A STON1 gene molecular marker primer related to eggshell quality traits and its application

Abstract

The invention relates to a STON1 gene molecular marker primer related to egg shell quality traits and an application thereof, and belongs to the field of biotechnology. The STON1 gene molecular marker of the invention is the 7867409th base of chromosome 3 of the chicken reference genome GRCg7b version, the base mutation is A or G, and the genotype is A / A, A / G and G / G. The proportion of soft-shell eggs of A / A genotype chickens is lower than that of A / G and G / G genotype individuals, and the proportion of soft-shell eggs of A / G genotype chickens is lower than that of G / G genotype individuals. The invention utilizes forward and reverse primer pairs to amplify a fragment containing the above-mentioned molecular marker site, and performs Sanger sequencing on the amplified product, so as to quickly and accurately identify the genotype of an individual as a genetic marker for chicken breeding, and select chickens with a lower proportion of soft-shell eggs; the soft-shell egg trait can be efficiently and accurately detected, and the breeding accuracy and breeding efficiency of the egg shell quality trait can be improved, which has important value for chicken breeding and production.

Description

Technical Field

[0001] The invention relates to a STON1 gene molecular marker primer related to egg shell quality traits and application thereof, belonging to the field of biotechnology. Background Art

[0002] Single nucleotide polymorphism (SNP) refers to the variation of a single nucleotide in the genome, which can be stably inherited to offspring during the transmission of genetic material. Therefore, it can be used as a molecular marker for population selection and seed conservation. Eggshell quality is one of the important quality traits of eggs. Normal fresh eggs have a smooth surface, a firm and complete eggshell, uniform color, consistent size, good hand feel, and produce a crisp sound when colliding with each other and are not easy to break. Soft-shell eggs have thin and soft shells that are easy to break, and the quality of the eggs is poor, which directly affects the collection, storage, transportation, hatching or consumption of eggs, causing great economic losses to breeding. The production of soft-shell eggs is affected by many factors. In addition to nutritional management and feeding management, the influence of genetics on the incidence of soft-shell eggs cannot be ignored. The heritability of the soft-shell egg ratio trait is 0.308, which is a high heritability trait. If it is not selected in breeding, it will lead to the rapid spread of soft-shell egg bad genes in the population, directly affecting the commerciality of eggs and the hatching success rate of breeding eggs, thereby reducing profits. However, soft-shelled eggs are more common in the middle and late stages of the laying period, making it difficult to select and breed chickens in the early stages, and selecting after the start of laying will result in a huge waste of feeding costs. One of the current goals of breeding is to use molecular markers to select chickens early, accurately, efficiently and quickly select chickens with low soft-shell egg production rates, and improve the uniformity of egg quality in the group. Studies have found that high expression of the human STON1 gene can lead to hyperandrogenism and obesity, and the STON1 gene is highly expressed in women with polycystic ovary syndrome. Compared with mice of normal body size, higher expression of the STON1 gene was found in the ovaries and fat cells of obese mice, and obesity is one of the reasons for the decline in reproductive performance. These studies have revealed that the STON1 gene is closely related to reproduction, but there has been no report on the study of the chicken STON1 gene. Summary of the invention

[0003] The purpose of the present invention is to study the relationship between the STON1 gene and eggshell quality traits in view of the defects of the prior art, and to propose a STON1 gene molecular marker primer related to eggshell quality traits and its application to quickly and accurately identify chicken soft-shell eggs.

[0004] The present invention measures the proportion of low-quality eggshells in chickens, uses second-generation sequencing technology to perform whole-genome SNP genotyping, and screens STON1 gene molecular markers that are significantly correlated with eggshell quality traits through whole-genome association analysis, providing new gene and molecular marker resources for eggshell quality trait selection and breeding.

[0005] The present invention solves the technical problem through the following technical scheme: firstly, a STON1 gene molecular marker primer related to eggshell quality traits is provided, the nucleotide sequence of the molecular marker primer is shown in SEQ ID NO:1 and SEQ ID NO:2, the molecular marker is located at the 7867409th base on chromosome 3 of the chicken reference genome GRCg7b version, and the base is mutated to A or G. The sequence is shown in the 109th base as shown in SEQ ID NO:3 or SEQ ID NO:4.

[0006] The present invention further provides an application of the above molecular marker primers for detecting SNP genotypes related to the proportion of soft-shell eggs. The detection method comprises the following steps:

[0007] The first step is to provide a chicken DNA sample to be tested, and perform PCR amplification using a molecular marker primer pair to obtain an amplification product, wherein the amplification product is 538 bp in length and contains the 7867409th base of chicken chromosome 3;

[0008] Step 2: Sanger sequencing of the PCR product;

[0009] The third step is to determine the genotype of the SNP molecular marker at base 7867409 of chicken chromosome 3 based on the sequencing results of the second step.

[0010] Wherein, the deoxyribonucleotide sequence of the molecular marker primer pair described in the first step is:

[0011] Upstream primer: 5'-CCACTGCACTTGCTCAACAT-3' (SEQ ID NO: 1)

[0012] Downstream primer: 5'-CATCCAGCTGAATCAAAGCA-3' (SEQ ID NO: 2)

[0013] The final concentration of the reaction system is 25 μl.

[0014] Chicken DNA to be tested 50 ng,

[0015] 2 x Accurate Taq Master Mix 12.5 μl,

[0016] Upstream primer 1 μl,

[0017] Downstream primer 1 μl,

[0018] Add sterile water to 25 μl.

[0019] The reaction conditions of the PCR amplification are: pre-denaturation at 94°C for 5 minutes; denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, extension at 72°C for 60 seconds, for a total of 30 cycles; extension at 72°C for 2 minutes; storage at 4°C; the nucleotide sequence of the amplified product is shown in SEQ ID NO: 3 or SEQ ID NO: 4, the amplified product is 538 bp in length, and contains the 7867409th base of chicken chromosome 3.

[0020] In the third step, the judgment standard is that the proportion of soft-shell eggs of chickens with A / A genotype at the SNP site is lower than that of A / G and G / G genotype individuals, and the proportion of soft-shell eggs of chickens with A / G genotype is lower than that of chickens with G / G genotype.

[0021] The present invention detects the genotype of the soft-shell egg trait through the STON1 gene molecular marker, and obtains that the proportion of soft-shell eggs of individuals with A / A genotype is lower than that of individuals with A / G genotype and G / G genotype, and the proportion of soft-shell eggs of individuals with A / G genotype is lower than that of individuals with G / G genotype. The genomic DNA of the chicken to be tested is used as a template, and PCR amplification is performed on it using specific primers, and then the PCR amplification product is subjected to Sanger sequencing and SNP molecular marker genotyping, and the genotype based on the SNP molecular marker can realize the selection of the chicken soft-shell egg trait. In breeding, according to the breeding goal, the A / G and G / G genotype individuals can be eliminated, and the A / A genotype individuals can be retained. The beneficial effect is that the molecular marker can be used as a genetic marker for chicken breeding, and chickens with a low proportion of soft-shell eggs can be bred; the chicken soft-shell egg trait can be identified efficiently and quickly, providing a scientific basis for the early breeding of chickens, and having important value for chicken breeding. In addition, the detection method disclosed in the present invention is simple and easy to operate, and can be carried out in the laboratory. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is the Manhattan plot of the genome-wide association analysis of soft-shell egg traits in chickens after they start laying eggs.

[0023] Figure 2 These are the Sanger sequencing results of the PCR amplification products of the three genotypes. DETAILED DESCRIPTION

[0024] The following embodiments are applicable to chicken breeding, and the breeds of chickens cited are not limited to the following embodiments.

[0025] Example 1

[0026] In this example, the soft-shell egg phenotypic traits of recessive White Rock chickens after laying were measured, and whole-genome SNP genotyping was performed using second-generation sequencing technology. The STON1 gene molecular markers significantly associated with eggshell quality traits were screened through whole-genome association analysis. The results are as follows: Figure 1 shown.

[0027] In this example, the following experiments were performed to identify and apply the STON1 gene molecular markers related to eggshell quality traits.

[0028] 1. Phenotypic and genotypic testing

[0029] (1) Experimental materials and phenotypic determination of soft-shell eggs at 36 weeks of age

[0030] 2301 recessive White Rock chickens were selected and raised under the same feeding conditions. They were fed and watered freely throughout the whole process. The number and type of eggs laid by each chicken were recorded after the start of laying. At 36 weeks of age, the proportion of soft-shell eggs of each chicken was counted as the phenotypic data of egg shell quality.

[0031] (2) Extraction of genomic DNA

[0032] Blood was collected from the subwing vein of the individual to be tested, lysed after anticoagulation, digested with proteinase K, extracted with saturated sodium chloride method, dissolved in TE and stored at -20℃.

[0033] (3) PCR amplification

[0034] Using the genomic DNA extracted as above as a template, a fragment containing the site at base position 7867409 on chromosome 3 was amplified.

[0035] Upstream primer: 5'-CCACTGCACTTGCTCAACAT-3' (SEQ ID NO: 1)

[0036] Downstream primer: 5'-CATCCAGCTGAATCAAAGCA-3' (SEQ ID NO: 2)

[0037] The final concentration of the reaction system is 25 μl.

[0038] DNA to be tested 50 ng,

[0039] 2 x Accurate Taq Master Mix 12.5 μl,

[0040] Upstream primer 1 μl,

[0041] Downstream primer 1 μl,

[0042] Add sterile water to 25 μl.

[0043] The reaction conditions of PCR amplification are: 94℃ pre-denaturation for 5min; 94℃ denaturation for 30sec, 55℃ annealing for 30sec, 72℃ extension for 60sec, 30 cycles in total; 72℃ extension for 2min; 4℃ storage; 10μl was taken for agarose detection, and a single target band with a length of 538bp was amplified, containing the SNP molecular marker at the 7867409th base site of chicken chromosome 3. The sequence of the amplified product is as follows:

[0044] SEQ ID NO:3

[0045] CCACTGCACTTGCTCAACATTCCATGAATCTGGAAGGCAACAGGGATGGGGAGTGCAACTTCTCGGTCAGTGATGGGATGTTCTGAGCAAAAAGGCAAACAACGAAAAAAGGCACAAAAGGATTCAGGCGAAAA AGGGGCAAAAGGCACAAAAAGGCAGCAGTCCTTTGTTTGCAAAGTCCTTATAAATGGTCTGGTCTTTGTGTGGTTTCACAAGGTAACAACACGTTGTGCACATTCGACACTACTGCACAGTCTTATCTACCCCTG AGCATCCAGGGTCCCTCATCTTAGGGTCACCTCGGTCCATCTCAGCAGCAGAACATGAGCTGGCATCCTCCCCTTATCTTTGTTGCCCCCGGCAACCGTGTGTAGGCAGCAGGGAGTCCTTCAGAGTCTCCCTC AGGCCTCTCAAGCAACTTCTGAGACAAAAAACTTCTTTGTATACGCTCACAGGGGTGCAACAGCATCCTCGTGCAACAGCAGGCGTTGGTTTCTGTTAAACTCAGAGGTGACGGATGCTTTGATTCAGCTGGATG

[0046] SEQ ID NO:4

[0047] CCACTGCACTTGCTCAACATTCCATGAATCTGGAAGGCAACAGGGATGGGGAGTGCAACTTCTCGGTCAGTGATGGGATGTTCTGAGCAAAAAGGCAAACAACGAAAAGAGGCACAAAAGGATTCAGGCGAAAA AGGGGCAAAAGGCACAAAAAGGCAGCAGTCCTTTGTTTGCAAAGTCCTTATAAATGGTCTGGTCTTTGTGTGGTTTCACAAGGTAACAACACGTTGTGCACATTCGACACTACTGCACAGTCTTATCTACCCCTG AGCATCCAGGGTCCCTCATCTTAGGGTCACCTCGGTCCATCTCAGCAGCAGAACATGAGCTGGCATCCTCCCCTTATCTTTGTTGCCCCCGGCAACCGTGTGTAGGCAGCAGGGAGTCCTTCAGAGTCTCCCTC AGGCCTCTCAAGCAACTTCTGAGACAAAAAACTTCTTTGTATACGCTCACAGGGGTGCAACAGCATCCTCGTGCAACAGCAGGCGTTGGTTTCTGTTAAACTCAGAGGTGACGGATGCTTTGATTCAGCTGGATG

[0048] (4) Sanger sequencing and genotyping

[0049] The PCR products of each sample were subjected to Sanger sequencing, and the sequencing peaks of different genotypes were obtained as shown in Figure 2 shown.

[0050] 2. Correlation Analysis

[0051] 2301 recessive White Rock hens with clear records of soft-shell egg phenotype at 36 weeks of age were selected for correlation analysis. The ANOVA test function of R 4.2 statistical drawing software was used for statistical test, and the pairwise mean comparison mode was selected to perform statistical test on the genotype and soft-shell egg traits of the experimental chicken flocks. P<0.05 indicated significant differences. The results are shown in Table 1. The soft-shell egg ratio of the three genotype chickens was significantly different (P<0.05). The soft-shell egg ratio of A / A genotype individuals was 1.02%, which was lower than 1.78% (P<0.05) of G / G genotype individuals and 1.46% (P<0.05) of A / G genotype individuals. The soft-shell egg ratio of A / G genotype individuals was lower than that of G / G genotype individuals (P<0.05). The results showed that the chicken STON1 gene molecular marker was significantly correlated with the chicken soft-shell egg phenotype. According to the actual breeding goals, A / A genotype individuals can be selected to breed chickens with a low proportion of soft-shell eggs, reduce the output rate of soft-shell eggs, and improve breeding efficiency.

[0052] Table 1 Statistical analysis of STON1 gene molecular marker genotypes and eggshell quality phenotypes

[0053]

[0054] Note: Data in the same column with the same letters on their shoulders indicate no significant difference, while data with different letters on their shoulders indicate significant difference (P<0.05).

[0055] Example 2

[0056] Genotype frequencies of different varieties

[0057] Step 1: Blood sample collection

[0058] Blood samples from 15 breeds, including Beijing Oily Chicken, Big Bone Chicken, Daweishan Miniature Chicken, Wenchang Chicken, Wuding Chicken, Piao Chicken, Bearded Chicken, Tibetan Chicken, Camellia Chicken, Fujian Hetian Chicken, Liyang Chicken, Xinghua Chicken, Guangxi Sanhuang Chicken, White Leghorn Laying Hen and Cobb Broiler, were collected by subwing vein blood collection and stored at -20℃ for future use.

[0059] Step 2: Extract genomic DNA

[0060] Take the tissue sample obtained in step 1 and use Omega's tissue genomic DNA extraction kit to extract genomic DNA. The specific method refers to the standard operating procedure provided by Omega.

[0061] Step 3: Genotype detection

[0062] Using the genomic DNA obtained in step 2 as a template, a primer pair consisting of an F nucleotide sequence (SEQ ID NO: 1) and an R nucleotide sequence (SEQ ID NO: 2) was used for PCR amplification and Sanger sequencing to obtain the individual's G / G genotype, G / A genotype, and A / A genotype.

[0063] White Leghorn laying hens are a common commercial laying hen breed with high egg production rate and good eggshell quality. Beijing Oily Chicken, Big Bone Chicken, Daweishan Miniature Chicken, Wenchang Chicken, Wuding Chicken, Gou Chicken, Bearded Chicken, Tibetan Chicken, Camellia Chicken, Fujian Hetian Chicken, Liyang Chicken, Xinghua Chicken and Guangxi Sanhuang Chicken are well-known Chinese local chicken breeds. Cobb broiler chicken is a more popular commercial broiler breed on the market, and the degree of selection and breeding for egg quality traits is relatively low. Among them, Chinese local chickens have not undergone long-term selection and breeding, and have low egg production, but good eggshell quality, and the frequency of A allele in the population is higher than that of Cobb broilers. White Leghorn laying hens are the most common fine breed laying hens. They have undergone long-term selection and breeding for egg quality traits, with high egg production and good eggshell quality, and the frequency of A allele in the population is higher than that of Cobb broilers. These results all confirm that the SNP locus can be used as a molecular marker for eggshell quality. See Table 2,

[0064] Table 2. Distribution of allele frequencies of STON1 gene molecular markers in different varieties

[0065]

[0066] In addition to the above implementations, the present invention may also have other implementations. Any technical solution formed by equivalent replacement or equivalent transformation falls within the protection scope required by the present invention.

Claims

1. An application of a primer for detecting a SNP site of a STON1 gene related to egg shell quality traits, characterized in that: The detection primers are used to detect the soft-shell egg ratio trait. The nucleotide sequences of the detection primers are shown in SEQ ID NO: 1 and SEQ ID NO:

2. The SNP site is located at the 7867409th base of chromosome 3 of the chicken reference genome GRCg7b version, and the base mutates to A or G. The soft-shell egg ratio of chickens with A / A genotype at the SNP site is lower than that of individuals with A / G and G / G genotypes, and the soft-shell egg ratio of chickens with A / G genotype is lower than that of individuals with G / G genotype.

2. The use of the primers for detecting the STON1 gene SNP site related to eggshell quality traits according to claim 1, characterized in that: The detection method comprises the following steps, The first step is to provide a chicken DNA sample to be tested, and perform PCR amplification using the detection primers shown in SEQ ID NO: 1 and SEQ ID NO: 2 to obtain an amplified product, wherein the amplified product is 538 bp in length and contains the 7867409th base of chromosome 3 of the chicken reference genome GRCg7b version; The second step is to perform Sanger sequencing on the PCR product; The third step is to determine the genotype of the SNP site at base 7867409 on chromosome 3 of the chicken reference genome GRCg7b version based on the sequencing results of the second step.

3. The use of the detection primers for the STON1 gene SNP site related to eggshell quality traits according to claim 2, characterized in that: The final volume of the reaction system was 25 μl. Chicken DNA to be tested 50 ng 2×Accurate Taq Master Mix 12.5 μl Upstream primer 1 μl Downstream primer 1 μl Add sterile water to 25 μl; The reaction conditions of the PCR amplification are: 94°C pre-denaturation for 5 min; 94°C denaturation for 30 sec, 55°C annealing for 30 sec, 72°C extension for 60 sec, a total of 30 cycles; 72°C extension for 2 min; 4°C storage; the nucleotide sequence of the amplified product is shown in SEQ ID NO: 3 or SEQ ID NO: 4.

Images