A primer-probe combination, kit and application for rapid detection of DON-producing Fusarium based on MIRA

Abstract

The present invention provides a primer-probe combination, a kit and an application for rapid detection of DON-producing Fusarium based on MIRA, which belongs to the field of biosafety technology. The present invention applies MIRA detection technology to DON-producing Fusarium detection for the first time, and compares the main DON-producing Fusarium with the Three Toxigenic gene clusters are screened for highly homologous sequences as specific amplification targets, and primer-probe combinations are designed for real-time fluorescence MIRA detection. The resulting primer and probe combination for detecting DON-producing Fusarium has strong specificity and high sensitivity. The method of detecting DON-producing Fusarium using a primer and probe combination for detecting DON-producing Fusarium has the advantages of simple operation, portable supporting equipment, short time consumption, high sensitivity, and automatic result interpretation. The amplification detection takes only about 20 minutes, which can achieve rapid on-site detection, timely discover the risk of DON-producing Fusarium contamination, intervene in advance, avoid risks or reverse losses.

Description

Technical Field

[0001] The present invention relates to the field of biosafety technology, and in particular to a primer-probe combination, a kit and applications for rapid detection of DON-producing Fusarium based on MIRA. Background Art

[0002] Mycotoxins are the main risk factors threatening food security. Among them, deoxynivalenol (DON), also known as vomitoxin, is the most common mycotoxin contaminating wheat. It is mainly a secondary metabolite produced by Fusarium graminearum and Fusarium culmorum. It has cytotoxic, teratogenic and immunosuppressive effects and has been classified as a Class 3 carcinogen by the World Health Organization's International Agency for Research on Cancer.

[0003] Wheat DON contamination is a global challenge. Studies have shown that monitoring the total number of DON-producing Fusarium organisms carried by wheat at different growth stages can facilitate early warning of DON contamination risks. However, existing laboratory testing methods are time-consuming and labor-intensive, and the bacteria are susceptible to changes during sample transportation, leading to biased test results. Therefore, there is an urgent need to develop rapid on-site detection methods for DON-producing Fusarium to promptly monitor contamination status, identify risks, and implement effective intervention measures to ensure wheat yield and quality. These methods will also provide data support for research on the mechanisms of toxigenic contamination and the factors influencing toxigenic production, facilitating the development of precise pre-harvest prediction models for DON contamination in wheat.

[0004] Nucleic acid-based polymerase chain reaction (PCR)-based rapid detection technologies, such as real-time quantitative PCR (qPCR) and digital PCR (dPCR), have been widely used in multiple testing fields due to their high specificity and sensitivity. However, these technologies rely on complex and sophisticated temperature-variable equipment, limiting their application in resource-scarce areas and on-site testing. Isothermal amplification technology has developed rapidly in recent years. Due to its single temperature requirement, it can operate in common constant-temperature instruments such as water baths, metal baths, and even thermos cups, completely eliminating the temperature and expensive instrumentation requirements of nucleic acid amplification. Furthermore, this technology has strong specificity, high sensitivity, simple operation steps, and does not require specialized technicians, making it ideal for grassroots laboratories and rapid on-site testing.

[0005] Commonly used isothermal amplification techniques include strand displacement amplification (SDA), rolling circle amplification (RCA), loop-mediated isothermal amplification (LAMP), recombinase polymerase amplification (RPA), and multienzyme isothermal rapid amplification (MIRA). LAMP is currently the most widely used and most widely published isothermal amplification method due to its high amplification efficiency and the need for only one enzyme. However, it suffers from drawbacks such as complex primer design, a high false-positive rate, and high reagent costs. Furthermore, due to intellectual property protection in Japan, its translational application in my country is limited. MIRA, which relies on the synergistic action of multiple functional proteins at room temperature to achieve rapid nucleic acid amplification, is a truly portable, on-site rapid nucleic acid detection technology. Its detection reagents, with independent intellectual property rights in my country, are relatively low-cost, easily available, and ensure timely detection. Furthermore, existing methods struggle with on-site nucleic acid extraction and purification, failing to meet the requirements for rapid, on-site testing.

[0006] MIRA is a recently emerging isothermal amplification technology that relies on three core enzymes: DNA polymerase, single-stranded DNA binding protein, and recombinase. It does not require complex temperature control equipment, and the amplification reaction time is short. By designing specific primers and probes with modified groups, fluorescence detection results can be interpreted. The key to the operation of this type of detection method lies in the design of appropriate primers and probes. The choice of primers affects the detection speed, sensitivity, and specificity.

[0007] Therefore, finding a method to quickly detect DON-producing Fusarium on site is crucial for monitoring and early warning of wheat DON toxin contamination. Summary of the Invention

[0008] The purpose of the present invention is to provide a primer-probe combination, kit and application for rapid detection of DON-producing Fusarium based on MIRA, which has the advantages of simple operation, short time consumption, automatic interpretation of results, etc., has good detection sensitivity and specificity for DON-producing Fusarium in field wheat samples, and can meet the needs of rapid on-site detection.

[0009] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0010] The present invention provides a primer-probe combination for rapid detection of DON-producing Fusarium based on MIRA, characterized in that the primer-probe combination for rapid detection of DON-producing Fusarium based on MIRA consists of the following sequences:

[0011] Forward primer MIRA-Fus-F9, SEQ ID NO.9:

[0012]

[0013] Reverse primer MIRA-Fus-R4, SEQ ID NO.15:

[0014]

[0015] Probe MIRA-Fus-Pr1, SEQ ID NO. 20:

[0016] GTTGTGCCTCGATCCATCGCTCAGGCTTGAACT / FAM / Spacer / BHQ1 / CGGGCTCGGGGAAA / C3-Spacer.

[0017] Furthermore, the front part of the probe MIRA-Fus-Pr1 sequence partially overlaps with the forward primer sequence, and the rear part of the probe sequence does not overlap with the reverse primer sequence; the probe MIRA-Fus-Pr1 has a total of 4 modification sites: the 34th base is labeled with a fluorescent group, the 35th base is labeled with tetrahydrofuran, the 36th base is labeled with a quenching group, and the 3′ end is modified with a blocking group.

[0018] The present invention also provides a DON-producing Fusarium detection kit, characterized in that the DON-producing Fusarium detection kit comprises the above-mentioned primer-probe combination for rapid detection of DON-producing Fusarium based on MIRA.

[0019] The present invention also provides an application of a DON-producing Fusarium detection kit in detecting DON-producing Fusarium.

[0020] Furthermore, the reaction system for detecting DON-producing Fusarium is calculated in 25 μL:

[0021] Buffer solution 14.7 μL, 10 μM forward primer 1 μL, 10 μM reverse primer 1 μL, 10 μM probe 0.3 μL, lyophilized enzyme powder 2.5 mg, DNA or plasmid solution 1-5 μL, 175 mM magnesium acetate solution 2 μL, and ddH2O to make up the volume to 25 μL.

[0022] Furthermore, the reaction temperature for detecting DON-producing Fusarium is 42° C., and the reaction time is 10 to 30 minutes.

[0023] The beneficial effects of the present invention compared with the prior art are:

[0024] (1) The present invention applies MIRA detection technology to the detection of DON-producing Fusarium for the first time. By comparing the Tri toxin-producing gene clusters of the main DON-producing Fusarium species—F. graminearum, F. asiaticum, F. pseudograminearum, and F. culmorum—highly homologous sequences were screened as specific amplification targets. Primer-probe combinations were designed for real-time fluorescence MIRA detection, resulting in a primer and probe combination for detecting DON-producing Fusarium. The primer and probe combination used in this application for detecting DON-producing Fusarium has strong specificity and high sensitivity.

[0025] (2) The method of the present invention for detecting DON-producing Fusarium using a primer and probe combination for detecting DON-producing Fusarium has the advantages of simple operation, portable supporting equipment, short time consumption, high sensitivity, and automatic interpretation of results. The amplification detection only takes about 20 minutes, which can realize rapid on-site detection, timely discover the risk of DON-producing Fusarium contamination, intervene in advance, avoid the risk or reverse the loss. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0027] Figure 1 This is the forward primer amplification result in Example 1;

[0028] Figure 2 This is the reverse primer amplification result in Example 1;

[0029] Figure 3 The probe amplification results in Example 1;

[0030] Figure 4 This is the amplification temperature verification result in Example 2;

[0031] Figure 5 This is the specificity verification result in Test Example 1;

[0032] Figure 6 This is the sensitivity result of plasmid detection in Experimental Example 2;

[0033] Figure 7 This is the sensitivity result of genomic DNA detection in Experimental Example 2. DETAILED DESCRIPTION

[0034] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0035] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Each smaller range between any intermediate value within a stated value or stated range and any other stated value or intermediate value within the stated range is also encompassed by the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0036] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0037] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be exemplary only.

[0038] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0039] In the present invention, a highly homologous base sequence (SEQ ID NO. 22) that can meet the requirements for primer probe design is:

[0040]

[0041] Example 1

[0042] In Example 1 of the present invention, MIRA forward and reverse primers and probes for detecting DON Fusarium were prepared. The specific method is as follows:

[0043] (1) Target sequence selection

[0044] MIRA detection primers and probes were designed using the Tri toxin-producing gene cluster sequence as the target. The Tri toxin-producing gene cluster sequences of different DON-producing Fusarium species were obtained from the NCBI website. After Blast comparison, a highly homologous base sequence that met the requirements for primer and probe design was screened and confirmed (see sequence SEQ ID NO.23).

[0045] (2) Primer and probe design

[0046] Probe design:

[0047] The probe triggers a fluorescent reaction by specifically binding to the amplified product, thereby determining the result. For optimal results, the length of the MIRA detection probe should be between 46 and 52 nucleotides. Specifically, there should be at least 30 nucleotides from the 5' end of the probe to the tetrahydrofuran labeling site, and at least 15 nucleotides from the 3' end to the same labeling site. The probe should include a flanking dT-fluorophore, usually fluorescein, an abasic nucleotide analog - tetrahydrofuran [THF] residue, a dT-quencher, generally a black hole quencher [BHQ], and a 3'-modifying group to prevent further extension of the probe. In the probe design process, the key is to find two T nucleotide residues that are very close to each other (only 1 to 5 nucleotides apart). One of the T residues is replaced by a dT-fluorophore, the other is replaced by a dT-quencher, and any position between the two residues is replaced by a tetrahydrofuran [THF] residue. The probes are shown in the sequences SEQ ID NO.20 and SEQ ID NO.21 in Table 1.

[0048] Primer design:

[0049] Design multiple primers in the upstream and downstream regions of the probe, with lengths ranging from 30 to 36 bases. It is particularly important to avoid overlapping with the probe sequence in the opposite direction of the probe to prevent primer-dimer formation. Primers in the same direction as the probe can overlap with the 5' end of the probe, but the overlapping region must exclude the tetrahydrofuran (THF) site and the sequence following it. See Table 1 for primer sequences, SEQ ID NOs. 1 to 20.

[0050] Table 1 Primer and probe sequences

[0051]

[0052]

[0053] (3) Establishment of detection methods

[0054] Standard plasmid construction:

[0055] Primers were designed according to the target DNA sequence, and the target sequence was obtained by PCR amplification. The target sequence was ligated to the PUC57 vector and transformed into Escherichia coli competent cells for enrichment culture. Positive clones were picked for sequencing verification, and standard plasmids were obtained after plasmid extraction.

[0056] Standard plasmid target sequence:

[0057]

[0058] Primer probe screening:

[0059] First, a forward primer and probe MIRA-Fus-Pr1 were fixed and paired with 8 reverse primers (SEQ ID NO.12 to SEQ ID NO.19), respectively. Amplification reactions were performed according to the amplification system in Table 2. By analyzing the intensity, peak onset time, and peak shape of the fluorescence signal, MIRA-Fus-R4 was selected as the optimal reverse primer. Subsequently, this forward primer and probe MIRA-Fus-Pr1 were paired with 11 forward primers (SEQ ID NO.1 to SEQ ID NO.11), respectively. Amplification reactions were performed according to the amplification system in Table 2, and based on the same analysis criteria, MIRA-Fus-F9 was determined to be the optimal forward primer. Finally, the working performance of the two probes was compared, and MIRA-Fus-Pr1 was confirmed to be the optimal probe sequence. The results are shown in Table 2. Figure 1 、 2 、3.

[0060] The buffer solution in Table 2 was purchased from Amp Future, 24022901C; the freeze-dried enzyme powder was purchased from Amp Future, 24022901C; and the magnesium acetate solution was purchased from Amp Future, 24022901C.

[0061] Table 2 Amplification reaction system

[0062]

[0063] Example 2

[0064] Example 2 of the present invention detected the effect of different amplification temperatures on the amplification effect, and the specific method is as follows:

[0065] TE buffer was added to the plasmid prepared in step (3) of Example 1, and the concentration was 3.9×10 4According to the system in Table 2, 1 μL of standard plasmid solution, 2.3 μL of primer-probe mixture and 5 μL of ddH2O were added to 14.7 μL of buffer solution, mixed evenly and transferred to a 2.5 mg freeze-dried enzyme powder tube. After inverting several times until the enzyme powder was completely dissolved, 2 μL of magnesium acetate solution was added and mixed evenly. The tubes were placed in a constant temperature amplification fluorescence detector at 37°C, 38°C, 39°C, 40°C, 41°C and 42°C for amplification. The reaction time was set to 20 min. After the reaction, the optimal reaction temperature was determined to be 42°C based on the fluorescence signal, peak time and peak shape. The results are shown in the figure. Figure 4 .

[0066] Test Example 1

[0067] Test Example 1 of the present invention detects the specificity of the probe and primer in Example 1, and the specific method is as follows: Fusarium graminearum, F. asiaticum, F. pseudograminearum, F. culmorum, F. verticillioides, F. fujikuroi, F. proliferatum, F. equiseti, F. tricinctum, F. oxysporum, Acremonium sp, Acremonium alternatum, Aspergillus flavus, A. niger, A. versicolor, A. amstelodami, Alternaria alternata, Alternaria tenuissima), Talaromyces assiutensis, Chaetomium globosum, Penicillium aurantiogriseum, P. Chrysogenum, and P. aurantiogriseum. The reverse primer MIRA-Fus-R4, forward primer MIRA-Fus-F9, and probe MIRA-Fus-Pr1 of Example 1 were used to configure the reaction system for the above 23 strains according to the amplification reaction system shown in Table 2. The reaction time was set to 20 min and the reaction temperature was set to 42° C. MIRA detection was performed on the above strains. The results are as follows: Figure 5 shown.

[0068] Depend on Figure 4 It can be seen that only four strains of Fusarium graminearum, Fusarium asiatica, Fusarium pseudograminearum and Fusarium genus showed amplification curves (positive), while the other strains had no amplification curves (negative), confirming that this method has good detection specificity.

[0069] Test Example 2

[0070] Test Example 2 of the present invention tested the specificity of the probe and primers in Example 1, and the specific method was as follows:

[0071] (1) Plasmid detection sensitivity

[0072] The plasmid constructed in Example 1 was diluted in series, and 6 dilutions were selected. The amplification test was performed using the method of Experimental Example 1, and 3 replicates were performed for each dilution. The results are shown in FIG. Figure 6 The detection limit of the plasmid was 19.5 copies / μL.

[0073] (2) DNA detection sensitivity

[0074] The mixed DNA solution of Fusarium graminearum, Fusarium asiatica, Fusarium pseudograminearum and Fusarium luteum was diluted in a gradient manner, and amplification detection was performed using the method of Experimental Example 1. Each concentration was repeated 3 times. The results are as follows: Figure 7 The DNA detection limit was 15 fg / μL.

[0075] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. A primer-probe combination for rapid detection of DON-producing Fusarium based on MIRA, characterized in that: The primer-probe combination for rapid detection of DON-producing Fusarium based on MIRA consists of the following sequences: Forward primer MIRA-Fus-F9, SEQ ID NO.9: CTGTTGTGCCTCGATCCATCGCTCAGGCTTGAACT; Reverse primer MIRA-Fus-R4, SEQ ID NO.15: CAGTCCACCTATTTCATGCACACCGATCCCAAGA; Probe MIRA-Fus-Pr1, SEQ ID NO. 20: GTTGTGCCTCGATCCATCGCTCAGGCTTGAACT / FAM / Spacer / BHQ1 / CGGGCTCGGGGAAA / C3-Spacer; The front part of the probe MIRA-Fus-Pr1 sequence partially overlaps with the forward primer sequence, and the rear part of the probe sequence does not overlap with the reverse primer sequence. The probe MIRA-Fus-Pr1 has four modification sites: the 34th base is labeled with a fluorescent group, the 35th base is labeled with tetrahydrofuran, the 36th base is labeled with a quenching group, and the 3' end is modified with a blocking group. The gene sequence detected by the primer probe is shown in SEQ ID NO.22; The DON-producing Fusarium species include Fusarium graminearum, Fusarium asiatica, Fusarium pseudograminearum and Fusarium genus.

2. A DON-producing Fusarium detection kit, characterized in that The DON-producing Fusarium detection kit comprises the primer-probe combination for rapid detection of DON-producing Fusarium based on MIRA according to claim 1.

3. Use of the DON-producing Fusarium detection kit according to claim 2 in detecting DON-producing Fusarium.

4. The use of the DON-producing Fusarium detection kit according to claim 3 in detecting DON-producing Fusarium, characterized in that: The reaction system for detecting DON-producing Fusarium is based on 25 μL: Buffer solution 14.7 μL, 10 μM forward primer 1 μL, 10 μM reverse primer 1 μL, 10 μM probe 0.3 μL, lyophilized enzyme powder 2.5 mg, DNA solution 1-5 μL, 175 mM magnesium acetate solution 2 μL, and ddH2O to make up the volume to 25 μL.

5. Use of the DON-producing Fusarium detection kit according to claim 3 in detecting DON-producing Fusarium, characterized in that: The reaction temperature for detecting DON-producing Fusarium is 42° C., and the reaction time is 10 to 30 minutes.

Images