Fluorescent quantitative detection kit for tick-borne encephalitis virus and application

Abstract

The invention discloses a fluorescent quantitative detection kit for tick-borne encephalitis virus and application, and belongs to the field of biomedicine. The invention designs a primer group for detecting tick-borne encephalitis virus. The primer group comprises an upstream primer TBEV-F with a nucleotide sequence as shown in SEQ ID NO.1 and a downstream primer TBEV-R with a nucleotide sequence as shown in SEQ ID NO.2, and a fluorescent quantitative detection kit and a detection method are constructed according to the primer group. The fluorescent quantitative detection kit provided by the invention adopts an SYBR dye method, can quickly and efficiently judge whether a sample to be detected contains the tick-borne encephalitis virus or not, has high specificity and high sensitivity, is stable in repeatability, can be used for detecting, preventing and controlling the tick-borne encephalitis virus, and has a wide application prospect.

Description

Technical Field

[0001] The invention relates to the field of biomedicine, and in particular to a fluorescent quantitative detection kit for tick-borne encephalitis virus and an application thereof. Background Art

[0002] Tick-borne encephalitis (TBE), also known as forest encephalitis, is a natural epidemic disease mainly affecting the central nervous system caused by tick-borne encephalitis virus (TBEV). It is mostly caused by tick bites. According to statistics, about 1% of patients are caused by consuming unpasteurized milk or dairy products from infected animals. Ticks, as its transmission medium, are temporary parasites that live on the surface of many vertebrates. Most of them are distributed in forests, grasslands, animal dens, bird nests and livestock sheds. When ticks suck the blood of infected rodents such as gray mice, wild mice and hedgehogs, the virus will reproduce in the tick's body. When people are bitten by ticks carrying the virus, they are often infected and sick. Severe cases will die within a few hours due to coma, convulsions and medullary paralysis. TBEV is a highly virulent neurotropic virus in the genus Flavivirus, which mainly invades the human central nervous system. Clinically, it is characterized by sudden high fever, meningeal irritation, headache and vomiting, hyperesthesia, impaired consciousness, and paralysis of the neck and limbs, and often has sequelae. Workers working in forest areas are at high risk of TBE. There are no specific antiviral drugs, and doctors can only treat patients symptomatically. Therefore, early and rapid diagnosis of viral infection is extremely important for the treatment, rehabilitation, and prognosis of patients.

[0003] At present, the methods used to diagnose tick-borne encephalitis mainly include etiological diagnosis, blood / cerebrospinal fluid tests, and immunological diagnosis. Etiological diagnosis is mainly based on virus isolation, which is the most basic and reliable detection method, but it has high culture requirements, is easily contaminated by foreign pathogenic microorganisms, and has a long culture time. Since the early blood picture changes are not obvious and difficult to distinguish from other encephalitis, blood / cerebrospinal fluid tests cannot be used for diagnosis. Immunological diagnosis mainly includes complement fixation test (CFT), hemagglutination inhibition test (HLT), neutralization test, enzyme-linked immunosorbent assay (ELISA), etc. CFT and HLT can simultaneously detect serum titers to improve diagnostic efficiency, but the operation is complicated and easy to cause missed detection; neutralization test is difficult to operate and is generally only used for epidemiological surveys; the conventional laboratory detection method is to use ELISA to screen TBEV-specific IgM or IgG antibodies in serum and cerebrospinal fluid, which has good specificity and repeatability, but low diagnostic sensitivity, and is prone to "window period", thereby delaying the disease. Electroencephalogram examination is a non-destructive diagnostic method. Most of the time, it shows diffuse slow waves or scattered slow waves, but it can only serve as an auxiliary diagnosis.

[0004] Compared with the above methods, nucleic acid diagnosis of TBE is theoretically the best diagnostic method. It can not only effectively diagnose patients with tick-borne encephalitis, but also determine the infectious factors in the environment, including ticks and whether infected milk contains TBEV. Therefore, there is an urgent need to provide a fluorescent quantitative detection kit with high specificity and good sensitivity. Summary of the invention

[0005] The purpose of the present invention is to provide a fluorescent quantitative detection kit for tick-borne encephalitis virus and its application, so as to solve the problems existing in the above-mentioned prior art. The present invention designs a primer set for tick-borne encephalitis virus detection and constructs a detection kit with high sensitivity and high specificity.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The invention provides a primer set for detecting tick-borne encephalitis virus, comprising an upstream primer TBEV-F having a nucleotide sequence as shown in SEQ ID NO.1 and a downstream primer TBEV-R having a nucleotide sequence as shown in SEQ ID NO.2.

[0008] The invention provides application of the primer set in preparing a product for detecting tick-borne encephalitis virus.

[0009] Preferably, the product comprises a fluorescence quantitative detection kit.

[0010] The invention also provides a fluorescent quantitative detection kit for tick-borne encephalitis virus, comprising the primer set.

[0011] Preferably, the method further comprises an RNA extraction reagent, a reverse transcriptase and a SYBR Green I fluorescent quantitative PCR reaction premix.

[0012] More preferably, the RNA extraction reagent includes proteinase K and an RNA carrier; and the reverse transcriptase is Primescript RT enzyme Mix.

[0013] The present invention also provides the use of the primer set or the kit in the detection of tick-borne encephalitis virus for purposes other than disease diagnosis and / or treatment.

[0014] The present invention also provides a method for detecting tick-borne encephalitis virus for purposes other than disease diagnosis and / or treatment, comprising the step of using the kit to perform fluorescent quantitative RT-PCR reaction.

[0015] Preferably, the method comprises the following steps:

[0016] Extracting total RNA from samples to be tested;

[0017] Using the total RNA as a template, SYBR GreenⅠ fluorescent quantitative RT-PCR reaction was performed;

[0018] Whether the sample contains tick-borne encephalitis virus is determined according to the result of the SYBR GreenⅠ fluorescent quantitative RT-PCR reaction.

[0019] More preferably, the reaction procedure of the SYBR GreenⅠ fluorescent quantitative RT-PCR reaction is: reverse transcription at 42°C for 5 min; pre-denaturation at 95°C for 5 min; denaturation at 95°C for 5 s, annealing at 60°C for 30 s, 40 cycles; after amplification, a melting process at 95°C for 15 s, 60°C for 1 min, and 95°C for 15 s.

[0020] The present invention discloses the following technical effects:

[0021] The present invention provides a primer set and a fluorescence quantitative detection kit for detecting tick-borne encephalitis virus. The fluorescence quantitative detection kit provided by the present invention uses a SYBR dye method combined with a specific primer set, can quickly and efficiently determine whether a sample to be tested contains tick-borne encephalitis virus, has high specificity and high sensitivity, and has stable repeatability, can be used for the detection and prevention of tick-borne encephalitis virus, and has broad application prospects. DETAILED DESCRIPTION

[0022] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0023] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0024] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0025] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0026] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0027] Example 1

[0028] 1. Primer Design

[0029] The present invention selects the gene sequence of tick-borne encephalitis virus (sequence as shown in SEQ ID NO.3), and uses primer design software Primer 3plus (http: / / www.primer3plus.com / ) to design PCR upstream primer TBEV-F (sequence as shown in SEQ ID NO.1) and downstream primer TBEV-R (sequence as shown in SEQ ID NO.2).

[0030] Upstream primer TBEV-F: 5′-CAGGTGTCTTCACGGTGGCAGAGTT-3′ (SEQ ID NO. 1);

[0031] Downstream primer TBEV-R: 5'-TGTTCTGAGTACCCAGGTATCCTG-3' (SEQ ID NO. 2).

[0032] SEQ ID NO.3:

[0033] 5'-CAGGTGTCTTCACGGTGGCAGAGTTTTGGAGTTGGCCTGAGAACAAAAGTATTTT TGGACTTCAGACAGGAATCAACACACGAGTGTGACACAGGAGTGATGGGGGCTGCTGTCAAGAATGGCATGGCAGTCCACACAGACCAGAGCCTCTGGATGAAATCCGTGAGAAATGAAACAGGGACCTACATAGTGGAACTTCT GGTCACTGACCTGAGAAACTGCTCATGGCCGGCTAGCCACACCATCGACAATGCTGAGGTGGTGGACTCAGAGCTCTTCCTTCCGGCCAGTCTGGCGGGGCCCAGATCCTGGTATAACAGGATAACCTGGGTACTCAGAACA-3'.

[0034] 2. Detection Method

[0035] 2.1 Total RNA extraction

[0036] The total RNA of the sample to be tested was extracted using the TaKaRa MiniBEST Viral RNA / DNA Extraction Kit Ver.5.0. The specific steps are as follows:

[0037] Take the sample to be tested, add Buffer VGB, proteinase K and RNA carrier, and place in a water bath at 56℃ for 10 minutes; add 96% ethanol to the lysate, transfer the solution to the Spin Column, and centrifuge at 12000rpm for 2 minutes; discard the filtrate, add Buffer RWA, and centrifuge at 12000rpm for 1 minute; discard the filtrate, add Buffer RWB, and centrifuge at 12000rpm for 3 minutes; move the Spin Column to a 1.5mL nuclease-free collection tube, add nuclease-free water, let stand at room temperature for 5 minutes, and centrifuge at 12000rpm for 2 minutes to obtain the total RNA solution.

[0038] 2.2 Fluorescence quantitative RT-PCR detection

[0039] The reaction system of fluorescence quantitative RT-PCR included: 2 μL of total RNA solution, 1 μL of PrimeScript RT enzyme Mix, 10 μL of SYBR GreenⅠ fluorescence quantitative PCR reaction solution (2×ByFast SYBR Green qPCR Mix), 0.8 μL of upstream primer TBEV-F, 0.8 μL of downstream primer TBEV-R, ddH 2 O 5.4μL, total system 20μL.

[0040] The reaction procedure of fluorescent quantitative RT-PCR was as follows: reverse transcription at 42°C for 5 min; pre-denaturation at 95°C for 5 min; denaturation at 95°C for 5 s, annealing at 60°C for 30 s, and 40 cycles; after amplification, a melting process was performed at 95°C for 15 s, 60°C for 1 min, and 95°C for 15 s.

[0041] 3. Kit performance verification

[0042] 3.1 Preparation of Standards

[0043] In order to test the performance of the prepared fluorescence quantitative detection kit, a tick-borne encephalitis virus standard was prepared.

[0044] Using TBEV cDNA as a template, amplification was performed using the upstream primer TBEV-F-2: 5'-ACTCAATGATCTGGAGCGTCCCCGA-3' as shown in SEQ ID NO.4 and the downstream primer TBEV-R-2: 5'-AGTCTGTCCCCGTGCGGAACGTCACT-3' as shown in SEQ ID NO.5; the amplified fragment is shown in SEQ ID NO.6, with a size of 627 bp.

[0045] Reaction system: Ex-Taq Master Mix 0.2 μL, upstream primer TBEV-F-2 1 μL, downstream primer TBEV-R-2 1 μL, cDNA sample 1 μL, ddH 2 O 17.3μL, total system 25μL. The reaction procedure is: 94℃ pre-denaturation for 5min, 94℃ denaturation for 30s, 50℃ annealing for 30s, 72℃ extension for 30s, a total of 35 cycles, 72℃ extension for 5min, 20℃ insulation. The PCR product was detected by 1% agarose gel electrophoresis, the gel recovery product was connected with the pMD18-T vector, and transformed into DH5α competent cells, cultured at 37℃ for 12h on a culture plate containing ampicillin, picked a single colony, and after shaking the bacteria for 14h, the bacterial solution was PCR identified, 1% agarose gel electrophoresis was used for detection, a blank control was set up, and the results were observed. The plasmid was extracted, and the D value was determined by ultraviolet spectrophotometer. The copy number of the recombinant plasmid was calculated according to the copy number calculation formula, plasmid copy number = mass concentration (mg / L) × 6.023 × 10 14 / (number of bases × 660).

[0046] SEQ ID NO.6:

[0047] 5'-ACTCAATGATCTGGAGCGTCCCCGAGGCCCCCCGCCGGTTCATGGTGGGAACAG -3'.

[0048] 3.2 Sensitivity test

[0049] Using the above standard as a template, press 10 8 -10 1 The concentration gradient dilution was repeated 3 times for each gradient, and a negative control of nuclease-free water was set up. The fluorescence quantitative detection kit was used for detection. At the same time, the standard products with different concentration gradients were detected by conventional PCR. The amplified products were detected by 1% agarose gel electrophoresis, and a blank control was set up. The minimum copy number of the detected plasmid DNA was statistically analyzed, and the sensitivity of the two detection methods was compared.

[0050] 3.3 Repeatability test

[0051] Using the established fluorescent quantitative PCR detection kit and detection method, 10 8 -10 5The standard samples with the dilution concentration of copies / μL were used as the object of repeatability test, and each gradient was repeated 3 times. The coefficient of variation (CV) of the four concentrations of the standard samples was calculated according to the calculation formula based on the size of the Ct value to analyze the repeatability of the method.

[0052] Calculation formula: CV = (standard deviation / mean value) x 100%.

[0053] 3.4 Specificity detection

[0054] Lymphocytic choriomeningitis virus (LCMV), fever with thrombocytopenia syndrome virus (SFTSV) and TBEV strains are taken as objects of specific detection and detected using the fluorescent quantitative detection kit of the present invention.

[0055] 4. Experimental Results

[0056] 4.1 Sensitivity test results

[0057] The detection limit of the fluorescence quantitative kit prepared by the present invention is 10 1 Copies / μL, the lower limit of conventional PCR detection is 10 2 The sensitivity of fluorescence quantitative PCR is 10 times higher than that of conventional PCR, which indicates that the fluorescence quantitative detection kit of the present invention has better sensitivity.

[0058] Table 1 Sensitivity test results of fluorescence quantitative detection kit

[0059]

[0060]

[0061] 4.2 Repeatability test results

[0062] As shown in Table 2, after repeated testing, the coefficient of variation of the fluorescent quantitative detection kit prepared by the present invention is less than 2%, and the negative control has no specific amplification, indicating that the established fluorescent quantitative PCR method has good stability.

[0063] Table 2 Repeatability test results of fluorescence quantitative detection kit

[0064]

[0065] 4.3 Specificity test results

[0066] The fluorescent quantitative detection kit of the present invention was used to detect tick-borne viruses such as LCMV, SFTSV and TBEV, and it was found that only TBEV could produce specific amplification, while LCMV and SFTSV were not amplified, indicating that the established fluorescent quantitative PCR detection method has good specificity.

[0067] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A primer set for detecting tick-borne encephalitis virus, characterized in that: It includes an upstream primer TBEV-F with a nucleotide sequence as shown in SEQ ID NO.1 and a downstream primer TBEV-R with a nucleotide sequence as shown in SEQ ID NO.

2.

2. Use of the primer set as claimed in claim 1 in preparing a product for detecting tick-borne encephalitis virus.

3. The use according to claim 2, characterized in that The product includes a fluorescence quantitative detection kit.

4. A fluorescent quantitative detection kit for tick-borne encephalitis virus, characterized in that: Comprising the primer set of claim 1.

5. The kit according to claim 4, characterized in that It also includes RNA extraction reagent, reverse transcriptase and SYBRGreenⅠfluorescent quantitative PCR reaction premix.

6. The kit according to claim 5, characterized in that The RNA extraction reagent comprises proteinase K and an RNA carrier; and the reverse transcriptase is Prime script RT enzyme Mix.

7. Use of the primer set according to claim 1 or the kit according to any one of claims 4 to 6 in the detection of tick-borne encephalitis virus for purposes other than disease diagnosis and / or treatment.

8. A method for detecting tick-borne encephalitis virus for purposes other than disease diagnosis and / or treatment, characterized in that: The method comprises the step of using the kit described in any one of claims 4 to 6 to perform a fluorescent quantitative RT-PCR reaction.

9. The method according to claim 8, characterized in that The specific steps include: Extracting total RNA from samples to be tested; Using the total RNA as a template, a SYBR GreenⅠ fluorescent quantitative RT-PCR reaction was performed; Whether the sample contains tick-borne encephalitis virus is determined according to the result of the SYBR GreenⅠ fluorescent quantitative RT-PCR reaction.

10. The method according to claim 9, characterized in that The reaction procedure of the SYBR GreenⅠ fluorescent quantitative RT-PCR reaction is: reverse transcription at 42°C for 5 minutes; pre-denaturation at 95°C for 5 minutes; denaturation at 95°C for 5 seconds, annealing at 60°C for 30 seconds, and 40 cycles; after amplification, a melting process at 95°C for 15 seconds, 60°C for 1 minute, and 95°C for 15 seconds.

Images