Fluorescent quantitative PCR (Polymerase Chain Reaction) method for Bordetella exkinsonii

Abstract

The invention discloses a Bordetella exponentiana fluorescent quantitative PCR (Polymerase Chain Reaction) method, which relates to the technical field of bioengineering, and is technically characterized by comprising the following steps: S1, carrying out fluorescent PCR amplification on a primer by taking a standard plasmid as a DNA (Deoxyribonucleic Acid) template, and drawing to obtain a standard curve between Bordetella exponentiana amplification CT (Computed Tomography) values; and S2, carrying out fluorescent PCR amplification on the DNA of the detected sample by using the primer, and obtaining an amplification result in the detected sample. According to the B.Hinzii fluorescent quantitative PCR method disclosed by the invention, an amplification curve is obvious by taking B.Hinzii as a template, so that the established fluorescent quantitative PCR detection method has good specificity, high detection sensitivity and good repeatability and stability.

Description

Technical Field

[0001] The invention relates to the technical field of bioengineering, and in particular to a fluorescent quantitative PCR method for Bordetella hinskii. Background Art

[0002] Bordetella hinzii is a species of Bordetella that can cause respiratory pathogens. It is a Gram-negative rod-shaped bacterium that belongs to the Bordetella genus of the Alcaligenes family, along with Bordetella pseudohinzii and Bordetella avium. It exists in the respiratory tract and lung tissue of mice and can conditionally cause respiratory inflammation in both immunocompetent and immunodeficient experimental mice.

[0003] Existing quantitative detection methods for Bordetella hinskii lack sensitivity and specificity. Summary of the invention

[0004] The purpose of the present invention is to solve the above problems and provide a fluorescent quantitative PCR method for Bordetella hinskii.

[0005] In order to achieve the above object, the technical scheme of the present invention is as follows: a fluorescent quantitative PCR method for Bordetella hinskii, comprising the following steps:

[0006] Step S1, using the standard plasmid as a DNA template, performing fluorescent PCR amplification on the primers, and drawing a standard curve between the CT values ​​of Bordetella hinsii amplification;

[0007] Step S2: Perform fluorescent PCR amplification on the DNA of the test sample using primers, and obtain the amplification result in the test sample according to the above.

[0008] Furthermore, the standard plasmid sequence is shown as SEQ ID NO.1.

[0009] Furthermore, the reaction system of the fluorescent quantitative PCR amplification is Premix Taq 10 μL, upstream and downstream primers (10 μM) 0.5 μL each, probe (10 μM) 0.25 μL, template 2 μL and RNase-free water to make up to 20 μL.

[0010] Furthermore, the reaction conditions of the fluorescent quantitative PCR amplification are 95°C for 2 min; 95°C for 15 s, 60°C for 1 min, and 40 cycles.

[0011] Furthermore, the standard curve is y=-3.4518x+41.13, and the linear determination coefficient R 2 =0.9993.

[0012] Further, the upstream primer sequence is "GCAGCCGTCGCAAGTATAC";

[0013] The downstream primer sequence is "CATTGCGAGGCCCTTATTCT";

[0014] The probe sequence is 5'-(FAM)TTGCAGCGCTAGCC(NFQ)-3'.

[0015] Furthermore, the deposit number of the Bordetella hinzii is CGMCC No.31707, the deposit unit is the General Microbiology Center of the China Microbiological Culture Collection Administration, the deposit date is November 1, 2024, the deposit address is No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, and the classification name of the deposited biological material sample is Bordetella hinzii 。

[0016] Compared with the prior art, the beneficial effects of this scheme are as follows: the fluorescent quantitative PCR method for Bordetella hinzii of the present invention has an obvious amplification curve with B. Hinzii as the template, indicating that the established fluorescent quantitative PCR detection method has good specificity, strong detection sensitivity, and good repetitive stability of the method. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 It is the result of B.Hinzii in the embodiment of the present invention;

[0018] Figure 2 is a standard curve in an embodiment of the present invention;

[0019] Figure 3 is the sensitivity result of B.Hinzii in the embodiment of the present invention;

[0020] Figure 4 This is the result of detecting nucleic acid in lung tissues of 5 mice by B. Hinzii fluorescence PCR method in the embodiment of the present invention;

[0021] Figure 5 This is the result of detecting 96 samples of respiratory tract contents of rats and mice by B. Hinzii fluorescence PCR method in the embodiment of the present invention. DETAILED DESCRIPTION

[0022] In order to enable those skilled in the art to better understand the solution of the present invention, the technical solution of the present invention will be further described in detail below in conjunction with the embodiments of the present invention and the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work should fall within the scope of protection of the present invention.

[0023] It should be noted that, in the absence of conflict, the embodiments and features in the embodiments of the present invention can be combined with each other. The present invention will be described in detail below in conjunction with the embodiments.

[0024] Example:

[0025] 1 Materials and methods

[0026] 1.1 Materials

[0027] 1.1.1 Bacteria

[0028] All mouse strains of Bordetella hinzii were maintained in our laboratory.

[0029] 1.1.2 Main reagents and instruments

[0030] Nucleic acid extraction kit: cador Pathogen 96QIAcube HT Kit, QIAGEN; reverse transcription kit: Thermo RevertAid First Strand cDNA Synthesis Kit, purchased from Thermo; B.zii plasmid standard connected with RTV target sequence was synthesized by Shanghai Bioengineering; Probe qPCR Master Mix: Promega;

[0031] Fully automatic nucleic acid extraction instrument: Model: QIAcubeHT QIAGEN; Fluorescence quantitative PCR instrument: Applied Biosystems, USA, Model: QuantStudio 6.

[0032] 1.2 Methods

[0033] 1.2.1 Design of primers and probes

[0034] According to the B. Hinzii (CCP049736.1) genome sequence published on NCBI, primers and probes were designed by selecting conserved specific regions of the FOY gene through BLAST comparison analysis. See Table 1.

[0035] Table 1 Primers and probes for RTV fluorescence quantitative PCR

[0036]

[0037] 1.2.2 Standard plasmid preparation:

[0038] A B.Hinzii sequence was artificially synthesized and inserted into the pUC57 plasmid as a plasmid standard for B.Hinzii. The standard plasmid was diluted from 10 8Dilute to 10 0 copies / ul, as a positive standard. The sequence is shown in SEQ ID NO.1.

[0039] 1.2.3 Fluorescence quantitative PCR reaction system and reaction conditions

[0040] PCR reaction system: Go Probe qPCR Master Mix 10μL, upstream and downstream primers (l0μM) 0.4μL each, probe (10μM) 0.2μL, CXR Reference Dye (30μM) 0.02μL, RNase-free water 6.98μL, template 2μL. Reaction conditions: 95℃ 2min: 95℃ 15s, 60℃ 1min, 40 cycles.

[0041] 1.2.4 Specificity experiments

[0042] The B.Hinzii plasmid, mouse Pasteurella pneumophila PP strain, mouse Pasteurella multocida PM strain, and mouse Pasteurella aerogenes PA strain were detected to verify the specificity of the B.Hinzii real-time fluorescence quantitative PCR detection method.

[0043] 1.2.5 Sensitivity test

[0044] Take 10 8 ~10 0 Copy standard samples, and perform real-time fluorescence quantitative PCR detection, and make 3 duplicate wells for each concentration of standard samples.

[0045] 1.2.6 Repeatability verification of the method

[0046] Using the optimized reaction conditions, different concentrations of plasmid standards (10 7 ,10 4 and 10 2 Three replicates were set for each concentration, and two different time points were selected for detection. The mean, standard deviation and coefficient of variation of Ct values ​​within and between groups were calculated.

[0047] 1.2.7 Application of the method

[0048] The established B. Hinzii fluorescent PCR method was used to detect a total of 10 samples of lungs and respiratory contents from 6 mice sent by a certain unit and 60 mouse respiratory tract samples randomly sampled for laboratory animal quality inspection in Beijing in June 2024.

[0049] 2 Results

[0050] 2.1 Specificity experimental results

[0051] Real-time fluorescence quantitative PCR detection method specific detection, the results are as follows Figure 1 As shown, it can be seen that when PP, PM, and PA are used as templates, the amplification curves are all straight lines with no amplification, while when B. Hinzii is used as a template, the amplification curve is obvious, indicating that the established fluorescent quantitative PCR detection method has good specificity.

[0052] 2.2 Sensitivity test results

[0053] like Figure 2 , Figure 3 It can be seen that the dilution gradients of the amplification curve are evenly spaced and the linear range (1×10 1 1×10 8 copies / μL), good. The slope of the standard curve is -3.407, and the correlation coefficient R 2 The value was 0.999 (>0.99), and the amplification efficiency Eff% was 96.56%C (between 90% and 110%). The standard was diluted to 1×10 1 There was an obvious amplification curve when the CT value was 35.54, so the minimum detection limit was 10 copies / μL.

[0054] 2.3 Verification of the repeatability of the method

[0055] The established H-PCR method was used to detect 10 6 , 10 4 and 10 2 As shown in Table 2, the intra-group variation coefficient of Ct value of the plasmid standard with three concentrations of 100 copies / μL was 0.12%-0.62%, and the inter-group variation coefficient was 2.27%-3.39%, indicating good repeatability of the method.

[0056] Table 2 Repeated verification results of the method

[0057]

[0058] 2.4 Application of the method

[0059] 2.3.1 The established B. Hinzii fluorescent PCR method was used to detect 10 samples of lung and respiratory contents from 5 mice sent by a certain unit. The results showed that all samples were negative for B. Hinzii ( Figure 4 ).

[0060] 2.3.2 The established B.Hinzii fluorescence method was used to detect 20 rat feces samples randomly sampled for laboratory animal quality inspection in Beijing in June 2024. The results showed that all samples were negative for B.Hinzii ( Figure 5 ).

[0061] The deposit number of Bordetella hinzii is CGMCC No.31707, the depository is the General Microbiology Center of China Culture Collection Administration, the deposit date is November 1, 2024, the deposit address is No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, and the classification name of the deposited biological material sample is Bordetella hinzii.

[0062] The above specific embodiments are merely explanations of the present invention and are not limitations of the present invention. After reading this specification, those skilled in the art may make modifications to the embodiments without any creative contribution as needed. However, such modifications are protected by the patent law as long as they are within the scope of the claims of the present invention.

Claims

1. A fluorescent quantitative PCR method for Bordetella hinskii, characterized in that: The following steps are involved: Step S1, using the standard plasmid as a DNA template, performing fluorescent PCR amplification on the primers, and drawing a standard curve between the CT values ​​of Bordetella hinsii amplification; Step S2: Perform fluorescent PCR amplification on the DNA of the test sample using primers, and obtain the amplification result in the test sample according to the above.

2. A fluorescent quantitative PCR method for Bordetella hinskii as claimed in claim 1, characterized in that: The standard plasmid sequence is shown in SEQ ID NO.

1.

3. A fluorescent quantitative PCR method for Bordetella hinskii as claimed in claim 1, characterized in that: The reaction system of the fluorescent quantitative PCR amplification is 10 μL of Premix Taq, 0.5 μL of each of the upstream and downstream primers (10 μM), 0.25 μL of the probe (10 μM), 2 μL of the template and 20 μL of RNase-free water.

4. A fluorescent quantitative PCR method for Bordetella hinskii as claimed in claim 1, characterized in that: The reaction conditions of the fluorescent quantitative PCR amplification are 95° C. for 2 min; 95° C. for 15 s, 60° C. for 1 min, and 40 cycles.

5. A fluorescent quantitative PCR method for Bordetella hinskii as claimed in claim 1, characterized in that: The standard curve is y=-3.4518x+41.13, and the linear determination coefficient R 2 =0.9993.

6. A fluorescent quantitative PCR method for Bordetella hinskii as claimed in claim 3, characterized in that: The upstream primer sequence is "GCAGCCGTCGCAAGTATAC"; The downstream primer sequence is "CATTGCGAGGCCCTTATTCT"; The probe sequence is 5'-(FAM)TTGCAGCGCTAGCC(NFQ)-3'.

7. A fluorescent quantitative PCR method for Bordetella hinskii as claimed in claim 1, characterized in that: The deposit number of the Bordetella hinzii is CGMCC No.31707, the deposit unit is the General Microbiology Center of the China Culture Collection Administration, the deposit date is November 1, 2024, the deposit address is No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, and the classification name of the deposited biological material sample is Bordetella hinzii.

Images