (i.e., by the binding site in the second detection probe complementary to the first subunit of the second barcode position). A second detection probe can then be detected and the identity of the second barcode position can be determined. The process is then repeated to investigate subsequent barcode positions. Thus, only four detection probes need to be brought into contact with the barcode sequence in each decoding cycle.

[0135] In summary, this scheme requires 4 possible detection L-probes for the first barcode position, and 16 possible detection L-probes for each subsequent position (one for each combination of two sequence portions selected from the possible 4 in each subunit). Thus, for the universal decoding scheme, the total number of detection L-probes required is 4+16*5=84 detection L-probes.

[0136] If a hybridization length of 20bp is used, with an overlap of 10bp, the entire binding zone of the decoding scheme will be 70bp long. The 70bp binding zone is quite long, but has a feasible length for use as a barcode, for example in hybridization probes such as padlock probes. If necessary, the length can be reduced by shortening the hybridization length of the detection L-probe from, for example, 20bp to 14bp. The 14bp design will only require a total hybridization length of 49bp.

[0137] As can be seen from the above, in such methods, the first detection probe can recognize a pair of subunits that decode the same color. The second detection probe also recognizes two subunits, which act as a pair to allow the probe to fully hybridize. The binding sites for the two corresponding barcode subunits in the detection probe can be considered to correspond to these subunits (in fact, the detection probe has corresponding "subunits"). The difference between the first and second detection probes is that in the second detection probe, the signal code is encoded only in one subunit, while the other subunit is a displacement subunit, which effectively replaces the first detection probe by encoding the signal of the first detection probe. Therefore, in such methods involving barcodes with barcode positions containing subunit pairs (one of the subunits overlaps with an adjacent position), only the second barcode subunit can be regarded as providing or encoding the signal code. Similarly, it can be seen that only the corresponding second subunit of the detection probe provides a decoded signal code. In such schemes, the second subunit of the detection probe that serves as a foothold for the subsequent detection probe provides a signal code that contributes to the signal code sequence (i.e., it is specific to the signal code of the barcode position targeted by the detection probe). The subunit providing a toehold of the detection probe is a sequence that can bind to the barcode sequence without resistance and is specific to the signal code of the barcode position; the first common (overlapping) subunit of the subsequent detection probe is specific to the toehold of the previous detection probe. In fact, the second subunit of the barcode position and the corresponding second subunit providing a toehold of the detection probe are the "coding" part that generates or provides the signal code.

[0138] use Figure 7 The major advantage of the design of the decoding protocol outlined in is that there is no stripping of tissue sections between each decoding cycle. Since stripping of tissue sections is usually performed using 100% formamide, this design is safer to operate and there is less chance of damaging the tissue sections and their morphology. High levels of formamide have also been shown to damage epitopes used in immunostaining. For example, reducing the use of high levels of formamide in an in situ sequencing procedure allows it to be fully compatible with subsequent immunostaining to identify relevant morphology and / or protein levels, thereby validating in situ knockout / removal.

[0139] The method for querying paired subunits as described above represents a method in which a linear barcode sequence of multiple consecutive barcode positions is queried continuously to generate a signal code sequence. However, an alternative method is also provided and disclosed herein, in which a linear barcode sequence of multiple consecutive barcode positions is not required, and each position corresponds to and generates a signal code. The principle of the method is that a signal code can be generated by sequential exchange of a series of detection probes, each detection probe generating a signal. The detection probes are exchanged by a sequential toehold-mediated displacement reaction. However, it is not necessary for each detection probe to have a unique binding site. The signal code sequence can alternatively be provided by querying the same two barcode positions sequentially, one after another, and repeatedly using detection probes with different reporters, and the different reporters generate distinguishable signals (including the absence of signals, or alternatively referred to as blank or "dark" reporters). In such methods, the detection probes are not moved sequentially in one direction, but are moved sequentially in the forward and reverse directions. The number of binding sites for the detection probes is reduced to two, and thus the nucleotide barcode sequence that distinguishes each nucleic acid molecule is simplified. It can be defined as a detection tag, or a detection site comprising two binding sites. Each individual nucleic acid molecule in the sample will have a unique barcode sequence (or alternatively referred to as a "detection tag"). It contains only two barcode positions (or detection probe binding sites), and only two different barcode subunits. Each barcode position contains a different barcode subunit and a common subunit shared with another position (in fact, the entire barcode is composed of only two subunits, one of which is unique to a barcode position, and the other subunit is shared). Thus, the two barcode positions overlap in the barcode subunits as described above, which allows subsequent detection probes to bind to one of the two barcode positions to replace the previous detection probe hybridized with the other barcode position. The barcode sequence can be queried by a group of detection probes unique to the barcode. The detection probe group is homologous to the barcode sequence and is designed to be used in a sequence to produce a specific signal code sequence. The method thus relies on the use of a specific detection probe group in the sequence. Detection probes in a group are provided so as to be used in a specific order to produce a predetermined signal code sequence. In this way, the barcode can be used to generate a signal code sequence using a detection probe. The detection probe can be designed and have a reporter as described above for other methods (eg, directly have a reporter, or indirectly have a reporter by having a reporter overhang that binds the reporter probe, etc.).

[0140] Thus, in another aspect, the present disclosure and invention may be viewed as providing a method of decoding a nucleotide barcode sequence in a nucleic acid molecule, wherein the nucleotide barcode sequence corresponds to a specific signal code sequence, the signal code sequence being derivable by interrogating the nucleotide barcode sequence with consecutive detection probes that each produce a signal, and the signals together constitute the signal code sequence, and wherein the nucleotide barcode sequence comprises at least two adjacent barcode positions, each barcode position comprising a barcode subunit pair comprising a first barcode subunit and a second barcode subunit, wherein the second barcode subunit from each barcode position at least partially overlaps with the first barcode subunit of an adjacent barcode position in the sequence, the method comprising:

[0141] (i) contacting the nucleic acid molecule with a first detection probe to generate a signal code for a first position of the signal code sequence, and hybridizing the detection probe to the nucleic acid molecule, wherein the detection probe comprises a recognition sequence complementary to the barcode subunit pair present at the first barcode position and a reporter molecule;

[0142] (ii) detecting a signal from the reporter molecule of the first detection probe, wherein the first detection probe has hybridized to the nucleotide barcode sequence at the first barcode position;

[0143] (iii) identifying the signal code of the first position of the signal code sequence from the signal detected in (ii);

[0144] (iv) contacting the nucleotide barcode sequence with a subsequent detection probe so as to generate a signal code for the next position of the signal code sequence, and allowing the detection probe to hybridize with the nucleic acid molecule, wherein the subsequent detection probe comprises a recognition sequence complementary to a barcode subunit pair present at an adjacent barcode position, and a reporter molecule, and wherein the subsequent detection probe hybridized to the barcode subunit at the adjacent position hybridizes to a sequence in the overlapping portion of the preceding barcode position (more particularly, hybridizes to a sequence in the second barcode subunit at the preceding barcode position), and thereby initiates a strand displacement reaction that displaces the hybridized preceding detection probe;

[0145] (v) detecting a signal from a reporter molecule of the subsequent detection probe, wherein the subsequent detection probe hybridizes to the nucleotide barcode sequence at the adjacent barcode position;

[0146] (vi) identifying the signal code of the next position of the signal code sequence from the signal detected in (v);

[0147] (vii) repeating steps (iv)-(vi) to identify a signal code at a subsequent signal code sequence position until a signal code sufficient to decode the nucleotide barcode sequence has been identified, wherein the detection probe for identifying the subsequent signal code in the signal code sequence has (a) a recognition sequence complementary to the barcode subunit pair present at the subsequent consecutive barcode position in a nucleotide barcode sequence comprising a plurality of consecutive adjacent barcode positions, or (b) a recognition sequence complementary to the barcode subunit pair present at the first and second barcode positions of a nucleotide barcode sequence comprising two adjacent barcode positions, and a reporter molecule;

[0148] The first barcode position may be any barcode position in the nucleotide barcode sequence.

[0149] "Specificity" means that the signal code sequence is specific to the nucleotide barcode sequence, ie, it is distinguished from other nucleotide barcode sequences. The signal code sequence is different from the signal code sequences of other nucleotide barcode sequences and identifies a given nucleotide barcode sequence.

[0150] It can be seen that the method as defined above comprising step (vii)(a) corresponds to the method described above for decoding a continuous nucleotide barcode sequence comprising a plurality of continuous barcode positions, wherein each barcode position comprises a barcode subunit pair comprising a first barcode subunit and a second barcode subunit, and the barcode subunits between adjacent barcode positions in the sequence are overlapping. In such methods, a subsequent detection probe displaces a previous detection probe in one direction (forward or reverse), and a linear sequence of barcode positions can be read.

[0151] On the other hand, the method comprising step (vii)(b) represents an alternative method, as described above, which uses different detection probes to read the same two barcode positions back and forth in sequence, and the probes are displaced from each other in alternating forward and reverse directions to produce a signal code sequence. Figure 8 A schematic example of such an approach is outlined in A.

[0152] exist Figure 8A variation of this type of method is shown in B. In this embodiment, the detection probe can hybridize not only to the barcode position in the barcode sequence, but also to a universal region present in the nucleic acid molecule outside the barcode sequence. Thus, the nucleic acid molecule can include a universal region flanking the barcode sequence. The universal region is common to different nucleic acid molecules. The use of such a universal (or common) region can shorten the barcode sequence. The universal or common region and the barcode position can thus provide or constitute a binding site for the detection probe together. In a further variation, the use of such a common region facilitates a modification of the "back and forth" decoding method, in which additional displacement probes are used to assist in the displacement and removal of prior detection probes. This is further described below and exemplified in Example 4 (see also Figures 14 to 18 ). The common region can be used to provide a binding site or a portion thereof for a displacer probe. In particular, instead of using a displacer probe comprising a portion (domain) that is specific for or complementary to a barcode position, the displacer probe can be designed to have a domain that is complementary to the common region (as well as a domain that is complementary to the toehold sequence in the detection probe). In this way, there is no need to design a separate set of displacer probes for each barcode sequence.

[0153] The detection probes are used sequentially and provided together with a reporter molecule to generate a signal code specific for a particular barcode sequence.

[0154] The method can be performed in multiplex to decode different nucleotide barcode sequences. Thus, the method can be implemented for samples containing a variety of different nucleic acid molecules, each of which contains different nucleotide barcode sequences. The method can distinguish nucleotide barcode sequences from other nucleotide barcode sequences. In such methods, each barcode sequence will be decoded by its own detection probe series or sequence. In other words, each nucleotide barcode sequence will have a matching (or alternatively defined homology or dedicated) detection probe series (or group) in order to decode it. Probes will be used sequentially (e.g., in a group of series or sequences) for each nucleotide barcode sequence to gradually obtain a signal code sequence to generate a signal code sequence, and thus identify or decode the barcode sequence. Thus, each barcode sequence has a unique detection probe sequence, and this will generate (or encode) a unique signal code sequence, which identifies the nucleotide barcode sequence and therefore identifies the target nucleic acid molecule (which can ultimately correspond to a specific gene or other analyte target). When multiple nucleotide sequence barcodes are decoded together in a sample (e.g., in parallel for the sample), the sample containing the barcode (or more specifically, the nucleic acid molecule containing the barcode) is contacted with a set of detection probes for decoding the barcode position (i.e., the first or subsequent position), wherein each detection probe in the set is capable of hybridizing and detecting a specific barcode subunit pair that may be present at the barcode position. In one embodiment, each detection probe in the set is capable of hybridizing and detecting a different barcode subunit pair at the barcode position. Therefore, the detection probe set used in each cycle (i.e., in order to obtain a signal code for a signal code position) can include detection probes for decoding multiple different barcode sequences that may be present. Although the sequence of the detection probe is unique to a specific barcode sequence, individual members of the sequence can be found in the detection probe sequence used to decode different barcode sequences. Thus, the detection probe can be "shared" between detection probe sets (sequences) used to decode different nucleotide barcode sequences.

[0155] In a specific embodiment of this aspect, a method for decoding a nucleotide barcode sequence in a nucleic acid molecule is provided, wherein the nucleotide barcode sequence corresponds to a specific signal code sequence, the signal code sequence can be derived by interrogating the nucleotide barcode sequence with consecutive detection probes that each produce a signal, and the signals together constitute the signal code sequence, and wherein the nucleotide barcode sequence comprises first and second adjacent barcode positions, each barcode position comprising a barcode subunit pair comprising a first barcode subunit and a second barcode subunit, wherein the second barcode subunit from the first barcode position at least partially overlaps with the first barcode subunit of the second barcode position, the method comprising:

[0156] (i) contacting the nucleic acid molecule with a first detection probe to generate a signal code for a first position of the signal code sequence, and hybridizing the detection probe to the nucleic acid molecule, wherein the detection probe comprises a recognition sequence complementary to the barcode subunit pair present at the first barcode position and a reporter molecule;

[0157] (ii) detecting a signal from the reporter molecule of the first detection probe, wherein the first detection probe has hybridized to the nucleotide barcode sequence at the first barcode position;

[0158] (iii) identifying the signal code of the first position of the signal code sequence from the signal detected in (ii);

[0159] (iv) contacting the nucleotide barcode sequence with a subsequent detection probe so as to generate a signal code for the next position of the signal code sequence, and allowing the detection probe to hybridize with the nucleic acid molecule, wherein the detection probe comprises a recognition sequence complementary to the barcode subunit pair present at the second barcode position, and a reporter molecule, and wherein the subsequent detection probe hybridized to the barcode subunit at the adjacent position hybridizes to a sequence in the overlapping portion of the prior barcode position (more particularly hybridizes to a sequence in the second barcode subunit at the prior barcode position), and thereby initiates a strand displacement reaction that displaces the hybridized prior detection probe;

[0160] (v) detecting a signal from a reporter molecule of the subsequent detection probe, wherein the subsequent detection probe hybridizes to the nucleotide barcode sequence at the adjacent barcode position;

[0161] (vi) identifying the signal code of the next position of the signal code sequence from the signal detected in (v);

[0162] (vii) repeating steps (iv)-(vi) to identify a signal code at a subsequent signal code sequence position until a signal code sufficient to decode the nucleotide barcode sequence has been identified, wherein in the repeated steps, the detection probes used to identify the subsequent signal code in the signal code sequence respectively have recognition sequences complementary to the barcode subunit pairs present at the first and second barcode positions of the nucleotide barcode sequence, so that the detection probes sequentially hybridize with and displace the previous detection probes from the first and second barcode positions;

[0163] The first barcode position may be the 5' or 3' barcode position in the nucleotide barcode sequence.

[0164] The above method involves assigning a signal code sequence to a given nucleotide barcode sequence, thereby assigning a signal code sequence to a given nucleic acid molecule, and determining the signal code sequence to detect or identify the nucleotide barcode sequence, and thus detect or identify the nucleic acid molecule.

[0165] From another aspect, the above method can therefore be regarded as or alternatively defined as a method for detecting a nucleic acid molecule, wherein the method comprises:

[0166] (a) assigning a unique signal code sequence to the nucleic acid molecule, wherein the signal code sequence is specific for the molecule;

[0167] (b) providing the nucleic acid molecule with a nucleotide barcode sequence corresponding to the signal code sequence, wherein the signal code sequence can be derived by interrogating the nucleotide barcode sequence with consecutive detection probes that each produce a signal, and the signals together comprise the signal code sequence, and wherein the nucleotide barcode sequence comprises at least two adjacent barcode positions, each barcode position comprising a barcode subunit pair comprising a first barcode subunit and a second barcode subunit, wherein the second barcode subunit from each barcode position at least partially overlaps with the first barcode subunit of an adjacent barcode position in the sequence;

[0168] (c) performing steps (i) to (vii) as defined above to generate a signal code sequence to decode the nucleotide barcode sequence and detect the nucleic acid molecule.

[0169] The disclosure herein regarding any of the first set of methods presented above for decoding nucleotide barcode sequences and detection probes and how they are used, etc., can be similarly applied to the alternative methods discussed above.

[0170] These decoding and nucleic acid molecule detection methods involving detection probes that are displaced back and forth between adjacent barcode positions can be more generally applied to detecting nucleic acid molecules. In this case, the detection probes act by interrogating the target nucleotide sequence in the nucleic acid molecule. Therefore, in one aspect, the present invention provides a method for detecting a nucleic acid molecule, wherein the method comprises:

[0171] (a) assigning a unique signal code sequence to a nucleic acid molecule, wherein the signal code sequence is specific for the molecule, wherein the signal code sequence can be derived by querying a target nucleotide sequence in the nucleic acid molecule with a detection probe sequence, each detection probe generating a signal, and the signals together constitute the signal code sequence, and wherein the target nucleotide sequence comprises a first and a second domain, each domain comprising a first subunit and a second subunit, wherein in the target nucleotide sequence, the second subunit of the first domain at least partially overlaps with the first subunit of the second domain;

[0172] (b) contacting the nucleic acid molecule with a first detection probe to generate a signal code for the first position of the signal code sequence, and hybridizing the detection probe to the nucleic acid molecule, wherein the detection probe comprises a recognition sequence complementary to the first and second subunits of the first domain, and a reporter molecule;

[0173] (c) detecting a signal from a reporter molecule of a first detection probe that has hybridized to the nucleic acid molecule at the first domain;

[0174] (d) identifying the signal code of the first position of the signal code sequence from the signal detected in (c);

[0175] (e) contacting the nucleic acid molecule with a subsequent detection probe so as to generate a signal code for the next position of the signal code sequence, and allowing the detection probe to hybridize with the nucleic acid molecule, wherein the subsequent detection probe comprises a recognition sequence complementary to the first and second subunits of the second domain, and a reporter molecule, and wherein the subsequent detection probe hybridizes with a sequence in the second subunit of the prior domain, thereby initiating a strand displacement reaction that displaces the hybridized prior detection probe;

[0176] (f) detecting a signal from the reporter molecule of the subsequent detection probe, wherein the subsequent detection probe has hybridized to the nucleic acid molecule at the adjacent domain;

[0177] (g) identifying the signal code of the next position of the signal code sequence from the signal detected in (f);

[0178] (h) repeating steps (e)-(g) to identify the signal code at the position of the subsequent signal code sequence until a signal code sufficient to detect the nucleic acid molecule has been identified, wherein in the repeated steps, the detection probe used to identify the subsequent signal code in the signal code sequence has a recognition sequence complementary to the subunit present at the first and second domains of the target nucleotide sequence, respectively, so that the detection probe hybridizes with the previous detection probe from the first and second domains in sequence and replaces the previous detection probe;

[0179] The first domain may be the 5' or 3' domain in the target nucleotide sequence.

[0180] The method can be multiplexed to detect a variety of different nucleic acid molecules present in a sample, similar to the multiplexed detection method disclosed above for decoding or detecting nucleic acid molecules containing barcodes. Each target nucleic acid molecule to be detected can be detected by its own series or sequence of detection probes. In other words, each nucleic acid molecule will have a matching (or, alternatively defined homologous or dedicated) series (or group) of detection probes for detecting it.

[0181] The target nucleotide sequence queried by this method can be a target sequence within a DNA or RNA molecule, with the help of which the nucleic acid molecule being tested (i.e., being detected) can be distinguished from other nucleic acid molecules. In other words, it can be a target sequence specific to the molecule and identify the molecule. The target sequence can be provided artificially within a nucleic acid molecule, i.e., it can be added or incorporated into the molecule as a detectable sequence for detecting the molecule. In other words, it can be a tag sequence, or a nucleotide barcode sequence, such as those described in the barcode decoding method disclosed herein above. In some embodiments, the target sequence can be contained in a nucleic acid molecule used as a probe (or a part of a probe) for detecting a target analyte. For example, a nucleic acid molecule comprising a target nucleotide sequence can be connected to a binding partner with affinity for the target analyte to detect the analyte. In such embodiments, the nucleic acid molecule constitutes a detectable portion (e.g., a molecule containing a tag or a barcode), which allows the binding partner to bind to the target analyte to be detected by it. Such binding partners can, for example, be used to detect non-nucleic acid analytes, such as proteins. The binding partner can be any affinity binding partner, particularly including non-nucleic acid binding partners, such as proteins or protein molecules. An example of such a binding partner is an antibody. In such embodiments, detection of nucleic acid molecules via the target sequence indicates the presence and position of the antibody, and therefore indicates the presence and position of the analyte to which the antibody binds.

[0182] Alternatively, the target sequence can be a naturally occurring sequence in the molecule to be detected (i.e., it can be a native sequence). Thus, the specific sequence present in the target nucleic acid molecule or its complement can be selected as the target nucleotide sequence. Adjacent target sequences can be selected thus, which have overlapping regions, and are designated as the first and second domains according to the above method. Each domain has two (first and second) subunits. The overlapping region can be designated as a subunit of the first and second domains, and the non-overlapping region of the first and second domains represents another subunit of the corresponding domain. Therefore, the target nucleotide sequence can be a specific target sequence present in natural genomic DNA or naturally occurring RNA molecules, or present in cDNA or the amplified product produced therefrom. In a specific embodiment, the nucleic acid molecules can be detected in situ in a cell or tissue sample. The cell sample can be a cell culture medium.

[0183] In some embodiments, a given nucleic acid molecule may contain multiple target nucleotide sequences, each of which may be assigned the same signal code sequence and interrogated by a separate set of detection probes.

[0184] It is to be understood that any "back and forth" detection or decoding method disclosed herein may involve the use of a displacement subprobe to assist in the displacement of a prior detection probe. Thus, it may be performed using a detection probe in the form of a U probe. Such methods using 2-site detection probe displacement are referred to herein as "2-LSD". The use of displacement subprobes is described above.

[0185] As outlined above, such U-probes can be designed to hybridize to a given barcode position or domain in a target nucleotide sequence, with two single-stranded overhangs, one for the reporter probe and the other for the displacement probe. Thus, a given detection probe can be displaced from both sides simultaneously; on one side by a subsequent detection probe that hybridizes to the shared overlap region between the detection probe binding sites; and on the other side by a displacement probe that hybridizes to the displacement probe overhang. This double displacement reaction is extremely efficient and thus enables rapid switching of detection probes between sequencing cycles without the need for chemical stripping (or any damage to the sample associated therewith).

[0186] In some embodiments, the displacer probe overhang (i.e., displacer toehold overhang) used in the detection probe can be common to all detection probes capable of hybridizing to a given binding site. The use of such "back and forth" detection probes is particularly advantageous because such methods only involve the use of 2 detection probe binding sites, and from this it can be seen that there are only 2 displacer probe overhangs (one for each binding site) in all detection probes. Therefore, a single displacer probe can be used to simultaneously displace detection probes bound to the same barcode position of all RCPs in a given sample (as well as displacements mediated by subsequent detection probes). This further improves the efficiency of the method as a whole and reduces the cost of the method because fewer different probes are required.

[0187] To facilitate common displacement of sub-probe overhangs for detection probes, a common region can be provided adjacent to each of the two barcode positions in the "back and forth" barcode (see, e.g. Fig.14and Example 4). The common region, together with the barcode position (comprising the first and second barcode subunits), provides a binding site for the detection probe. The displacement subprobe is designed to bind to the common displacement subprobe overhang of the detection probe and to the common region adjacent to the barcode position. By being able to bind to the common region, the hybrid between the intrusion barcode sequence and the hybridized detection probe is facilitated. In this way, there is a universal or common foothold region in all detection probes that binds to the first barcode position, and there is a different universal common foothold region in all detection probes that binds to the second barcode position. Similarly, there is a universal common region that allows the binding of the displacement subprobe adjacent to the first barcode position, and a different universal or common region adjacent to the second barcode position. Thus, only two displacement subprobes need to be provided, one for use with each detection probe used to query the first barcode position, and the other for use with each detection probe used to query the second barcode position in any barcode sequence (i.e., for any target).

[0188] In all methods and embodiments herein, the detection probes may comprise naturally occurring nucleotides and may thus be in the form of DNA or RNA oligonucleotide probes. However, they may alternatively or additionally comprise artificial or synthetic nucleotides (i.e., nucleotide analogs), and the detection probes may thus comprise any nucleic acid, or may consist of any nucleic acid. Thus, the detection probes may be DNA, RNA, PNA, LNA, GNA and / or TNA.

[0189] The methods and embodiments of the present invention may further include contacting the nucleic acid molecule with an anchor probe. The term "anchor probe" as used herein refers to a probe comprising a sequence complementary to the anchor probe binding region, which is present in all target nucleic acid molecules, and a reporter molecule, such as a detectable label, so that it can be detected. Suitable reporter molecules associated with the detection probe are disclosed herein. Detection of the anchor probe via the reporter molecule confirms the presence of the target nucleic acid molecule.

[0190] The target nucleic acid molecule can be contacted with the anchor probe before, simultaneously or afterwards with the first group of detection probes. In some embodiments, the target nucleic acid molecule can be contacted with the anchor probe during multiple decoding cycles. In some embodiments, a plurality of different anchor probes comprising different sequences and / or different reporter molecules can be used to confirm the presence of a plurality of different target nucleic acid molecules. When using a large amount of target nucleic acid molecules, it is particularly useful to use a plurality of anchor probes because this can reduce optical crowding and can more clearly resolve the target nucleic acid molecule.

[0191] It is apparent that the methods of decoding nucleotide barcode sequences of the present invention and the nucleotide barcode sequence designs described herein can be applied to any situation in which it is desired to detect, quantify and / or locate a plurality (i.e., multiple) of target nucleic acid molecules. The method can be used for in situ applications to detect or assess gene expression, including, for example, in situ sequencing. In addition, the method can be applied in vitro to distinguish a group of target nucleic acid molecules, for example after an amplification reaction. The target nucleic acid can be a probe molecule, or can be or can be derived from a target nucleic acid molecule present in any sample under investigation. The nucleic acid molecule comprising the nucleotide barcode sequence can thus similarly comprise or consist of any nucleic acid, but typically they will comprise DNA or RNA. In some embodiments, the nucleic acid molecule can comprise cDNA. In other embodiments, it can comprise an amplicon of a target molecule (e.g., an analyte nucleic acid molecule) or a probe under test.

[0192] As described above, the barcode sequence can be provided directly within the nucleic acid molecule, for example, it can be directly attached to the nucleic acid molecule, for example, by a ligation reaction (for example, an adaptor containing the barcode sequence can be ligated to a set of test nucleic acid molecules), or it can be incorporated into an amplification product, for example by using a substrate containing the barcode sequence, or it or its complement can be simply provided as part of a nucleic acid molecule, for example where the molecule is a probe or some other synthetic molecule.

[0193] Alternatively, barcodes can be introduced or provided indirectly using probes that hybridize to the subject nucleic acid molecule. These probes typically contain a sequence complementary to a portion of their corresponding target nucleic acid molecule, and a separate non-target complementary sequence containing the barcode.

[0194] Thus, as an example, a hybridization probe can be designed to specifically hybridize with a test nucleic acid molecule. The test nucleic acid molecule can be, for example, an analyte nucleic acid molecule present in a sample, or a cDNA or its amplicon, or it can be an oligonucleotide molecule provided as a representative of the test analyte (e.g., a protein or other analyte in a sample can be detected by an antibody or other analyte-specific binding partner with an oligonucleotide, and a hybridization probe can be designed to hybridize with the oligonucleotide to detect the antibody, and thus detect the analyte; similarly, an oligonucleotide molecule can be generated as part of an analyte detection assay, such as an extension or connection reaction product can be generated as a result of a proximity assay). Similarly, a nucleic acid molecule is not a target of a probe containing the barcode sequence, but can include the barcode sequence together with a nucleic acid molecule. Thus, as described above, a nucleic acid molecule containing a barcode sequence can also be provided for a binding partner (e.g., an antibody) of an analyte. In other words, a conjugate comprising a binding partner (e.g., an antibody) for detecting an analyte and a nucleic acid molecule comprising a barcode sequence directly or indirectly connected to the binding partner can be provided.

[0195] Such hybridization probes may be padlock probes, and different padlock probes for different analytes or test nucleic acids may have different barcode sequences, for example in the backbone portion of the padlock between the target binding sites of the padlock.

[0196] Amplification of such padlock probes by rolling circle amplification (RCA) will produce concatemeric nucleic acid products (referred to as RCPs; rolling circle products) comprising multiple repeated complementary copies of the padlock sequence (and therefore the barcode sequence) in series. Such RCPs may represent nucleic acid molecules that may be used in the methods of the present invention. The RCPs will contain multiple repeated copies of the barcode sequence, to which the detection probes described herein may be directed. (Technically, the RCPs will contain complements of the barcode sequences contained in the padlock probes, but these may be considered to be barcodes that are the target of the methods of the present invention; the terms "barcode" or "barcode sequence" and the like are thus used herein to refer to the inclusion of complementary copies of a given barcode sequence. This may provide a barcode for the probe, which is copied as a homolog or complementary copy into the target molecule to be detected, and the like.)

[0197] In addition, each nucleic acid molecule can be targeted by a plurality of hybridization probes, and each hybridization probe provides different bar code sequences.Use a plurality of hybridization probes thus to provide several bar code sequences for identical nucleic acid molecule.Can decode this bar code sequence with independent detection probe group simultaneously or sequentially subsequently.This can be used for reducing the optical crowding in the dense sample with a large amount of different nucleic acid molecules or a large amount of copies of identical nucleic acid molecules.A plurality of hybridization probes can hybridize with the same site or a single site on nucleic acid molecule separately.

[0198] Rather than incorporating the barcode directly into the padlock probe, the multiple repeats of the padlock complementary sequence contained in the RCP can itself hybridize to the intermediate or sandwich probes, and these intermediate or sandwich probes can have the barcode nucleotide sequence. Thus, the padlock probe can have a tag sequence, the complement of which can hybridize to the intermediate or sandwich probe (i.e., the tag sequence can be identical or homologous to the sequence contained in the binding site of the intermediate / sandwich probe).

[0199] As described above, these intermediate or sandwich probes can be in the form of so-called "L probes" or U probes, which can contain one or two overhang regions containing a barcode sequence. In fact, sandwich / intermediate L probes or U probes containing barcodes are not necessarily limited to those used to detect RCPs, and thus sandwich / intermediate probes used in any nucleic acid-based detection assay or method can be used as test nucleic acid molecules in the methods of the present invention.

[0200] As described above, alternative methods for detecting target nucleic acid molecules are also disclosed herein. In one embodiment, the present invention provides a method for detecting a target nucleic acid molecule, wherein the target nucleic acid molecule is detected using a padlock probe specific for the target molecule, the padlock probe circularizes after hybridization with a target sequence in the target nucleic acid molecule, and has a nucleotide barcode sequence to identify the padlock probe, and wherein the circularized padlock probe is amplified by rolling circle amplification (RCA) to produce a rolling circle product (RCP), the RCP containing multiple complementary copies of the nucleotide barcode sequence, characterized in that the method comprises:

[0201] (a) assigning a unique signal code sequence to a target nucleic acid molecule, wherein the signal code sequence is specific for that molecule;

[0202] (b) providing a nucleotide barcode sequence to the padlock probe so that an RCP is formed comprising a plurality of complementary copies of the nucleotide barcode sequence each corresponding to the signal code sequence, wherein the signal code sequence can be derived by interrogating the complementary copies of the nucleotide barcode sequence with consecutive detection probes that each generate a signal, and the signals together constitute the signal code sequence;

[0203] (c) contacting the RCP with a first detection probe to generate a signal code for the first position of the signal code sequence, and hybridizing the detection probe to the RCP at a complementary copy of the nucleotide barcode sequence, wherein the detection probe comprises a recognition sequence complementary to the nucleotide barcode sequence and a reporter molecule;

[0204] (d) detecting a signal from the reporter molecule of the first detection probe, which has hybridized to the RCP;

[0205] (e) identifying the first signal code for the first position in the signal code sequence for RCP from the signal detected in (d);

[0206] (f) removing the first detection probe from the RCP;

[0207] (g) contacting the RCP with a subsequent detection probe to generate a signal code for the next position of the signal code sequence, and hybridizing the detection probe to the nucleic acid molecule at a complementary copy of the nucleotide barcode sequence, wherein the detection probe comprises a recognition sequence complementary to the nucleotide barcode sequence and a reporter molecule;

[0208] (h) detecting a signal from the reporter molecule of the subsequent detection probe, which has hybridized to the RCP;

[0209] (i) identifying, from the signal detected in (g), a signal code for a next position in a signal code sequence for an RCP;

[0210] (j) removing the subsequent detection probe from the RCP;

[0211] (k) repeating steps (g)-(j) to identify signal codes at subsequent signal code positions until signal codes sufficient to identify the nucleotide barcode sequence and thereby detect the nucleic acid molecule have been identified.

[0212] All disclosures provided above, such as those related to detection probes, reporter molecules, detection of signals and identification of signal codes, etc., can be applied to the method for detecting target nucleic acid molecules. In particular, the removal of the detection probe, i.e., steps (f) and (i) can be achieved by any suitable method disclosed herein or known in the art (Xiao and Guo, 2018, Front Cell Dev Biol, 6-42; Peng, 2017, Sequential Color Display for Highly Multiplexed in situ Single-Molecule Detection, Dissertation for Doctor of Philosophy, Stanford University; Duose et al., 2012, Nucleic Acids Research, 3289-3298). Such methods can include the use of formamide buffer or displacement sub-probes, or simply balance kinetics, wherein the unbound prior detection probe is washed away, and the subsequent detection probe is added in excess, and the prior binding probe can be replaced.

[0213] The method can be used to detect a plurality of different nucleic acid molecules present in a sample, wherein each different nucleic acid molecule is assigned a different signal code sequence and is detected using a specific padlock probe having a different nucleotide barcode sequence. In some embodiments, a different subsequent detection probe set is provided for each different nucleic acid molecule, and each different detection probe set produces a different signal code sequence.

[0214] In some embodiments, target nucleic acid molecules are detected in situ in a tissue sample.

[0215] In Example 3 and Figures 10 to 13 Further details on this method are provided in .

[0216] The present invention also relates to the following embodiments (corresponding to the claims of the original application):

[0217] 1. A method for detecting a nucleic acid molecule, wherein the method comprises:

[0218] (a) assigning a unique signal code sequence to a nucleic acid molecule, wherein the signal code sequence is specific for the molecule, wherein the signal code sequence can be derived by querying a target nucleotide sequence in the nucleic acid molecule with a detection probe sequence, each detection probe generating a signal, and the signals together constitute the signal code sequence, and wherein the target nucleotide sequence comprises a first and a second domain, each domain comprising a first subunit and a second subunit, wherein in the target nucleotide sequence, the second subunit of the first domain at least partially overlaps with the first subunit of the second domain;

[0219] (b) contacting the nucleic acid molecule with a first detection probe to generate a signal code for the first position of the signal code sequence, and hybridizing the detection probe to the nucleic acid molecule, wherein the detection probe comprises a recognition sequence complementary to the first and second subunits of the first domain, and a reporter molecule;

[0220] (c) detecting a signal from a reporter molecule of a first detection probe that has hybridized to the nucleic acid molecule at the first domain;

[0221] (d) identifying the signal code of the first position of the signal code sequence from the signal detected in (c);

[0222] (e) contacting the nucleic acid molecule with a subsequent detection probe so as to generate a signal code for the next position of the signal code sequence, and allowing the detection probe to hybridize with the nucleic acid molecule, wherein the subsequent detection probe comprises a recognition sequence complementary to the first and second subunits of the second domain, and a reporter molecule, and wherein the subsequent detection probe hybridizes with a sequence in the second subunit of the prior domain, thereby initiating a strand displacement reaction that displaces the hybridized prior detection probe;

[0223] (f) detecting a signal from the reporter molecule of the subsequent detection probe, wherein the subsequent detection probe has hybridized to the nucleic acid molecule at the adjacent domain;

[0224] (g) identifying the signal code of the next position of the signal code sequence from the signal detected in (f);

[0225] (h) repeating steps (e)-(g) to identify the signal code at the position of the subsequent signal code sequence until a signal code sufficient to detect the nucleic acid molecule has been identified, wherein in the repeated steps, the detection probe used to identify the subsequent signal code in the signal code sequence has a recognition sequence complementary to the subunits present at the first and second domains of the target nucleotide sequence, respectively, so that the detection probe continuously hybridizes with and replaces the previous detection probe from the first and second domains;

[0226] The first domain may be the 5' or 3' domain in the target nucleotide sequence.

[0227] 2. A method as described in embodiment 1, wherein the target nucleotide sequence is a specific target sequence present in the DNA or RNA molecule to be detected.

[0228] 3. A method as described in embodiment 2, wherein the target nucleotide sequence is a specific target sequence present in natural genomic DNA or naturally occurring RNA molecules, or in cDNA, or in an amplification product generated by any of the aforementioned nucleic acid molecules.

[0229] 4. A method as described in any one of embodiments 1 to 3, wherein the second subunit from each domain completely overlaps with the first subunit of the adjacent domain.

[0230] 5. A method as described in any one of embodiments 1 to 4, which is used to detect different nucleic acid molecules present in a sample, wherein each nucleic acid molecule contains a different target nucleotide sequence, and wherein a different first and subsequent detection probe series are provided for each different target nucleotide sequence, and each different detection probe series produces a different signal code sequence.

[0231] 6. A method as described in embodiment 5, wherein each target nucleotide sequence comprises: (i) a first common region adjacent to the first subunit of the first domain, wherein the recognition sequence of the first detection probe comprises a sequence complementary to the first common region; and (ii) a second common region adjacent to the second subunit of the second domain, wherein the recognition sequence of the subsequent detection probe comprises a sequence complementary to the second common region.

[0232] 7. The method according to any one of embodiments 1 to 6, wherein the first detection probe and the subsequent detection probe each comprise a displacer toehold overhang region.

[0233] 8. A method as described in embodiment 7, wherein all detection probes comprising a recognition sequence complementary to the first domain comprise a first displacement subtoehold overhang sequence, and all detection probes comprising a recognition sequence complementary to the second domain comprise a second displacement subtoehold overhang sequence.

[0234] 9. A method as described in embodiment 8, wherein step (e) further comprises contacting the nucleic acid molecule with a first displacement subprobe, which comprises a displacement subtoehold binding region complementary to the first displacement subtoehold protrusion and a sequence complementary to the first common region; or contacting the nucleic acid molecule with a second displacement subprobe, which comprises a displacement subtoehold binding region complementary to the second displacement subtoehold protrusion and a sequence complementary to the second common region.

[0235] 10. The method of any one of embodiments 1 to 9, wherein the target nucleotide sequence is a nucleotide barcode sequence provided within the nucleic acid molecule.

[0236] 11. The method of any one of embodiments 1 to 10, wherein the nucleic acid molecule is linked to an antibody.

[0237] 12. A method of decoding a nucleotide barcode sequence in a nucleic acid molecule, wherein the nucleotide barcode sequence corresponds to a specific signal code sequence, the signal code sequence can be derived by interrogating the nucleotide barcode sequence with consecutive detection probes that each produce a signal, and the signals together constitute the signal code sequence, and wherein the nucleotide barcode sequence comprises at least two adjacent barcode positions, each barcode position comprising a barcode subunit pair comprising a first barcode subunit and a second barcode subunit, wherein the second barcode subunit from each barcode position at least partially overlaps with the first barcode subunit of the adjacent barcode position in the sequence, the method comprising:

[0238] (i) contacting the nucleic acid molecule with a first detection probe to generate a signal code for a first position of the signal code sequence, and hybridizing the detection probe to the nucleic acid molecule, wherein the detection probe comprises a recognition sequence complementary to the barcode subunit pair present at the first barcode position and a reporter molecule;

[0239] (ii) detecting a signal from the reporter molecule of the first detection probe, wherein the first detection probe has hybridized to the nucleotide barcode sequence at the first barcode position;

[0240] (iii) identifying the signal code of the first position of the signal code sequence from the signal detected in (ii);

[0241] (iv) contacting the nucleotide barcode sequence with a subsequent detection probe so as to generate a signal code for the next position of the signal code sequence and allowing the detection probe to hybridize with the nucleic acid molecule, wherein the subsequent detection probe comprises a recognition sequence complementary to a barcode subunit pair present at an adjacent barcode position, and a reporter molecule, and wherein the subsequent detection probe hybridized to the barcode subunit at the adjacent position hybridizes to a sequence in the overlapping portion of the prior barcode position and thereby initiates a strand displacement reaction that displaces the hybridized prior detection probe;

[0242] (v) detecting a signal from a reporter molecule of the subsequent detection probe, wherein the subsequent detection probe hybridizes to the nucleotide barcode sequence at the adjacent barcode position;

[0243] (vi) identifying the signal code of the next position of the signal code sequence from the signal detected in (v);

[0244] (vii) repeating steps (iv)-(vi) to identify a signal code at a subsequent signal code sequence position until a signal code sufficient to decode the nucleotide barcode sequence has been identified, wherein a detection probe for identifying the subsequent signal code in the signal code sequence has (a) a recognition sequence complementary to a barcode subunit pair present at a subsequent consecutive barcode position in a nucleotide barcode sequence comprising a plurality of consecutive adjacent barcode positions, or (b) a recognition sequence complementary to a barcode subunit pair present at a first and a second barcode position in a nucleotide barcode sequence comprising two adjacent barcode positions, and a reporter molecule;

[0245] The first barcode position may be any barcode position in the nucleotide barcode sequence.

[0246] 13. The method of embodiment 12, wherein each nucleotide barcode sequence comprises a unique barcode subunit.

[0247] 14. The method of embodiment 12 or embodiment 13, wherein the nucleotide barcode sequence comprises first and second adjacent barcode positions, each barcode position comprising a barcode subunit pair comprising a first barcode subunit and a second barcode subunit, wherein the second barcode subunit from the first barcode position at least partially overlaps with the first barcode subunit of the second barcode position, the method comprising:

[0248] (i) contacting the nucleic acid molecule with a first detection probe to generate a signal code for a first position of the signal code sequence, and hybridizing the detection probe to the nucleic acid molecule, wherein the detection probe comprises a recognition sequence complementary to the barcode subunit pair present at the first barcode position and a reporter molecule;

[0249] (ii) detecting a signal from a reporter molecule of a first detection probe that has hybridized to the nucleotide barcode sequence at the first barcode position;

[0250] (iii) identifying the signal code of the first position of the signal code sequence from the signal detected in (ii);

[0251] (iv) contacting the nucleotide barcode sequence with a subsequent detection probe so as to generate a signal code for the next position of the signal code sequence, and allowing the detection probe to hybridize with the nucleic acid molecule, wherein the detection probe comprises a recognition sequence complementary to the barcode subunit pair present at the second barcode position, and a reporter molecule, and wherein the subsequent detection probe hybridized to the barcode subunit at an adjacent position hybridizes to a sequence in the second barcode subunit at the prior barcode position, thereby initiating a strand displacement reaction that displaces the hybridized prior detection probe;

[0252] (v) detecting a signal from a reporter molecule of the subsequent detection probe, wherein the subsequent detection probe hybridizes to the nucleotide barcode sequence at the adjacent barcode position;

[0253] (vi) identifying the signal code of the next position of the signal code sequence from the signal detected in (v);

[0254] (vii) repeating steps (iv)-(vi) to identify a signal code at a subsequent signal code sequence position until a signal code sufficient to decode the nucleotide barcode sequence has been identified, wherein in the repeated steps, the detection probe used to identify the subsequent signal code in the signal code sequence has a recognition sequence complementary to the barcode subunit pair present at the first and second barcode positions of the nucleotide barcode sequence, respectively, so that the detection probe sequentially hybridizes with and displaces the previous detection probes from the first and second barcode positions;

[0255] The first barcode position may be the 5' or 3' barcode position in the nucleotide barcode sequence.

[0256] 15. The method of embodiment 14, wherein the nucleic acid molecule further comprises a general region flanking the nucleotide barcode sequence, and wherein the detection probe hybridizes to the general region in addition to its corresponding barcode position.

[0257] 16. A method as described in any one of embodiments 12 to 15, used to decode different nucleotide barcode sequences in multiple different nucleic acid molecules present in a sample, wherein a different first and subsequent detection probe series are provided for each different nucleotide barcode sequence, and each different detection probe series produces a different signal code sequence.

[0258] 17. A method for detecting a nucleic acid molecule, wherein the method comprises:

[0259] (a) assigning a unique signal code sequence to the nucleic acid molecule, wherein the signal code sequence is specific for the molecule;

[0260] (b) providing the nucleic acid molecule with a nucleotide barcode sequence corresponding to the signal code sequence, wherein the signal code sequence can be derived by interrogating the nucleotide barcode sequence with consecutive detection probes that each produce a signal, and the signals together comprise the signal code sequence, and wherein the nucleotide barcode sequence comprises at least two adjacent barcode positions, each barcode position comprising a barcode subunit pair comprising a first barcode subunit and a second barcode subunit, wherein the second barcode subunit from each barcode position at least partially overlaps with the first barcode subunit of the adjacent barcode position in the sequence;

[0261] (c) performing steps (i) to (vii) as defined in any one of embodiments 12 to 23 to generate a signal code sequence to decode the nucleotide barcode sequence and detect the nucleic acid molecule.

[0262] 18. A method as described in any one of embodiments 12 to 17, wherein each nucleotide barcode sequence comprises: (i) a first common region adjacent to the first barcode subunit of the first barcode position, wherein the recognition sequence of the first detection probe comprises a sequence complementary to the first common region; and (ii) a second common region adjacent to the second barcode subunit of the second barcode position, wherein the recognition sequence of the subsequent detection probe comprises a sequence complementary to the second common region.

[0263] 19. The method of any one of embodiments 12 to 18, wherein the first detection probe and the subsequent detection probe each comprise a displacement subtoehold overhang region.

[0264] 20. The method of embodiment 19, wherein step (iv) further comprises contacting the nucleotide barcode sequence with a set of displacer probes, wherein each displacer probe comprises a displacer toehold binding region and a sequence complementary to a sequence of a different detection probe.

[0265] 21. The method of embodiment 19, wherein all detection probes comprising a recognition sequence complementary to the first barcode position comprise a first displacement subtoehold overhang sequence, and all detection probes comprising a recognition sequence complementary to a second barcode position comprise a second displacement subtoehold overhang sequence.

[0266] 22. A method as described in embodiment 21, wherein step (iv) further includes contacting the nucleotide barcode sequence with a first displacement subprobe, which comprises a displacement subtoehold binding region complementary to the first displacement subtoehold protrusion and a sequence complementary to the first common region; or contacting with a second displacement subprobe, which comprises a displacement subtoehold binding region complementary to the second displacement subtoehold protrusion and a sequence complementary to the second common region.

[0267] 23. A method of decoding a nucleotide barcode sequence in a nucleic acid molecule to distinguish the nucleotide barcode sequence from other nucleotide barcode sequences, wherein the nucleotide barcode sequence comprises a plurality of consecutive barcode positions, each barcode position partially but not completely overlapping an adjacent barcode position in the sequence, and each barcode position comprises at least one barcode subunit, and wherein each barcode subunit is selected from a panel of barcode subunits such that the order of the barcode subunits in each nucleotide barcode sequence defines a signal code sequence comprising a signal code corresponding to each barcode position and distinct from a signal code sequence of other nucleotide barcode sequences, and identifying a given nucleotide barcode sequence, the method comprising:

[0268] (i) contacting the nucleic acid molecule with a first set of first detection probes to decode a nucleotide barcode sequence at a first contiguous barcode position, and hybridizing the detection probes to the nucleic acid molecule, wherein each detection probe in the set comprises a sequence complementary to a different barcode subunit in the small group and a reporter molecule, such that each detection probe is capable of hybridizing to and detecting a different barcode subunit at the first barcode position;

[0269] (ii) detecting a signal from the reporter molecule of the first detection probe, wherein the first detection probe has hybridized to the nucleotide barcode sequence at the first contiguous barcode position;

[0270] (iii) a signal code identifying the location of the first barcode from the signal detected in (ii);

[0271] (iv) contacting the nucleotide barcode sequence with a next set of subsequent detection probes to decode the nucleotide barcode sequence at the next consecutive barcode position and hybridizing the detection probes to the nucleic acid molecule, wherein each detection probe comprises a sequence complementary to a different barcode subunit in the group and a reporter molecule, such that each detection probe is capable of hybridizing to and detecting a different barcode subunit at the barcode position, and wherein the subsequent detection probe that hybridizes to the barcode subunit at the next position hybridizes to a sequence in an overlapping portion of the prior barcode position and thereby initiates a strand displacement reaction that displaces the hybridized prior detection probe;

[0272] (v) detecting a signal from the reporter molecule of the subsequent detection probe that has hybridized to the nucleotide barcode sequence at the next consecutive barcode position;

[0273] (vi) identifying the signal code of the next barcode position from the signal detected in (v);

[0274] (vii) repeating steps (iv)-(vi) to identify signal codes for subsequent consecutive barcode positions until a signal code sufficient to decode the nucleotide barcode sequence has been identified,

[0275] The first contiguous barcode position may be any barcode position in the nucleotide barcode sequence.

[0276] 24. The method of embodiment 23, wherein the first detection probe and the subsequent detection probe each comprise a displacement subtoehold overhang region.

[0277] 25. The method of embodiment 24, wherein step (iv) further comprises contacting the nucleotide barcode sequence with a set of displacer probes, wherein each displacer probe comprises a displacer toehold binding region and a sequence complementary to a sequence of a different detection probe.

[0278] 26. The method of any one of embodiments 12 to 25, wherein the first contiguous barcode position is one of the terminal barcode positions of the nucleotide barcode sequence.

[0279] 27. A method as described in any one of embodiments 1 to 26, wherein the reporter molecule of each detection probe comprises a fluorophore.

[0280] 28. A method as described in embodiment 28, wherein the detection probe comprises an overhang region, which comprises a binding site capable of hybridizing to a reporter probe comprising a fluorophore.

[0281] 29. A method as described in embodiment 27 or embodiment 28, wherein the signal code for each domain or barcode position is the color of the fluorophore of the reporter molecule of the detection probe hybridized to the domain or barcode position.

[0282] 30. The method of any one of embodiments 23 to 29, wherein each barcode position comprises a first spacer sequence, a barcode subunit, and a second spacer sequence, wherein the second spacer sequence from each barcode position at least partially overlaps with the first spacer sequence of an adjacent barcode position in the sequence, and wherein each barcode subunit is selected from a small group of barcode subunits such that the order of the barcode subunits in each barcode sequence is different from other barcode sequences, and identifying a given barcode sequence, the method comprising:

[0283] (i) contacting the nucleic acid molecule with a first set of first detection probes to decode the nucleotide barcode sequence at a first contiguous barcode position, and allowing the detection probes to hybridize to the nucleic acid molecule, wherein each detection probe comprises a first flanking sequence complementary to at least a portion of the first spacer sequence at the first barcode position, a sequence complementary to a barcode subunit, a second flanking sequence complementary to at least a portion of the second spacer sequence at the first barcode position, and a reporter molecule, wherein each detection probe comprises a sequence complementary to a different barcode subunit in the small set, such that each detection probe is capable of hybridizing to and detecting a different barcode subunit at the first barcode position;

[0284] (ii) detecting a signal from the reporter molecule of the first detection probe, wherein the first detection probe has hybridized to the nucleotide barcode sequence at the first contiguous barcode position;

[0285] (iii) determining the identity of the first barcode subunit from the signal detected in (ii);

[0286] (iv) contacting the nucleotide barcode sequence with a next set of subsequent detection probes to decode the nucleotide barcode sequence at the next consecutive barcode position and hybridizing the detection probes to the nucleic acid molecule, wherein each detection probe comprises a first flanking sequence complementary to at least a portion of the first spacer sequence at the subsequent barcode position, a sequence complementary to a barcode subunit, a second flanking sequence complementary to at least a portion of the second spacer sequence at the subsequent barcode position, and a reporter molecule, wherein each detection probe comprises a sequence complementary to a different barcode subunit in the small group, such that each detection probe is capable of hybridizing to and detecting a different barcode subunit at the barcode position, and wherein the subsequent detection probe that hybridizes to the barcode subunit at the next position hybridizes to at least a portion of the second spacer sequence at the prior barcode position and thereby initiates a strand displacement reaction that displaces the hybridized prior detection probe;

[0287] (v) detecting a signal from the reporter molecule of the subsequent detection probe that has hybridized to the nucleotide barcode sequence at the next consecutive barcode position;

[0288] (vi) determining the identity of the next barcode subunit from the signal detected in (v);

[0289] (vii) repeating steps (iv)-(vi) to decode subsequent consecutive barcode positions until the identity of the position of the subunit barcode sequence sufficient to decode the nucleotide barcode sequence has been determined,

[0290] The first continuous barcode position can be any barcode position in the nucleic acid molecule.

[0291] 31. A method as described in embodiment 30, wherein each barcode subunit is 3 nucleotides in length.

[0292] 32. The method of embodiment 30 or embodiment 31, wherein each barcode subunit comprises at least 2 mismatches relative to each other barcode subunit.

[0293] 33. A method as described in any one of embodiments 30 to 32, wherein the length of the spacer sequence is 2 to 20 nucleotides.

[0294] 34. A method as described in any one of embodiments 30 to 33, wherein the spacer sequences are all of the same length.

[0295] 35. A method as described in any one of embodiments 30 to 34, wherein the second spacer sequence of each barcode position completely covers the first spacer sequence of the adjacent barcode position.

[0296] 36. A method as described in any one of embodiments 30 to 35, wherein the affinity of the first flanking sequence of each detection probe to the first spacer sequence of the corresponding barcode position is higher than the affinity of the second flanking sequence of the detection probe to the second spacer sequence of the corresponding barcode position.

[0297] 37. The method of any one of embodiments 30 to 36, wherein in each detection probe, the first flanking sequence is longer than the second flanking sequence.

[0298] 38. The method of any one of embodiments 23 to 29, wherein each barcode position comprises a barcode subunit pair comprising a first barcode subunit and a second barcode subunit, wherein the second barcode subunit from each barcode position at least partially overlaps with the first barcode subunit of an adjacent barcode position in the sequence, such that the order of the barcode subunit pairs in each nucleotide barcode sequence defines a signal code sequence comprising a signal code corresponding to each barcode subunit pair and distinct from a signal code sequence of other nucleotide barcode sequences, and identifying a given nucleotide barcode sequence, the method comprising:

[0299] (i) contacting the nucleic acid molecule with a first set of first detection probes to decode a nucleotide barcode sequence at a first contiguous barcode position, and hybridizing the detection probes to the nucleic acid molecule, wherein each detection probe comprises a sequence complementary to a different barcode subunit pair and a reporter molecule, such that each detection probe is capable of hybridizing to and detecting a different barcode subunit pair at the first barcode position;

[0300] (ii) detecting a signal from the reporter molecule of the first detection probe, wherein the first detection probe has hybridized to the nucleotide barcode sequence at the first contiguous barcode position;

[0301] (iii) identifying a signal code for a first barcode subunit pair from the signal detected in (ii);

[0302] (iv) contacting the nucleotide barcode sequence with a next set of subsequent detection probes to decode the nucleotide barcode sequence at the next consecutive barcode position and hybridize the detection probes to the nucleic acid molecule, wherein each detection probe comprises a sequence complementary to a different barcode subunit pair and a reporter molecule, such that each detection probe is capable of hybridizing to and detecting a different barcode subunit pair at the barcode position, and wherein the subsequent detection probe that hybridizes to the barcode subunit at the next position hybridizes to a sequence in an overlapping portion of the prior barcode position and thereby initiates a strand displacement reaction that displaces the hybridized prior detection probe;

[0303] (v) detecting a signal from the reporter molecule of the subsequent detection probe that has hybridized to the nucleotide barcode sequence at the next consecutive barcode position;

[0304] (vi) identifying the signal code of the next barcode subunit pair from the signal detected in (v);

[0305] (vii) repeating steps (iv)-(vi) to identify signal codes for barcode subunit pairs at subsequent consecutive barcode positions until a signal code sufficient to decode the nucleotide barcode sequence has been identified,

[0306] The first contiguous barcode position may be any barcode position in the nucleotide barcode sequence.

[0307] 39. The method of embodiment 38, wherein each nucleotide barcode sequence comprises a unique barcode subunit.

[0308] 40. The method of any one of embodiments 12 to 29, 38 or 39, wherein the second barcode subunit from each barcode position completely overlaps with the first barcode subunit of the adjacent barcode position.

[0309] 41. The method according to any one of embodiments 12 to 40, wherein the nucleic acid molecule containing the nucleotide barcode sequence is a probe molecule or an amplification product of a probe molecule.

[0310] 42. The method of any one of embodiments 12 to 41, wherein the nucleic acid molecule containing the nucleotide barcode sequence is a rolling circle amplification product of a circularized padlock probe.

[0311] 43. A method for detecting a target nucleic acid molecule, wherein the target molecule is detected using a padlock probe specific for the target nucleic acid molecule, the padlock probe being circularized when hybridized to a target sequence in the target nucleic acid molecule, and the padlock probe having a nucleotide barcode sequence to identify the padlock probe, wherein the circularized padlock probe is amplified by rolling circle amplification (RCA) to produce a rolling circle product (RCP), the RCP containing multiple complementary copies of the nucleotide barcode sequence, characterized in that the method comprises:

[0312] (a) assigning a unique signal code sequence to a target nucleic acid molecule, wherein the signal code sequence is specific for that molecule;

[0313] (b) providing a nucleotide barcode sequence to the padlock probe so that an RCP is formed comprising a plurality of complementary copies of the nucleotide barcode sequence each corresponding to the signal code sequence, wherein the signal code sequence can be derived by interrogating the complementary copies of the nucleotide barcode sequence with consecutive detection probes that each generate a signal, and the signals together constitute the signal code sequence;

[0314] (c) contacting the RCP with a first detection probe to generate a signal code for a first position of the signal code sequence, and hybridizing the detection probe to the RCP at a complementary copy of the nucleotide barcode sequence, wherein the detection probe comprises a recognition sequence complementary to the nucleotide barcode sequence and a reporter molecule;

[0315] (d) detecting a signal from the reporter molecule of the first detection probe, which has hybridized to the RCP;

[0316] (e) identifying the first signal code for the first position in the signal code sequence for RCP from the signal detected in (d);

[0317] (f) removing the first detection probe from the RCP;

[0318] (g) contacting the RCP with a subsequent detection probe to generate a signal code for the next position of the signal code sequence, and hybridizing the detection probe to the nucleic acid molecule at a complementary copy of the nucleotide barcode sequence, wherein the detection probe comprises a recognition sequence complementary to the nucleotide barcode sequence and a reporter molecule;

[0319] (h) detecting a signal from the reporter molecule of the subsequent detection probe, which has hybridized to the RCP;

[0320] (i) identifying, from the signal detected in (g), a signal code for a next position in a signal code sequence for an RCP;

[0321] (j) removing the subsequent detection probe from the RCP;

[0322] (k) repeating steps (g)-(j) to identify signal codes at subsequent signal code positions until signal codes sufficient to identify the nucleotide barcode sequence and thereby detect the nucleic acid molecule have been identified.

[0323] 44. A method as described in embodiment 43, wherein the reporter of each detection probe is a binding site for the reporter probe comprising a detectable label, wherein the binding site is contained in the overhang region of the detection probe that is not hybridized to the RCP, and wherein the signal is detected by the label.

[0324] 45. A method as described in embodiment 44, wherein the detectable label is a fluorophore and the signal code sequence is a unique fluorophore sequence.

[0325] 46. ​​A method as described in embodiment 44 or embodiment 45, wherein the detection probes for generating the signal code sequence of the target nucleic acid molecule are provided in the form of a set of detection probes, each detection probe comprising the same recognition sequence and reporter binding site, which may be the same or different, and which is specific to the reporter probe comprising a detectable label that produces a given signal code, and wherein the detection probes are used in a predetermined sequence order, and the predetermined sequence corresponds to the signal code sequence assigned to the target nucleic acid molecule.

[0326] 47. A method as described in any one of embodiments 43 to 46, used to detect multiple different nucleic acid molecules present in a sample, wherein each different nucleic acid molecule is assigned a different signal code sequence and detected using a specific padlock probe with a different nucleotide barcode sequence.

[0327] 48. The method of embodiment 47, wherein a different subsequent detection probe set is provided for each different nucleic acid molecule, each different detection probe set producing a different signal code sequence.

[0328] 49. The method according to any one of embodiments 1 to 48, wherein the target nucleic acid molecule is detected in situ in a cell sample.

[0329] 50. The method of embodiment 49, wherein the target nucleic acid molecule is detected in a cell culture medium or in a tissue sample. BRIEF DESCRIPTION OF THE DRAWINGS

[0330] The present invention will now be described in more detail in the following non-limiting examples. In addition, a set of drawings is provided, wherein

[0331] Figure 1 A schematic diagram of a discontinuous barcode sequence is shown in (A), wherein each barcode position comprises a barcode subunit flanked by a spacer sequence, and wherein one spacer of a barcode position overlaps with the spacer of an adjacent barcode position; and a schematic diagram of an alternative, continuous barcode design is shown in (B), wherein each barcode position comprises two barcode subunits, and one subunit of the pair overlaps with (i.e., is common to) the barcode subunit of the adjacent barcode position. The depicted barcode positions are numbered 1-5.

[0332] Figure 2 Shows the design Figure 1 (B) Detection probes hybridized to consecutive barcode positions of two different consecutive nucleotide barcode sequences in the format depicted in FIG. The subunits of the barcode positions are represented by letters A to G below the barcodes. Y, G, B, and R represent yellow, green, blue, and red, respectively, as colorimetric detectable labels of the detection probes.

[0333] Figure 3 Shows (A) Figure 1 Design of discontinuous barcode sequences in the format depicted in (A) showing barcode subunits (BC1-BC4) each flanked by a spacer sequence. (B) shows a direct detection probe directly having a colorimetric label; (C) shows an indirect detection probe in the form of an L probe having one overhang for binding to a reporter probe having a colorimetric label; and (D) shows an indirect detection probe in the form of a U probe having two overhangs, one of which is depicted as a reporter probe binding to a label. The probe in (D) has an asymmetric design in which the second flanking region is shorter than the first flanking region.

[0334] Figure 4 Shows the use of Figure 3 (B) The detection probe query depicted in Figure 3 Reaction scheme for discontinuous barcode sequences.

[0335] Figure 5 Shows Figure 1 (A) Alternative detector probe designs for discontinuous barcode sequences in the format of (A), where the subsequent detector probe has an extended first flanking sequence that extends into the barcode position and the first spacer sequence of the preceding barcode position.

[0336] Figure 6 In (A), a schematic diagram is shown for decoding Figure 1 Operation of the method for a continuous barcode sequence in the format shown in (B). The results of such a method performed in Example 2 are given in (B), showing a fluorescent microscopy image of the detection probe hybridized to the RCP target.

[0337] Figure 7 Schematic diagram of the decoding Figure 1 (B) Decoding scheme for continuous barcode sequences in the format shown.

[0338] Figure 8 Two alternative approaches are shown in (A) and (B) and involve sequentially reading back and forth the same two barcode positions using different detection probes that are displaced from each other in alternating forward and reverse directions to generate a signal code sequence.

[0339] Fig. 9 Fluorescence microscopy images obtained after hybridization of a set of detection probes to RCP under various conditions are shown. Each detection probe contains a different nucleotide at the position corresponding to the barcode subunit, as well as a different reporter molecule, as shown. %FA indicates formamide concentration.

[0340] Fig.10 Shown is the design of an L-shaped detection probe (L probe) suitable for detecting a target nucleic acid molecule, the probe comprising a sequence unique to the gene to be detected, a linker, and a sequence unique to a reporter probe. A complementary reporter probe comprising a detectable label can then bind to the L probe at the reporter probe binding region.

[0341] Fig.11 In (A) and (B) are shown the first two cycles of a reaction scheme designed to detect target nucleic acid molecules comprising genes 1 and 2. In each cycle, a pool of L-shaped detection probes (L probes) and reporter probes (directly and indirectly, respectively) are hybridized to the target nucleic acid molecules before the probes are imaged and removed.

[0342] Fig.12 Shows the Fig.11 The signal detected in 4 cycles of the reaction performed according to the scheme in . In cycle 1, the L probe having a sequence complementary to the Cy3 reporter probe hybridizes with the target nucleic acid molecule, and the Cy3 signal can be observed. These probes are then removed, and the L probe having a sequence complementary to the Cy5 reporter probe hybridizes in cycle 2. The Cy5 signal can then be observed. The process is repeated with Atto425 and FITC reporter probes in cycles 3 and 4, respectively.

[0343] Fig.13 Shows the Fig.11 The signal detected in 4 cycles of the reaction performed in the protocol. Fig.12 In this assay, an "anchor probe" containing a sequence complementary to a specific recognition site present in all RCPs and a Cy7 fluorophore was also used as a positive control. At each cycle, in addition to the detection probe, the anchor probe was hybridized to the RCP, imaged, and removed.

[0344] Fig.14 A schematic diagram of the barcode sequence design of the padlock probe for the 2-LSD method is shown. The various regions in the padlock are necessary to allow the 2-LSD mechanism and the detection probe to properly bind and displace each other. (1) and (5) represent 5 bp regions that are different from each other but common to all padlock probes (regardless of the target). (2) and (4) represent 5 bp regions that are unique to each binding site in the barcode sequence of the padlock. (3) represents a 10 bp region that is common to binding site 1 and binding site 2. This is necessary to facilitate displacement of one detection probe by another detection probe through strand displacement. Binding site 1 is a 20 bp sequence consisting of sequences (1), (2) and (3). Binding site 2 is a 20 bp sequence consisting of sequences (3), (4) and (5).

[0345] Fig.15 The 2-LSD detection probe design is shown. It outlines the main design features of the detection probes used in the 2-LSD method, including the toehold region. Left: the detection probe that will bind to binding site 1, right: the detection probe that will bind to binding site 2. (1) represents the displacer toehold overhang, to which the displacer probe binds and triggers displacement. (2) represents the reporter probe binding site, to which the reporter probe binds to allow detection of the detection probe. (3) and (4) represent the RCP binding regions, which are complementary to binding sites 1 and 2, respectively.

[0346] Fig.16 The workflow of the 2-LSD method performed through three sequencing cycles is shown, including a "back and forth" method with double displacement. In (1), the first detection probe hybridizes to binding site 1. In (2), the second detection probe and the first displacement probe are added. The second detection probe hybridizes to binding site 2, and the first displacement probe hybridizes to the displacement sub-toehold protrusion of the first detection probe. This triggers the displacement of the first detection probe. In (3), the first detection probe is completely displaced, leaving the second detection probe completely hybridized to binding site 2. In (4), the third detection probe and the second displacement probe are added. The third detection probe hybridizes to binding site 1, and the second displacement probe hybridizes to the displacement sub-toehold protrusion of the second detection probe. This triggers the displacement of the second detection probe. In (5), the second detection probe is completely displaced, leaving the third detection probe completely hybridized to binding site 1.

[0347] Fig.17 Results of experiments to optimize the displacement buffer are shown. Using 3 different displacement buffers, the 2-LSD method was applied to displace the Cy5 detection probe with the Cy3 detection probe, and subsequently displace the Cy3 detection probe with the Cy5 detection probe. The Cy3 (A) and Cy5 (B) channels were detected. The daughter:mother ratio (A&B i), maximum intensity (A&B ii) and quality (A&B iii) of the detected RCP signal were quantified. These were used to determine the efficiency of the displacement of the detection probe. N=5. The displacement buffer conditions were as follows: Cond1: 5×SSC+0.05% Tween+20% formamide; Cond 2: 2.5×SSC+0.05% Tween+20% formamide; Cond3: 2.5×SSC+20% formamide.

[0348] Fig.18 Results of a 2-LSD experiment performed over 3 sequencing cycles are shown. (A) Microscope images of Cy5, Cy3, Cy7, and DAPI signals over the entire 3-cycle sequencing cycle are shown. (B) Linear graphs of the 3 RCPs in the Cy3, Cy5, and Cy7 channels are shown, indicating the signal intensities of the three RCPs in these channels over the 3 cycles. DETAILED DESCRIPTION

[0349] Example

[0350] Example 1 - Detection of discontinuous barcode sequences by sequencing by hybridization

[0351] General principles

[0352] The first detection probe hybridizes to the first barcode subunit and decodes the first barcode subunit. The second detection probe then hybridizes in a manner that displaces a portion of the first detection probe. Each probe in the second probe set for querying the second barcode subunit contains a common toehold region that is complementary to the sequence adjacent to the barcode subunit, with which it can hybridize very quickly. The detection probe complementary to the second barcode subunit can then also hybridize to the overlapping portion of the probe to which the first probe has bound, and in this way can very effectively displace the first probe. In fact, no washing or formamide treatment is required, which makes the method faster, cheaper and easier. The first probe - even if it still has some affinity for the target - is in the minority (much lower concentration), so the chance of hybridizing and displacing the second probe again is very small, and it will eventually dissociate. The affinity of the second probe set can even be increased by giving it a hybridization sequence that is one or two bases longer in the toehold region.

[0353] The approach works with barcode subunits, which are either individual bases (A, G, C and T) or doublets (AA, CC, GG, TT) or mixtures of bases (AT, CG, TA, GC) or - preferably - triplets, where at least two bases in the triplet are unique (two-base mismatch discrimination) to ensure high specificity.

[0354] The padlock probe can be provided with a barcode sequence having a single base barcode subunit flanked by a common spacer sequence to demonstrate this principle. In this example, a padlock probe for Actb was generated with a single base difference in the middle of the common barcode sequence. RCA products were generated in vitro or in situ in fixed mouse brain tissue sections and then queried with a set of probes targeting the single base barcode position. Sequencing was performed by hybridization reaction using detection probes, effectively decoding the barcode.

[0355] method

[0356] In vitro RCA generation

[0357] The starting circular template for rolling circle amplification was generated by performing a padlock probe ligation reaction with a single-stranded DNA template as a template. The padlock probe ligation reaction was performed with a mixture consisting of 10 nM padlock probe (PO4-AGCCTCGCCTTTGCCTTTTCTACGATTTTACCAGTGGCTTTTGCGTCTATTTAGTGGAGCCtaacgctagaCTATCTTTC GCCCCGCGAGCACAG, SEQ ID NO: 1), 30 nM template (GGCAAAGGCGAGGCTCTGTGCTCGCGGGGC, SEQ ID NO: 2), T4 ligase reaction buffer (66 mM Tris-HCl (pH 7.5), 10 mM DTT, 10 mM MgCl2, 0.2 μg / μl BSA, 0.68 mM ATP) and 1 U T4 ligase in a final volume of 50 μl. The mixture was incubated at 37°C for 15 minutes and then incubated at 65°C for 2 minutes. The circles obtained from this reaction were diluted to 10 pM in mQ H2O and subsequently amplified by target-triggered RCA reactions, for which a mixture containing 5 pM of the ligated circles, 0.2 μg / μl BSA, Φ29 polymerase reaction buffer (ThermoFisher), 125 μM dNTPs and 0.4 U / μl Φ29 polymerase (Thermo Fisher) was used to amplify the dilutions of the above circles. The RCA reactions were incubated at 37°C for 3 hours and heat-inactivated by incubation at 65°C for 2 minutes.

[0358] 10 μL of the resulting RCA reaction was then applied to a positively charged microscope slide (Superfrost, ThermoFisher), covered with a 20×20 mm coverslip and incubated at room temperature for 15 minutes to allow the RCA product to bind to the positively charged surface of the microscope slide. The coverslip was then removed, the slide was washed twice in PBS, and the RCA product was then sequenced by hybridization mixing.

[0359] In situ generation of RCAs within fixed mouse brain tissue sections:

[0360] 30-day-old mice strain C57BL / 6 (P30) were euthanized and the olfactory bulbs were cut via cryosectioning. Cryosectioning was performed on a ThermoFisher cryostat at a thickness of 10 μm. The sections were then adhered to ThermoFisher Superfrost slides and stored at -70°C until processing.

[0361] First, slides were taken out from -70 ° C storage and thawed at room temperature (RT) for 5 minutes. The fixation step was performed by incubating the slides in 3.7% PFA in 1 × DEPC-PBS (KI Substat, MIK3125-1L) for 5 minutes at RT. The slides were then washed in 1 × DEPC-PBS for 1 minute to ensure that PFA was removed, followed by permeabilization at room temperature for 5 minutes in 0.1M HCl (KI Substart, MIK-1282-500-1) in DEPC H2O. Then, the slides were washed twice in 1 × DEPC-PBS, followed by dehydration of ethanol series in 70% and 100% ethanol for 2 minutes. The slides were then air-dried at RT for 5 minutes, and then a fixed sealing chamber (Grace Bio-Labs) was applied to each slice. The slices were then rehydrated with 1 × DEPC-PBS-T (KI Substart, MIK1437-1L). In order to prepare samples, Cartana Neuroskit (Cartana, Sweden) was used. For reverse transcription, 43.75 μl reaction mixture 1 (RM1), 1.25 μl enzyme 1 and 5.00 μl enzyme 2 were mixed together and added to each tissue section mounted in the fixed sealed chamber on top of the tissue slide. The sample was incubated overnight at 37 ° C. Subsequently, RM1 was removed from the fixed sealed chamber, and a post-fixation solution containing 3.7% PFA in 1 × DEPC-PBS was added to the sample, and incubated at room temperature for 30 minutes. After fixation, the sample was washed twice in 1 × DEPC-PBS-T. For probe connection, 36.0 μl reaction mixture 2 (RM2), 4.0 μl enzyme 3, 5.0 μl enzyme 4 and 100 nM padlock probe (SEQ ID1) were mixed and added to each fixed sealed chamber, incubated for 30 minutes at 37 ° C, and then incubated for 60 minutes at 45 ° C. RM2 was then removed and the samples were washed twice with 1×DEPC-PBS-T, after which the samples were ready for in situ sequencing by hybridization reaction.

[0362] In situ sequencing by hybridization of RCPs fixed on slides or tissue sections

[0363] To query the first barcode subunit of the probe, 100 μl of SBH mix containing 2× SSC, 20% or 30% formamide and SBH-oligonucleotide G (CACA TGCGTCTATGTAGTGGAGCC TTAGAGAGTAGTACTTCCGACT, SEQ ID NO:3), SBH-oligonucleotide A (CACATGCGTCTATATAGTGGAGCC TTGTA GTA CAG CAG CAG CAT TGA GG, SEQ ID NO:4), SBH-oligonucleotide T (CACATGCGTCTATTTAGTGGAGCC TT CAA TCT AGT ATC AGT GGC GCA, SEQ ID NO:5), SBH-oligonucleotide C (CACA TGCGTCTATCTAGTGGAGCC TT GGG CCT TAT TCC GGT GCT AT, SEQ ID NO:6) and SBH-detection oligonucleotide Cy3–AGTCGGAAGTACTACTCTCT (SEQ ID NO:7). NO:7), Cy5–CCTCAATGCTGCTGCTGTACTAC (SEQ ID NO:8), AF488–TGCGCCACTGATACTAGATTG (SEQ ID NO:9) and TexR–ATAGCACCGGAATAAGGCCC (SEQ ID NO:10). SBH-oligonucleotides represent detection probes according to the present disclosure and the present invention. Detection oligonucleotides represent reporter probes as defined herein. Sequencing reactions were incubated at 25°C, 37°C or 45°C for 30 minutes. The sequencing mixture was then removed and tissue sections were washed twice in PBS-T 0.05%. Tissue sections were then mounted with mounting medium and coverslips and imaged using a 20× objective Zeiss microscope (Axio Z2).

[0364] result

[0365] The first barcode subunit contains an A at the specific position being queried, and thus a detection probe containing a T at the corresponding position is expected to hybridize to the barcode subunit. The results are shown in Fig. 9 As can be seen, within a range of temperatures and formamide concentrations, fluorescence is observed from the detection probe containing a T at the relevant position, while no fluorescence is observed from the other detection probes. It is thus confirmed that barcode subunits that differ by a single base can be successfully interrogated and distinguished using this system. The method is particularly effective at higher temperatures and formamide concentrations (i.e., 30% formamide and 37 or 45°C).

[0366] Example 2 - Linear Strand Displacement (LSD)

[0367] As described herein, the LSD method represents decoding of continuous barcode sequences with continuous overlapping barcode positions. The design of the LSD method enables continuous foothold exchange to replace the detection probe, thereby generating a decoding scheme that leads to the recognition of target nucleic acid molecules (e.g., in situ genes) without the need to strip the detection probe (e.g., the L probe used herein). In the main design, the detection probe in the form of an L probe can be hybridized with the target nucleic acid molecule, taking RCP as an example here, and then the detection oligonucleotide (DO) (i.e., the reporter probe) is hybridized and imaged. The first detection L probe consists of a reporter probe binding site, a unique foothold region (capable of hybridizing with a barcode subunit of its target barcode position) and a common binding region (capable of hybridizing with a second barcode subunit of the barcode position). The second detection L probe designed to compete with the first detection L probe also consists of a reporter probe binding site, a unique foothold region, and a common region shared with the first L probe (which hybridizes with overlapping barcode subunits, and the overlapping barcode subunits are shared by the first and second barcode positions). The second L probe will bind to RCP via its unique foothold, and compete and displace with the common binding site of the first L probe. This causes the second L probe to fully occupy its RCP binding region, and the first L probe hybridizes only with its unique foothold region. In order to complete the reaction, the unique foothold region of the first L probe spontaneously dissociates subsequently, leaving the second L probe (and its signal) as the only probe on the RCP. The unique foothold region of the second probe becomes the common region shared by it and the 3rd L probe subsequently, and this will be used to establish another foothold exchange. This cycle can continue to decode the required multiple rounds of barcodes.

[0368] During the toehold exchange process, the spontaneous displacement of the first probe can be driven forward by the stringency of the hybridization buffer. The stringency of the hybridization buffer and the subsequent wash buffer during the toehold exchange process is designed so that a 20 bp hybridization (i.e., a fully bound second detection probe) is less likely to dissociate than a 10 bp hybridization (i.e., a partially bound first detection probe). In addition, the local concentration of the first probe is reduced to a level much lower than that of the second probe, thereby making it much less likely to reverse the toehold exchange.

[0369] method

[0370] Mouse tissue section preparation

[0371] 30-day-old mice strain C57BL / 6 (P30) were euthanized and the olfactory bulbs were cut via cryosectioning. Cryosectioning was performed on a ThermoFisher cryostat at a thickness of 10 μm. The sections were then adhered to ThermoFisher Superfrost slides and stored at -70°C until processing.

[0372] RCA in situ generation

[0373] Fixation and permeabilization

[0374] The tissue sections were taken out from -70°C storage and thawed at room temperature (RT) for 5 minutes. The slides were then fixed by incubating in 3.7% PFA in 1×DEPC-PBS for 5 minutes at RT. The slides were then washed in 1×DEPC-PBS for 1 minute at RT. This ensures that PFA is completely removed before proceeding to the permeabilization step. The tissue sections were then permeabilized at room temperature for 1 minute using 0.1M HCl in DEPC-H2O, followed by two quick washes in 1×DEPC-PBS. Thereafter, the slides were then dehydrated with an ethanol series in 70% and 100% ethanol for 2 minutes, respectively, after which the slides were air-dried at RT for 5 minutes. A fixed seal chamber (Grace Bio Labs) was applied to each section, and the sections were rehydrated with 1×DEPC-PBS-T before continuing the reverse transcription step.

[0375] Reverse transcription

[0376] Using CARTANA's Neurokit, 43.75 μl of reaction mixture (RM1), 1.25 μl of enzyme 1 (ribonuclease inhibitor) and 5.00 μl of enzyme 2 (reverse transcriptase) were added to each fixed seal chamber and samples were then incubated overnight at 37°C in a humid chamber.

[0377] Probe connection

[0378] Remove reverse transcription from the fixed sealed chamber, and use 3.7% PFA in DEPC-PBS to apply the post-fixation step to the slide for 30 minutes at RT. After the post-fixation step, wash the slices twice with DEPC-PBS-T quickly. Using CARTANA's Neurokit, 36.0μl reaction mixture 2 (RM2), 4.0μl enzyme 3 (ribonuclease H), 5.0μl enzyme 4 (Tth ligase) and 100nM of each padlock probe are added to each fixed sealed chamber, and incubated at 37°C for 30 minutes, followed by secondary incubation at 45°C for 60 minutes. Subsequently, the ligation reaction mixture is removed from the fixed sealed chamber, and the chamber is subsequently washed twice with DEPC-PBS-T.

[0379] Rolling circle amplification

[0380] Using CARTANA's Neurokit, 43.0 μl of reaction mixture 3 (RM3) and 5 μl of enzyme 5 (Φ29 polymerase) were added to the fixed seal chamber and incubated at 37°C for 3 hours or at 30°C overnight. The amplification reaction mixture was then removed and washed twice with DEPC-PBS-T. The fixed seal chamber was then removed and the slide was then dehydrated with an ethanol series in 70% and 100% ethanol for 2 minutes, respectively, and then the slide was air-dried at RT for 5 minutes. The sections were then used for in situ sequencing using the LSD design.

[0381] In situ sequencing of RCPs in tissue sections using the LSD design

[0382] Probe design

[0383] The L probe designed to hybridize with RCP and displace each other consists of 3 different parts. The first part is the arm to which the detection probe binds. It is 14-20bp long and encodes a unique binding site (hence the color) that is specific to a detection probe. The second part is a unique foothold region (7-10bp) that allows initial hybridization, and the third part is a common binding sequence (7-10bp) shared by the displaced sub-probe (i.e., the subsequent detection L probe).

[0384] Probe hybridization

[0385] The sections were rehydrated with 2×SSC and the first probe mix was added at 100 nM in alkaline hybridization buffer (2.5×SSC + 5-20% formamide (depending on the length of the hybridization)) and incubated for 1 hour at RT. The sections were washed twice with alkaline wash buffer (2×SSC in DEPC-H2O).

[0386] Detection oligonucleotide (reporter probe) hybridization

[0387] After L probe hybridization, 100nM detection oligo mixture was added in alkaline hybridization buffer and hybridized for 30 minutes at RT. The sections were then washed twice with alkaline washing buffer, and then dehydrated for 2 minutes with an ethanol series in 70% and 100% ethanol, respectively, and then the slides were air-dried for 5 minutes at RT. 10μl SlowFade Gold anti-fading reagent (Invitrogen) was then added to each section and covered with a cover glass. The slides were imaged under a microscope.

[0388] Foothold Exchange

[0389] After imaging, the coverslip is removed, and the slides are dehydrated with an ethanol series in 70% and 100% ethanol for 2 minutes, respectively, and then the slides are air-dried for 5 minutes at RT to remove the mounting medium. The sections are then rehydrated with 2 × SSC in DEPC-H2O. The second L probe mixture is then added at 200nM in a replacement hybridization buffer (2.5 × SSC, 0.05% Tween-20 and 5-20% formamide concentration (depending on the hybridization length)). The sections are then incubated for 1 hour at RT, followed by washing twice with a replacement wash buffer (1 × DEPC-PBS-T and 10% formamide), each for 10 minutes. After the foothold is exchanged, the sections are then hybridized with the detection oligonucleotide mixture as described above.

[0390] result

[0391] A proof-of-concept experiment was performed using a 20 bp hybridization length (ie, an L probe of 20 nucleotides in length, with a unique toehold region of 10 bp and a consensus region of 10 bp). Figure 6 A shows the replacement scheme used. This is a reverse toehold exchange, where the L probe specific for recognition site 2 is added first, and the toehold exchange is performed with the L probe mix specific for recognition site 1. When the first probe mix containing the probe encoding the Cy5 detection probe hybridizes to the second recognition site, we see a strong signal in the Cy5 channel, but no signal in the Cy3 channel, indicating the presence of the correct L probe at the recognition site ( Figure 6 B). After performing the toehold exchange, we found that the Cy5 signal decreased significantly, indicating that the L probe at recognition site 2 had been successfully removed from the RCP. This decrease in the Cy5 signal is consistent with the increase in the Cy3 signal from background levels observed before the toehold exchange. This indicates that the Cy5-specific probe at the second recognition site was successfully exchanged for the Cy3-specific probe bound to recognition site 1.

[0392] As outlined in the above description, the "LSD design" relies on each hybridization domain of the L probe having a unique toehold region and a sequence in common with the next probe in the toehold exchange sequence. Figure 6 A), this toehold exchange can occur in both the forward and reverse directions. The latter mechanism is demonstrated here, and the results show Figure 6In B. As can be seen from the figure, during the toehold exchange process, the signal from the second recognition site is reduced to near background levels, which is consistent with the sharp increase in the signal of the L probe specific for the first recognition site. This shows that although some signals from the second recognition site are retained, the toehold exchange is successful. The spontaneous removal of the L probe is not 100% effective. However, since the signal after the toehold exchange is sufficiently reduced to near background levels, the remaining signal can be filtered out by adjusting the detection threshold during image processing.

[0393] Compared with the discontinuous barcode sequence design, the LSD design utilizes a unique toehold region of 7-10 bp and a common region of 7-10 bp. This hybridization length has high specificity, so non-specific hybridization and toehold exchange are extremely unlikely to occur.

[0394] Due to these factors, this LSD design is efficient, specific, inexpensive, and compatible with downstream methods because it does not compromise tissue morphology due to the use of large amounts of formamide.

[0395] Example 3 - In situ detection of target nucleic acid molecules using RCA and L-shaped detection probes

[0396] method

[0397] Mouse tissue section preparation

[0398] 30-day-old mice strain C57BL / 6 (P30) were euthanized and the olfactory bulbs were cut via cryosectioning. Cryosectioning was performed on a ThermoFisher cryostat at a thickness of 10 μm. The sections were then adhered to ThermoFisher Superfrost slides and stored at -70°C until processing.

[0399] RCA in situ generation

[0400] Fixation and permeabilization

[0401] The tissue sections were taken out from -70°C storage and thawed at room temperature (RT) for 5 minutes. The slides were then fixed by incubating in 3.7% PFA in 1×DEPC-PBS for 5 minutes at RT. The slides were then washed in 1×DEPC-PBS for 1 minute at RT. This ensures that PFA is completely removed before proceeding to the permeabilization step. The tissue sections were then permeabilized for 1 minute at RT using 0.1M HCl in DEPC-H2O, followed by two quick washes in 1×DEPC-PBS. Thereafter, the slides were then dehydrated with an ethanol series in 70% and 100% ethanol for 2 minutes, respectively, after which the slides were air-dried for 5 minutes at RT. A fixed seal chamber (Grace Bio Labs) was applied to each section, and the sections were rehydrated with 1×DEPC-PBS-T before continuing the reverse transcription step.

[0402] Reverse transcription

[0403] Using CARTANA's Neurokit, 43.75 μl of reaction mixture (RM1), 1.25 μl of enzyme 1 (ribonuclease inhibitor) and 5.00 μl of enzyme 2 (reverse transcriptase) were added to each fixed seal chamber and samples were then incubated overnight at 37°C in a humid chamber.

[0404] Probe connection

[0405] Remove reverse transcription from the fixed sealed chamber, and use 3.7% PFA in DEPC-PBS to apply the post-fixation step to the slide for 30 minutes at RT. After the post-fixation step, wash the slices twice with DEPC-PBS-T quickly. Using CARTANA's Neurokit, 36.0μl reaction mixture 2 (RM2), 4.0μl enzyme 3 (ribonuclease H), 5.0μl enzyme 4 (Tth ligase) and 100nM of each padlock probe are added to each fixed sealed chamber, and incubated at 37°C for 30 minutes, followed by secondary incubation at 45°C for 60 minutes. Subsequently, the ligation reaction mixture is removed from the fixed sealed chamber, and the chamber is subsequently washed twice with DEPC-PBS-T.

[0406] Rolling circle amplification

[0407] Using CARTANA's Neurokit, 43.0 μl of reaction mixture 3 (RM3) and 5 μl of enzyme 5 (Φ29 polymerase) were added to the fixed seal chamber and incubated at 37°C for 3 hours or at 30°C overnight. The amplification reaction mixture was then removed and washed twice with DEPC-PBS-T. The fixed seal chamber was then removed and the slide was then dehydrated with an ethanol series in 70% and 100% ethanol for 2 minutes, respectively, and then the slide was air-dried at RT for 5 minutes. The sections were then used for in situ sequencing using the LSD design.

[0408] In situ sequencing of RCPs in tissue sections using L-probe design

[0409] Probe design

[0410] The L-shaped detection probe (L probe) designed to hybridize with the RCP probe binding site consists of 2 different parts. The first part is a 14-20nt long arm that recognizes RCP. Each RCP is unique to a specific gene, so the binding arm is specific to the specific gene. The second arm encodes the reporter probe binding site. The sequence can be different depending on which reporter probe will be combined. The arm consists of a 2nt linker and an 18nt reporter probe binding site.

[0411] Detection probe hybridization

[0412] The sections were rehydrated with 2×SSC and the first detection probe mixture was added at 100 nM in alkaline hybridization buffer (2.5×SSC+20% formamide) and incubated for 1 hour at 20-37° C. The sections were washed twice with alkaline wash buffer (2×SSC in DEPC-H 2 O).

[0413] Reporter probe hybridization

[0414] After L-probe hybridization, 100nM reporter probe mixture was added in alkaline hybridization buffer and hybridized for 30 minutes at 20-37°C. The sections were then washed twice with alkaline washing buffer, and the sections were then dehydrated with an ethanol series in 70% and 100% ethanol for 2 minutes, respectively, and the slides were then air-dried for 5 minutes at RT. 10μl SlowFadeGold anti-fading reagent (Invitrogen) was then added to each section and covered with a coverslip. The slides were imaged under a microscope. After imaging, the L probe and reporter probe were removed, and a new sequencing cycle could be started.

[0415] result

[0416] A proof-of-concept experiment was performed using an L probe with a 20 bp hybridization length and a 20 bp RCP binding region. Fig.12 and 13 Probe hybridization and removal and the hybridization of different L probe mixtures of 4 sequencing cycles are shown. Cycle 1 in both figures shows the strong Cy3 signal in cycle 1 because the L probe with a sequence complementary to the Cy3 reporter probe is hybridized. After removing the Cy3 complementary L probe, the Cy5 complementary L-probe is hybridized, and the Cy5 signal is observed in cycle 2, wherein the Cy3 signal is completely or almost completely removed. This is also true for cycle 3 using ATTO425 and cycle 4 using AF488. This shows that the L probe hybridization in each cycle encodes a specific reporter probe, and it is also effectively removed and replaced by another L probe encoding different L probes, which encode different reporter probes.

[0417] The design of the L-probe hybridization method provides a general sequencing reaction with a decoding scheme that is straightforward and highly flexible and leads to in situ identification of the gene of interest. In the main design, an L-shaped detection probe can hybridize to the RCP, followed by hybridization of the reporter probe and imaging. The L-probe consists of a reporter probe binding site (20 nt), a 2 nt linker region, and an RCP binding region (18 nt). Fig.10The RCP binding region is specific for the gene (i.e., complementary to the nucleotide barcode sequence in the RCP), and the reporter probe binding region is specific for the reporter probe used in the decoding protocol during cycling ( Fig.10 ). In total, 4 L probes are designed for each gene, which have the same RCP binding region, but their reporter probe binding regions are different. Each L probe will contain a reporter probe binding region that is complementary to different reporter probes with different fluorophores (such as Cy3, Cy5, Cy7 and AF488). Other fluorophores can be used as needed. These 4 L probes can be expanded to include 5 or more L probes, each of which decodes a unique reporter probe binding site and all have the same RCP binding site. The sequencing reaction is triggered by hybridizing the L probe pool with the RCP in the tissue section, wherein each probe encodes a unique gene. The universal pool of reporter probes is then allowed to hybridize with the bound L probes. Approximately 1 / 4 of these L probes encode Cy3 reporter probes, 1 / 4 encode Cy5 reporter probes, and so on. Fig.11 As shown in. The tissue section is then imaged, and the L probe and reporter probe are removed. The second cycle is similar to the first cycle, except that the L probe pool is changed. Although the L probe still encodes and binds to the same gene, the reporter probe binding site in the L probe is changed so that the L probe encoding a specific reporter probe in the first cycle can but not necessarily encode different reporter probes in the second cycle. For example, the L probe encoding gene 1 may encode a Cy3 reporter probe in the first cycle, but encodes a Cy5 reporter probe in the second cycle. This means that the decoding scheme of gene 1 can be Cy3 (cycle 1), Cy5 (cycle 2), AF488 (cycle 3), etc. ... and this design means that each gene needs 4 L probes, which requires a large amount of probes in total, which also provides the flexibility of how to produce the L probe pool for decoding. It also allows multiple sequencing cycles without changing the RCP sequence. Therefore, it can be seen that the decoding ability is located in the L-probe pool mixture, rather than being directly encoded on the RCP.

[0418] This design provides greater flexibility to change the decoding mechanism in order to include additional genes into the pool or to reduce the number of genes in the pool. Fig.12 and 13 It can be clearly seen that it is possible to control which reporter probe is decoded in which cycle. A requirement of this design is that the L probe needs to be removed to make the L probe recognition site available again on the RCP. This may seem like a rather harsh treatment compared to other designs disclosed and claimed herein that may not require such harsh treatment to remove the signal. However, from Fig.12 and 13 As can be seen, this removal is very effective.

[0419] Having a decoding mechanism based on a pool of L probes rather than RCPs means that only a 20nt recognition site is required on the RCP, rather than multiple binding sites specific for a particular reporter probe. This makes the padlock probe relatively small and easier to use. An additional benefit of having a decoding mechanism based on a pool of L probes is that we can decide the length of the decoding barcode. This can range from 1 to 6 or more cycles without increasing the size of the padlock probe and without having to design additional reporter probes. This also means that in order to encode 4 reporter probes, 4 L probes need to be designed for each gene. If additional reporter probes are used in the decoding scheme, another L probe must be designed for each gene that encodes the reporter probe. However, if many genes need to be sequenced, this does provide us with an additional level of flexibility in implementing additional "bases."

[0420] Example 4 - Linear Strand Displacement (2-LSD) with "Back and Forth" Arrangement and Additional Displacer Probes

[0421] This is the second iteration of the LSD design discussed above. In the original LSD method, a subsequent detection probe in the form of an L probe is used to replace the previous detection probe without the need for chemical stripping. In the 2-LSD design, the barcode contains 2 binding sites, i.e., 2 barcode positions (i.e., recognition sites for 2 detection probes), which are arranged to facilitate a "back and forth" decoding method. In this arrangement, only 2 binding sites are required on the target nucleic acid molecule (here, the RCP) in order to fully decode the barcode. The binding sites on the RCP contain a common region of 5bp (these regions are different from each other, but are common in all RCPs). Both binding sites also contain a 5bp region, which is unique for each binding site and each RCP. Finally, there is a 10bp region that is common to both binding sites but unique to each RCP ( Fig.14 ). The overlapping region is a displacement site where the detection probes can be displaced from each other in two directions. Thus, it can be seen that the barcode comprises a first and a second barcode position (corresponding to the first and second domains of the target nucleic acid sequence). The first barcode position (BC1) comprises the first and second barcode subunits ( Fig.14 2 and 3 in ), and the second barcode position (BC2) comprises the first and second barcode subunits ( Fig.14 3 and 4 in ), where the second subunit of BC1 overlaps (is common or shared with) the first subunit of BC2. 3 is thus a shared or overlapping barcode subunit, and 2 and 4 are unique barcode subunits unique to BC1 and BC2, respectively. Each barcode position (BC1 and BC2) also contains its own adjacent common region, in Fig.141 and 5 in the example. This common region is the same for the first and second position barcodes used in different targets (RCPs), but is different from each other in a given barcode. BC1 and BC2 together with their adjacent common regions constitute the binding site for the detection probe.

[0422] The detection probe used in the 2-LSD method is a modified L probe designed to have 2 overhangs, that is to say they are U probes as defined above. They are slightly different from the detection probe used in the original LSD method in two aspects. The first is to add a 10bp displacement sub-toehold overhang, which serves as a toehold region for the binding of a short displacement sub-probe. The displacement sub-toehold overhang is common to all detection probes that are bound to a specific binding site (barcode position with a common region). The presence of the additional displacement sub-toehold region on the detection probe allows displacement to occur simultaneously on both sides of the detection probe; at the displacement sub-toehold site, the detection probe can be replaced by the displacement sub-probe, and at the other end of the binding site, the detection probe can be replaced by a subsequent detection probe (as in the original LSD method).

[0423] The second variation is that the detection probe is designed to specifically bind to "binding site 1" or "binding site 2" ( Fig.15 ). The detection probe needs to be in a certain configuration when binding to RCP and needs to be able to bind to a specific sequence in one of the two binding sites, so they are each designed to bind only to one or the other binding site.

[0424] As a typical sequencing workflow consists of 6 rounds of decoding, that is, 6 unique detection probes, the detection probes will be designed so that the detection probes used for cycles 1, 3 and 5 will bind to site 1, while the detection probes used for cycles 2, 4 and 6 will bind to site 2, which means that, for example, the detection probe designed for cycle 2 will not be used in cycle 5.

[0425] The 2-LSD design eliminates the need to use chemical stripping to remove the detection probes. This is gentler on the tissue samples being studied and allows the morphology of the sample to be maintained. The use of a "back and forth" design means that binding sites very similar to those used in the original LSD method can be used, thereby maintaining the size of the padlock probe (which is used to generate the RCP, and thus contains a complementary copy of the barcode that appears in the RCP; in fact, the barcode is encoded into the padlock probe and copied into the RCP). In addition, the use of a common replacement sub-toehold overhang region means that for all sequencing cycles, only 2 different replacement sub-probes are required to replace all detection probes in the entire detection probe pool. This reduces the cost of reagents and makes the reaction more efficient.

[0426] method

[0427] Mouse tissue section preparation

[0428] 30-day-old mice strain C57BL / 6 (P30) were euthanized and the olfactory bulbs were cut via cryosectioning. Cryosectioning was performed on a ThermoFisher cryostat at a thickness of 10 μm. The sections were then adhered to ThermoFisher Superfrost slides and stored at -70°C until processing.

[0429] RCA in situ generation

[0430] Fixation and permeabilization

[0431] The tissue sections were taken out from -70°C storage and thawed at room temperature (RT) for 5 minutes. The slides were then fixed by incubating in 3.7% PFA in 1×DEPC-PBS for 5 minutes at RT. The slides were then washed in 1×DEPC-PBS for 1 minute at RT. This ensures that PFA is completely removed before proceeding to the permeabilization step. The tissue sections were then permeabilized for 1 minute at RT using 0.1M HCl in DEPC-H2O, followed by two quick washes in 1×DEPC-PBS. Thereafter, the slides were then dehydrated with an ethanol series in 70% and 100% ethanol for 2 minutes, respectively, after which the slides were air-dried for 5 minutes at RT. A fixed seal chamber (Grace Bio Labs) was applied to each section, and the sections were rehydrated with 1×DEPC-PBS-T before continuing the reverse transcription step.

[0432] Reverse transcription

[0433] Using CARTANA's Neurokit, 43.75 μl of reaction mixture (RM1), 1.25 μl of enzyme 1 (ribonuclease inhibitor) and 5.00 μl of enzyme 2 (reverse transcriptase) were added to each fixed seal chamber and samples were then incubated overnight at 37°C in a humid chamber.

[0434] Probe connection

[0435] Remove reverse transcription from the fixed sealed chamber, and use 3.7% PFA in DEPC-PBS to apply the post-fixation step to the slide for 30 minutes at RT. After the post-fixation step, wash the slices twice with DEPC-PBS-T quickly. Using CARTANA's Neurokit, 36.0μl reaction mixture 2 (RM2), 4.0μl enzyme 3 (ribonuclease H), 5.0μl enzyme 4 (Tth ligase) and 100nM of each padlock probe are added to each fixed sealed chamber, and incubated at 37°C for 30 minutes, followed by secondary incubation at 45°C for 60 minutes. Subsequently, the ligation reaction mixture is removed from the fixed sealed chamber, and the chamber is subsequently washed twice with DEPC-PBS-T.

[0436] Rolling circle amplification

[0437] Using CARTANA's Neurokit, 43.0 μl of reaction mixture 3 (RM3) and 5 μl of enzyme 5 (Φ29 polymerase) were added to the fixed seal chamber and incubated at 37°C for 3 hours or at 30°C overnight. The amplification reaction mixture was then removed and the steps of washing twice with DEPC-PBS-T were followed. The fixed seal chamber was then removed and the slides were then dehydrated with an ethanol series in 70% and 100% ethanol for 2 minutes, respectively, and then the slides were air-dried at RT for 5 minutes. The sections were then used for in situ sequencing using the LSD design.

[0438] In situ sequencing of RCPs in tissue sections using a 2-LSD design

[0439] Probe design

[0440] The detection probe is designed to hybridize with binding site 1 or binding site 2 on RCP. Except for the orientation, the two designs are identical. The detection probe contains a 10bp displacement subtoehold overhang region, which is combined with a 5bp sequence in the RCP recognition domain to act as a general toehold region common to all detection probes. The RCP binding region contains the above-mentioned 5bp toehold plus an additional 15bp, spanning 20bp and the length of the reporter probe binding site is 20bp. The GC content of the detection probe is 50%. For binding site 1, the displacement subtoehold overhang region is on the left side of the RCP binding domain, and the reporter probe binding region is on the right side of the RCP binding domain. For the detection probe that binds to binding site 2, the reporter probe binding region is on the left side of the RCP binding domain, and the displacement subtoehold overhang region is on the right side.

[0441] The barcode design of the padlock probe comprises a 30bp detection probe binding domain. It has 2 common regions at either end of the barcode, and each length is 5bp. These common regions are different from each other, but are common to all padlock probes, and no matter what its target is. There are 2 unique regions, and its length is 5bp and is located next to the common region. These unique regions are unique for each binding site. In the middle of the 30bp detection probe binding region, there is a 10bp binding region, which is shared between two binding sites. This ensures that a detection probe part replaces the ability of another detection probe. Each binding site is composed of 1 common region (5bp), 1 unique region (5bp) and the 10bp common region, thus providing a 20bp binding region for detection probe hybridization.

[0442] Probe hybridization

[0443] The sections were rehydrated with 1×PBS and the first probe mixture was added at 100 nM in alkaline hybridization buffer (2.5×SSC + 5-20% formamide (depending on the length of the hybridization)) and incubated for 1 hour at 37° C. The sections were then washed twice with alkaline wash buffer (1×PBS).

[0444] Detection of oligonucleotide hybridization

[0445] After hybridization of the detection probe, 100 nM detection oligonucleotide mixture was added in alkaline hybridization buffer and hybridized at 37°C for 30 minutes. The sections were then washed twice with alkaline wash buffer, followed by dehydration with an ethanol series in 70% and 100% ethanol for 2 minutes, respectively, and the slides were then air-dried for 5 minutes at RT. 10 μl of SlowFade Gold anti-fading reagent (Invitrogen) was then added to each section and covered with a cover glass. The slides were imaged under a microscope.

[0446] Displacement of detection probes using the 2-LSD method

[0447] After imaging, the coverslip is removed and the slide is placed in an ethanol series in 70% and 100% ethanol for 2 minutes, respectively, and then the slide is air-dried for 5 minutes at RT to remove the sealing agent. The slice is then rehydrated with 1×PBS. The second detection probe and the displacement subchain mixture are then added, and the final concentration of the two in the displacement hybridization buffer (2.5×SSC, 0.05% Tween-20 and 5-20% formamide concentration (depending on the hybridization length)) is 200nM. The slice is then incubated at 37°C for 1 hour, and then washed twice at room temperature with displacement washing buffer (1×DEPC-PBS-T and 20% formamide), each time for 10 minutes. After the displacement reaction ends, the slice is subjected to DO mixed hybridization as described above.

[0448] result

[0449] Displacement of detection probes under different buffer conditions

[0450] The buffer used to replace the detection probe with the next detection probe in the sequencing cycle is key to efficient and complete replacement during the 2-LSD method. Variants of the standard hybridization buffer were used to test the components required for effective replacement of the detection probe. Three sequencing cycles including 2 replacement steps were performed to observe the color change and the recovery of the signal from the first cycle in the third cycle. All buffer compositions tested were considered successful in replacing the detection probe in cycles 2 and 3 and resulted in a switch from Cy5 to Cy3 and back to Cy5. From this result, it can be concluded that the replacement in the second cycle (from Cy5 to Cy3) is less efficient for condition 3 (2.5×SSC+20% formamide). This can be seen by analyzing the daughter:mother ratio ( Fig.17 A&B i), which showed a lower ratio of daughter:mother than other conditions. Fig.17 A&B iii) It can also be seen that condition 3 shows lower overall quality compared to the other conditions.

[0451] The signal recovery in the Cy5 channel (i.e., the third cycle) is Fig.17 B ii) and base quality ( Fig.17 B iii) is lower, indicating that the displacement of the second detection probe is incomplete, but the signal is still well above the background level and can be easily identified. This finding is confirmed by the fact that the daughter: mother ratio in the third cycle ( Fig.17 B i) shows complete recovery of the signal in the Cy5 channel. Therefore, a suitable displacement buffer can be selected from 5× or 2.5× SSC supplemented with 0.05% Tween-20 and 20% formamide. These results further indicate that the 2-LSD method is able to displace the currently hybridized detection probe by using a combination of a displacement daughter strand and another detection probe.

[0452] 2-LSD cycle with 2 permutation cycles using the "back and forth" method

[0453] Using the optimal displacement buffer composition as described above, a 3-cycle 2-LSD setup was used to investigate how effectively the detection probe could be displaced. Fig.18 A shows a microscope image showing the switching of the detection probe detection from Cy5 to Cy3 and back to Cy5 channel in its respective cycle. As a reference for RCP, a Cy7-labeled anchor was used as a nuclear counterstain together with DAPI. In all 3 cycles, the switching between channels can be observed very clearly. Fig.18 B shows a line graph of three RCPs and indicates the grayscale value of the RCP in the corresponding channel. Here, Cy5 shows the highest signal in cycle 1, disappears completely in cycle 2, and is detected again only in cycle 3, although the intensity is slightly lower. The signal in the Cy3 channel is only significantly higher than the background in cycle 2, which is where the signal is expected. In cycle 1 and cycle 3, the Cy3 signal is all background level. This shows that in the 3 cycles, the channel expected to show a signal can be quite clearly distinguished from other channels, and it can be seen that those channels that should not show any signal have signals close to or below the background level. Therefore, it can be concluded that the 2-LSD design can successfully replace the detection probe and cycle through 2 positions in a "back and forth" method.

Claims

1. A method for detecting a nucleic acid molecule, wherein the method comprises: (a) assigning a unique signal code sequence to a nucleic acid molecule, wherein the signal code sequence is specific for the molecule, wherein the signal code sequence can be derived by querying a target nucleotide sequence in the nucleic acid molecule with a detection probe sequence, each detection probe generating a signal, and the signals together constitute the signal code sequence, and wherein the target nucleotide sequence comprises a first and a second domain, each domain comprising a first subunit and a second subunit, wherein in the target nucleotide sequence, the second subunit of the first domain at least partially overlaps with the first subunit of the second domain; (b) contacting the nucleic acid molecule with a first detection probe to generate a signal code for the first position of the signal code sequence, and hybridizing the detection probe to the nucleic acid molecule, wherein the detection probe comprises a recognition sequence complementary to the first and second subunits of the first domain, and a reporter molecule; (c) detecting a signal from a reporter molecule of a first detection probe that has hybridized to the nucleic acid molecule at the first domain; (d) identifying the signal code of the first position of the signal code sequence from the signal detected in (c); (e) contacting the nucleic acid molecule with a subsequent detection probe so as to generate a signal code for the next position of the signal code sequence, and allowing the detection probe to hybridize with the nucleic acid molecule, wherein the subsequent detection probe comprises a recognition sequence complementary to the first and second subunits of the second domain, and a reporter molecule, and wherein the subsequent detection probe hybridizes with a sequence in the second subunit of the prior domain, thereby initiating a strand displacement reaction that displaces the hybridized prior detection probe; (f) detecting a signal from the reporter molecule of the subsequent detection probe, wherein the subsequent detection probe has hybridized to the nucleic acid molecule at the adjacent domain; (g) identifying the signal code of the next position of the signal code sequence from the signal detected in (f); (h) repeating steps (e)-(g) to identify the signal code at the position of the subsequent signal code sequence until a signal code sufficient to detect the nucleic acid molecule has been identified, wherein in the repeated steps, the detection probe used to identify the subsequent signal code in the signal code sequence has a recognition sequence complementary to the subunits present at the first and second domains of the target nucleotide sequence, respectively, so that the detection probe continuously hybridizes with and replaces the previous detection probe from the first and second domains; The first domain may be the 5' or 3' domain in the target nucleotide sequence.

2. A method for decoding a nucleotide barcode sequence in a nucleic acid molecule, wherein the nucleotide barcode sequence corresponds to a specific signal code sequence, the signal code sequence can be derived by interrogating the nucleotide barcode sequence with consecutive detection probes that each produce a signal, and the signals together constitute the signal code sequence, and wherein the nucleotide barcode sequence comprises at least two adjacent barcode positions, each barcode position comprising a barcode subunit pair comprising a first barcode subunit and a second barcode subunit, wherein the second barcode subunit from each barcode position at least partially overlaps with the first barcode subunit of the adjacent barcode position in the sequence, the method comprising: (i) contacting the nucleic acid molecule with a first detection probe to generate a signal code for a first position of the signal code sequence, and hybridizing the detection probe to the nucleic acid molecule, wherein the detection probe comprises a recognition sequence complementary to the barcode subunit pair present at the first barcode position and a reporter molecule; (ii) detecting a signal from the reporter molecule of the first detection probe, wherein the first detection probe has hybridized to the nucleotide barcode sequence at the first barcode position; (iii) identifying the signal code of the first position of the signal code sequence from the signal detected in (ii); (iv) contacting the nucleotide barcode sequence with a subsequent detection probe so as to generate a signal code for the next position of the signal code sequence and allowing the detection probe to hybridize with the nucleic acid molecule, wherein the subsequent detection probe comprises a recognition sequence complementary to a barcode subunit pair present at an adjacent barcode position, and a reporter molecule, and wherein the subsequent detection probe hybridized to the barcode subunit at the adjacent position hybridizes to a sequence in the overlapping portion of the prior barcode position and thereby initiates a strand displacement reaction that displaces the hybridized prior detection probe; (v) detecting a signal from a reporter molecule of the subsequent detection probe, wherein the subsequent detection probe hybridizes to the nucleotide barcode sequence at the adjacent barcode position; (vi) identifying the signal code of the next position of the signal code sequence from the signal detected in (v); (vii) repeating steps (iv)-(vi) to identify a signal code at a subsequent signal code sequence position until a signal code sufficient to decode the nucleotide barcode sequence has been identified, wherein a detection probe for identifying the subsequent signal code in the signal code sequence has (a) a recognition sequence complementary to a barcode subunit pair present at a subsequent consecutive barcode position in a nucleotide barcode sequence comprising a plurality of consecutive adjacent barcode positions, or (b) a recognition sequence complementary to a barcode subunit pair present at a first and a second barcode position in a nucleotide barcode sequence comprising two adjacent barcode positions, and a reporter molecule; The first barcode position may be any barcode position in the nucleotide barcode sequence.

3. A method for detecting a nucleic acid molecule, wherein the method comprises: (a) assigning a unique signal code sequence to the nucleic acid molecule, wherein the signal code sequence is specific for the molecule; (b) providing the nucleic acid molecule with a nucleotide barcode sequence corresponding to the signal code sequence, wherein the signal code sequence can be derived by interrogating the nucleotide barcode sequence with consecutive detection probes that each produce a signal, and the signals together comprise the signal code sequence, and wherein the nucleotide barcode sequence comprises at least two adjacent barcode positions, each barcode position comprising a barcode subunit pair comprising a first barcode subunit and a second barcode subunit, wherein the second barcode subunit from each barcode position at least partially overlaps with the first barcode subunit of the adjacent barcode position in the sequence; (c) performing steps (i) to (vii) as defined in claim 2 to generate a signal code sequence to decode the nucleotide barcode sequence and detect the nucleic acid molecule.

4. A method of decoding a nucleotide barcode sequence in a nucleic acid molecule to distinguish the nucleotide barcode sequence from other nucleotide barcode sequences, wherein the nucleotide barcode sequence comprises a plurality of consecutive barcode positions, each barcode position partially but not completely overlapping an adjacent barcode position in the sequence, and each barcode position comprises at least one barcode subunit, and wherein each barcode subunit is selected from a panel of barcode subunits, such that the order of the barcode subunits in each nucleotide barcode sequence defines a signal code sequence comprising a signal code corresponding to each barcode position and distinct from a signal code sequence of other nucleotide barcode sequences, and identifying a given nucleotide barcode sequence, the method comprising: (i) contacting the nucleic acid molecule with a first set of first detection probes to decode a nucleotide barcode sequence at a first contiguous barcode position, and hybridizing the detection probes to the nucleic acid molecule, wherein each detection probe in the set comprises a sequence complementary to a different barcode subunit in the small group and a reporter molecule, such that each detection probe is capable of hybridizing to and detecting a different barcode subunit at the first barcode position; (ii) detecting a signal from the reporter molecule of the first detection probe, wherein the first detection probe has hybridized to the nucleotide barcode sequence at the first contiguous barcode position; (iii) a signal code identifying the location of the first barcode from the signal detected in (ii); (iv) contacting the nucleotide barcode sequence with a next set of subsequent detection probes to decode the nucleotide barcode sequence at the next consecutive barcode position and hybridizing the detection probes to the nucleic acid molecule, wherein each detection probe comprises a sequence complementary to a different barcode subunit in the group and a reporter molecule, such that each detection probe is capable of hybridizing to and detecting a different barcode subunit at the barcode position, and wherein the subsequent detection probe that hybridizes to the barcode subunit at the next position hybridizes to a sequence in an overlapping portion of the prior barcode position and thereby initiates a strand displacement reaction that displaces the hybridized prior detection probe; (v) detecting a signal from the reporter molecule of the subsequent detection probe that has hybridized to the nucleotide barcode sequence at the next consecutive barcode position; (vi) identifying the signal code of the next barcode position from the signal detected in (v); (vii) repeating steps (iv)-(vi) to identify signal codes for subsequent consecutive barcode positions until a signal code sufficient to decode the nucleotide barcode sequence has been identified, wherein the first consecutive barcode position may be any barcode position in the nucleotide barcode sequence; Preferably, the first detection probe and the subsequent detection probe each comprise a displacement subtoehold overhang region; Preferably, step (iv) further comprises contacting the nucleotide barcode sequence with a set of displacer probes, wherein each displacer probe comprises a displacer toehold binding region and a sequence complementary to a sequence of a different detection probe.

5. The method of any one of claims 2 to 4, wherein the first contiguous barcode position is one of the terminal barcode positions of the nucleotide barcode sequence.

6. The method of any one of claims 1 to 5, wherein the reporter molecule of each detection probe comprises a fluorophore; Preferably, the detection probe comprises an overhang region, wherein the overhang region comprises a binding site capable of hybridizing to a reporter probe comprising a fluorophore. Preferably, wherein the signal code for each domain or barcode position is the color of the fluorophore of the reporter molecule of the detection probe hybridized to the domain or barcode position.

7. The method of any one of claims 4 to 6, wherein each barcode position comprises a first spacer sequence, a barcode subunit, and a second spacer sequence, wherein the second spacer sequence from each barcode position at least partially overlaps with the first spacer sequence of an adjacent barcode position in the sequence, and wherein each barcode subunit is selected from a small group of barcode subunits such that the order of the barcode subunits in each barcode sequence is different from other barcode sequences, and identifying a given barcode sequence, the method comprising: (i) contacting the nucleic acid molecule with a first set of first detection probes to decode the nucleotide barcode sequence at a first contiguous barcode position, and allowing the detection probes to hybridize to the nucleic acid molecule, wherein each detection probe comprises a first flanking sequence complementary to at least a portion of the first spacer sequence at the first barcode position, a sequence complementary to a barcode subunit, a second flanking sequence complementary to at least a portion of the second spacer sequence at the first barcode position, and a reporter molecule, wherein each detection probe comprises a sequence complementary to a different barcode subunit in the small set, such that each detection probe is capable of hybridizing to and detecting a different barcode subunit at the first barcode position; (ii) detecting a signal from the reporter molecule of the first detection probe, wherein the first detection probe has hybridized to the nucleotide barcode sequence at the first contiguous barcode position; (iii) determining the identity of the first barcode subunit from the signal detected in (ii); (iv) contacting the nucleotide barcode sequence with a next set of subsequent detection probes to decode the nucleotide barcode sequence at the next consecutive barcode position and hybridizing the detection probes to the nucleic acid molecule, wherein each detection probe comprises a first flanking sequence complementary to at least a portion of the first spacer sequence at the subsequent barcode position, a sequence complementary to a barcode subunit, a second flanking sequence complementary to at least a portion of the second spacer sequence at the subsequent barcode position, and a reporter molecule, wherein each detection probe comprises a sequence complementary to a different barcode subunit in the small group, such that each detection probe is capable of hybridizing to and detecting a different barcode subunit at the barcode position, and wherein the subsequent detection probe that hybridizes to the barcode subunit at the next position hybridizes to at least a portion of the second spacer sequence at the prior barcode position and thereby initiates a strand displacement reaction that displaces the hybridized prior detection probe; (v) detecting a signal from the reporter molecule of the subsequent detection probe that has hybridized to the nucleotide barcode sequence at the next consecutive barcode position; (vi) determining the identity of the next barcode subunit from the signal detected in (v); (vii) repeating steps (iv)-(vi) to decode subsequent consecutive barcode positions until the identity of the position of the subunit barcode sequence sufficient to decode the nucleotide barcode sequence has been determined, The first continuous barcode position can be any barcode position in the nucleic acid molecule.

8. The method of claim 7, wherein each barcode subunit is 3 nucleotides in length.

9. The method of claim 7 or claim 8, wherein each barcode subunit comprises at least 2 mismatches relative to each other barcode subunit.

10. The method of any one of claims 7 to 9, wherein the spacer sequence is 2 to 20 nucleotides in length.

11. The method of any one of claims 7 to 10, wherein the spacer sequences are all the same length.

12. The method of any one of claims 7 to 11, wherein the second spacer sequence of each barcode position completely covers the first spacer sequence of the adjacent barcode position.

13. The method of any one of claims 7 to 12, wherein the first flanking sequence of each detection probe has a higher affinity for the first spacer sequence of the corresponding barcode position than the second flanking sequence of the detection probe has an affinity for the second spacer sequence of the corresponding barcode position.

14. The method of any one of claims 7 to 13, wherein in each detection probe, the first flanking sequence is longer than the second flanking sequence.

15. The method of any one of claims 4 to 6, wherein each barcode position comprises a barcode subunit pair comprising a first barcode subunit and a second barcode subunit, wherein the second barcode subunit from each barcode position at least partially overlaps with the first barcode subunit of an adjacent barcode position in the sequence, such that the order of the barcode subunit pairs in each nucleotide barcode sequence defines a signal code sequence comprising a signal code corresponding to each barcode subunit pair and distinct from a signal code sequence of other nucleotide barcode sequences, and identifying a given nucleotide barcode sequence, the method comprising: (i) contacting the nucleic acid molecule with a first set of first detection probes to decode a nucleotide barcode sequence at a first contiguous barcode position, and hybridizing the detection probes to the nucleic acid molecule, wherein each detection probe comprises a sequence complementary to a different barcode subunit pair and a reporter molecule, such that each detection probe is capable of hybridizing to and detecting a different barcode subunit pair at the first barcode position; (ii) detecting a signal from the reporter molecule of the first detection probe, wherein the first detection probe has hybridized to the nucleotide barcode sequence at the first contiguous barcode position; (iii) identifying a signal code of a first barcode subunit pair from the signal detected in (ii); (iv) contacting the nucleotide barcode sequence with a next set of subsequent detection probes to decode the nucleotide barcode sequence at the next consecutive barcode position and hybridize the detection probes to the nucleic acid molecule, wherein each detection probe comprises a sequence complementary to a different barcode subunit pair and a reporter molecule, such that each detection probe is capable of hybridizing to and detecting a different barcode subunit pair at the barcode position, and wherein the subsequent detection probe that hybridizes to the barcode subunit at the next position hybridizes to a sequence in an overlapping portion of the prior barcode position and thereby initiates a strand displacement reaction that displaces the hybridized prior detection probe; (v) detecting a signal from the reporter molecule of the subsequent detection probe that has hybridized to the nucleotide barcode sequence at the next consecutive barcode position; (vi) identifying the signal code of the next barcode subunit pair from the signal detected in (v); (vii) repeating steps (iv)-(vi) to identify signal codes for barcode subunit pairs at subsequent consecutive barcode positions until a signal code sufficient to decode the nucleotide barcode sequence has been identified, The first contiguous barcode position may be any barcode position in the nucleotide barcode sequence.

16. The method of claim 15, wherein each nucleotide barcode sequence comprises a unique barcode subunit.

17. The method of any one of claims 2 to 6, 15 or 16, wherein the second barcode subunit from each barcode position completely overlaps with the first barcode subunit of the adjacent barcode position.

18. The method of any one of claims 2 to 17, wherein the nucleic acid molecule containing the nucleotide barcode sequence is a probe molecule or an amplification product of a probe molecule.

19. The method of any one of claims 2 to 18, wherein the nucleic acid molecule containing the nucleotide barcode sequence is a rolling circle amplification product of a circularized padlock probe.

20. A method for detecting a target nucleic acid molecule, wherein the target molecule is detected using a padlock probe specific for the target nucleic acid molecule, the padlock probe is circularized when hybridized with a target sequence in the target nucleic acid molecule, and the padlock probe has a nucleotide barcode sequence to identify the padlock probe, wherein the circularized padlock probe is amplified by rolling circle amplification (RCA) to produce a rolling circle product (RCP), the RCP containing multiple complementary copies of the nucleotide barcode sequence, characterized in that The method includes: (a) assigning a unique signal code sequence to a target nucleic acid molecule, wherein the signal code sequence is specific for that molecule; (b) providing a nucleotide barcode sequence to the padlock probe so that an RCP is formed comprising a plurality of complementary copies of the nucleotide barcode sequence each corresponding to the signal code sequence, wherein the signal code sequence can be derived by interrogating the complementary copies of the nucleotide barcode sequence with consecutive detection probes that each generate a signal, and the signals together constitute the signal code sequence; (c) contacting the RCP with a first detection probe to generate a signal code for a first position of the signal code sequence, and hybridizing the detection probe to the RCP at a complementary copy of the nucleotide barcode sequence, wherein the detection probe comprises a recognition sequence complementary to the nucleotide barcode sequence and a reporter molecule; (d) detecting a signal from the reporter molecule of the first detection probe, which has hybridized to the RCP; (e) identifying the first signal code for the first position in the signal code sequence for RCP from the signal detected in (d); (f) removing the first detection probe from the RCP; (g) contacting the RCP with a subsequent detection probe to generate a signal code for the next position of the signal code sequence, and hybridizing the detection probe to the nucleic acid molecule at a complementary copy of the nucleotide barcode sequence, wherein the detection probe comprises a recognition sequence complementary to the nucleotide barcode sequence and a reporter molecule; (h) detecting a signal from the reporter molecule of the subsequent detection probe, which has hybridized to the RCP; (i) identifying, from the signal detected in (g), a signal code for a next position in a signal code sequence for an RCP; (j) removing the subsequent detection probe from the RCP; (k) repeating steps (g)-(j) to identify signal codes at subsequent signal code positions until signal codes sufficient to identify the nucleotide barcode sequence and thereby detect the nucleic acid molecule have been identified.

21. The method of claim 20, wherein the reporter of each detection probe is a binding site for the reporter probe comprising a detectable label, said binding site being contained in an overhang region of the detection probe that is not hybridized to the RCP, and wherein the signal is detected by said label.

22. The method of claim 21, wherein the detectable label is a fluorophore and the signal code sequence is a unique fluorophore sequence.

23. The method of claim 21 or claim 22, wherein the detection probes for generating the signal code sequence of the target nucleic acid molecule are provided in the form of a set of detection probes, each detection probe comprising the same recognition sequence and reporter binding site, which may be the same or different, and which is specific to the reporter probe comprising a detectable label that produces a given signal code, and wherein the detection probes are used in a predetermined sequence order, the predetermined sequence corresponding to the signal code sequence assigned to the target nucleic acid molecule.

24. The method of any one of claims 20 to 23, for detecting a plurality of different nucleic acid molecules present in a sample, wherein each different nucleic acid molecule is assigned a different signal code sequence and is detected using a specific padlock probe having a different nucleotide barcode sequence; Preferably, wherein a different subsequent detection probe set is provided for each different nucleic acid molecule, each different detection probe set produces a different signal code sequence.

25. The method of any one of claims 1 to 24, wherein the target nucleic acid molecule is detected in situ in a cell sample; Preferably, the target nucleic acid molecule is detected in a cell culture medium or in a tissue sample.

Images