Method for screening cool substances by using a TRPM8 stable cell strain and construction of a cell model thereof

Abstract

The application belongs to the technical field of genetic engineering, and particularly relates to a method for screening cool substances by using a TRPM8 stable cell strain and construction of a cell model thereof. TRPM8 The cell model comprises a vector, and the vector comprises TRPM8 a gene, and a nucleotide sequence of the gene is shown in SEQ ID No: 1. TRPM8 The application provides an application of the gene in cool substance evaluation. TRPM8 The application adopts the gene to construct a cell model, and then adopts a cool substance to treat the cell model, and finally detects a relative value of fluorescence intensity of the cell model to evaluate the cool substance.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of genetic engineering, and relates to an activating TRPM8 cooling substance of an ion channel, in particular to a method for screening a cooling substance by using a TRPM8 stable cell strain and construction of a cell model thereof. BACKGROUND

[0002] TRPM8 The present application belongs to the field of genetic engineering, and relates to an activating transient receptor potential, TRP cooling substance of an ion channel, in particular to a method for screening a cooling substance by using a TRPM8 stable cell strain and construction of a cell model thereof. TRPC, TRPM, TRPV, TRPA, TRPP and TRPM BACKGROUND TRP The present application belongs to the field of genetic engineering, and relates to an activating TRPM cooling substance of an ion channel, in particular to a method for screening a cooling substance by using a TRPM8 stable cell strain and construction of a cell model thereof. TRPM The present application belongs to the field of genetic engineering, and relates to an activating TRP cooling substance of an ion channel, in particular to a method for screening a cooling substance by using a TRPM8 stable cell strain and construction of a cell model thereof. TRPM1-8 The present application belongs to the field of genetic engineering, and relates to an activating TRPM8 cooling substance of an ion channel, in particular to a method for screening a cooling substance by using a TRPM8 stable cell strain and construction of a cell model thereof. TRPM8 The present application belongs to the field of genetic engineering, and relates to an activating TRPM8 cooling substance of an ion channel, in particular to a method for screening a cooling substance by using a TRPM8 stable cell strain and construction of a cell model thereof. TRPM8 The present application belongs to the field of genetic engineering, and relates to an activating TRPM8 cooling substance of an ion channel, in particular to a method for screening a cooling substance by using a TRPM8 stable cell strain and construction of a cell model thereof. The present application belongs to the field of genetic engineering, and relates to an activating

[0003] cooling substance of an ion channel, in particular to a method for screening a cooling substance by using a TRPM8 stable cell strain and construction of a cell model thereof. TRPM8 The present application belongs to the field of genetic engineering, and relates to an activating 2+ cooling substance of an ion channel, in particular to a method for screening a cooling substance by using a TRPM8 stable cell strain and construction of a cell model thereof.

[0004] The prior art CN108473484A discloses a compound that can be used as TRPM8 The compound is used as a modulator, and belongs to the technical field of coolants, which provides a variety of compounds that can be used as TRPM8 modulators, and the preparation of the compounds is provided, and the use of various modulators is classified. In particular, there are many coolants, but the specific cooling effect on the human body cannot be compared.

[0005] If only through sensory to determine whether a certain cooling agent can achieve good cooling effect, not only time-consuming, but also may have various effects on the human body. Therefore, it is very important to excavate a model for screening cool substances for the cooling experience of people. SUMMARY

[0006] In order to solve the above problems, the present application provides the following technical solutions:

[0007] The present application provides a kind of TRPM8 Gene in cool substance evaluation Application, the TRPM8 sequence number is NM_024080.5, nucleic acid sequence is as shown in SEQ ID No:1.

[0008] SEQ ID No:1:

[0009]

[0010] Specifically, the application adopts TRPM8 constructing a cell model, treating the cell model with a cooling substance, and detecting the relative value of fluorescence intensity of the cell model to evaluate the cooling substance.

[0011] Further, the evaluation includes screening or quality control.

[0012] In some embodiments, the cooling substance includes menthol or menthol nicotinate.

[0013] The present application provides a model for screening a cooling substance, which is a cell model, and the cell model includes a vector, and the vector includes TRPM8 a gene, and the nucleotide sequence of the gene is shown in SEQ ID No: 1. TRPM8

[0014] Further, the vector is a lentivirus vector, and the cell model is based on HEK293.

[0015] Further, the cell model can also be based on SH-SY5Y and HaCaT.

[0016] In another aspect, a method for constructing a cell model is provided, which includes TRPM8 constructing a recombinant plasmid containing a gene and stably transfecting a cell strain with the recombinant plasmid. TRPM8

[0017] Further, the recombinant plasmid is a lentivirus vector into which a gene fragment is inserted. TRPM8

[0018] The method includes the following steps:

[0019] (1) cloning a gene fragment from a human cDNA as a template; TRPM8

[0020] (2) inserting the cloned gene fragment into a lentivirus vector digested by two enzymes; XbaI EcoRI and pcSLenti-EF1- EGFP-P2A-Puro-CMV-MCS-3xFLAG-WPRE TRPM8

[0021] (3) transfecting the lentivirus vector into cells to construct a stably transfected cell strain.

[0022] Further, in the step (1), the primers for cloning the gene fragment are as follows: pcSLenti-EF1-EGFP-

[0023] CMV-F: CGCAAATGGGCGGTAGGCGTG; ​​​​​​​​

[0024] WPRE-R: CATAGCGTAAAAGGAGCAACA.

[0025] Further, in the step (2), the lentiviral vector is derived from a virus of interest P2A-Puro-CMV- TRPM8-3xFLAG-WPRE XbaI and the H37273 is constructed using restriction endonucleases EcoRI and TRPM8 The vector is digested, and the product is recovered using a gel recovery kit.

[0026] Further, in the step (2), the lentiviral vector is labeled with EGFP and Flag.

[0027] Further, in the step (2), the cloned TRPM8 gene fragment is connected to the digested vector using T4 ligase.

[0028] In another aspect, the cell model is applied in the evaluation of cooling substances.

[0029] In another aspect, a method for evaluating cooling substances is provided, which is achieved by detecting the relative value of the fluorescence intensity of the cell model. Further, the fluorescence intensity reflects the ion influx of calcium labeled by the fluorescent probe.

[0030] Further, the calcium ion fluorescent probe includes but is not limited to Rhod-2 reagent.

[0031] In summary, the present application successfully constructs a cell model for screening cooling substances. TRPM8 In summary, the present application successfully constructs a cell model for screening cooling substances.

[0032] The beneficial effects of the present application include:

[0033] The present application provides a cell stably overexpressing a gene, which can be long-term cryopreserved and recovered, maintains a high expression state, and is beneficial for the screening of cooling substances. pcSLenti-EF1-EGFP-P2A-Puro-CMV-MCS-3xFLAG- The constructed vector WPRE TRPM8 At the same time, the vector is labeled with EGFP and Flag, which is beneficial for the observation and screening of the stably transfected cell. Figure 1 The virus can also infect SH-SY5Y and HaCaT cells, which meets the toxicity screening of cells of different sources. Ultimately, the screening of cooling substances can be realized and objective relative values can be given. BRIEF DESCRIPTION OF DRAWINGS

[0034] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed to be used in the embodiments or prior art description will be briefly introduced as follows.

[0035] pcSLenti-EF1-EGFP-P2A-Puro-CMV-MCS-3xFLAG-WPRE ToFigure 2 Plasmid map;

[0036] Figure 3 Recombinant plasmid map;

[0037] Figure 4 Fluorescence screening results of stable cell strain

[0038] TRPM8 WB detection TRPM8 Expression results of stable cell strain. DETAILED DESCRIPTION

[0039] The application will be described in further detail below with reference to the embodiments and drawings, but the embodiments of the application are not limited thereto.

[0040] Experimental reagents and instruments:

[0041]

[0042] The application will be described in further detail below with reference to the embodiments and drawings, but the embodiments of the application are not limited thereto.

[0043] Example 1 Construction of cell model for evaluating cool-feeling substances

[0044] 1. TRPM8 Construction of recombinant plasmid of gene

[0045] (1) NCBI database search TRPM8 Gene sequence (NM_024080.5), primer 5.0 software design TRPM8 Primer of gene CDS sequence, primer contains enzyme digestion site sequence. Human cDNA as template for T cloning of gene fragment. PCR primer sequence is as follows: XbaI

[0046] Upstream primer: CAGCACTGGCACCTGAAAAC;

[0047] Downstream primer: GGACTGCGCGATGTAGATGA.

[0048] PCR reaction system is as follows:

[0049] Table 1 PCR reaction system

[0050]

[0051] PCR reaction program conditions are as follows:

[0052] Table 2 PCR reaction program conditions

[0053]

[0054] ​The PCR amplification products were subjected to agarose gel electrophoresis, and the PCR products were recovered using a gel extraction kit to obtain... EcoRI and XbaI TRPM8 gene fragment with double restriction sites.

[0055] (2) EcoRI and pcSLenti-EF1-EGFP-P2A-Puro-CMV-MCS- Double enzyme digestion of lentiviral vector 3xFLAG-WPRE TRPM8 The enzyme was digested at 37°C for 2 hours, and the digestion product was recovered using a kit.

[0056] The enzyme digestion system is as follows:

[0057] Table 3 Enzyme digestion system

[0058]

[0059] (3) Ligation using T4 ligase TRPM8 The gene fragment and enzyme digestion vector were ligated, and competent cells were added to the ligation product. Sequencing of the recombinant lentiviral plasmid confirmed that the sequence was completely correct.

[0060] (4) Pre-culture HEK293 cells in DMEM complete medium, controlling the cell density at 70-80% during transfection. Seed the cells into cell culture dishes, remove the original cell culture medium, and add 10 mL of Opti-MEM™ I serum-reduced medium (purchased from Gibco, catalog number 31985070). Place the cells back into the incubator. Add the transfection reagent dilution to the plasmid dilution, mix well, and incubate at room temperature for 20 min to allow the DNA and transfection reagent to fully bind and form a stable transfection complex. Add the prepared transfection complex to the cell culture plate and incubate in the incubator. 48 hours after transfection, harvest the virus for the first time, collecting the culture medium into 50 mL centrifuge tubes. 72 hours after transfection, harvest the virus for the second time, adding 80 μL-120 μL of DPBS to each tube according to the amount of precipitate. Seal the tube opening with sealing film and dissolve the precipitate overnight at 4°C. Collect the same virus in one tube at a time until the last tube is filled. Then collect the virus twice more with 100 μL DPBS. Collect all the virus into 1.5 mL EP tubes, aliquot the virus as required, and store at -80°C.

[0061] (5) Take TRPM8 stable cell lines with good growth status, extract genomic DNA from the cells, and perform real-time PCR to determine the titer. Quantification was performed on an ABI 7500, and the SYBR Master Mixture was obtained from TAKARA. In this study, a pair of specific primers and housekeeping gene primers were designed and synthesized, and their sequences are shown below.

[0062] Table 4 Primer Sequences

[0063]

[0064] Table 5 PCR Procedure

[0065]

[0066] Following the above procedure, the results showed that the average viral titer was 3.74*10⁻⁶. 7 mL.

[0067] (6) TRPM8 Screening of stable transfected cells. HEK293 cells were infected for 72 hours, then puromycin was added to a final concentration of 2 μg / mL. The culture medium was changed to a fresh puromycin concentration of 2 μg / mL every 2-3 days. After drug screening, fluorescence images were taken, and the results showed… Figure 4 The stable conversion efficiency was 80%. Alternatively, membrane proteins could be extracted using the Beyotime Membrane Protein Extraction Kit, and the expression level of membrane proteins could be verified using Western blot antibodies (Flag, primary antibody dilution 1:1000; Goat Anti-mouse IgG, secondary antibody dilution 1:5000, overnight incubation). Sample loading details are shown in Table 6. TRPM8 The results showed that TRPM8 protein was detected in the HEK293-H37273 sample.

[0068] Table 6 Sample addition details for WB experiments

[0069]

[0070] Example 2 TRPM8 Stable cell lines (cell models) are used for screening cooling substances.

[0071] This embodiment uses the cell model constructed in Example 1 to screen for cooling substances. The cell model described below stably expresses these substances. TRPM8 HEK293 cells. As a specific example, menthol and menthol nicotinate were used as evaluation subjects in this embodiment.

[0072] The cell model was cultured in 96-well plates using DMEM liquid medium containing 2 µg / mL puromycin, with each well containing 10 cells. 4The cells in each well were divided into zero setting group, negative group, menthol group (1 mM), and menthol nicotinate group (0.1%) according to the same cell model and the same volume of medium in each well. The negative group was added with only the medium; the zero setting group was free of cells (equivalent to a blank control). The menthol group and the menthol nicotinate group were treated with the corresponding cooling substances for 30 min, and then the medium was discarded, the cells were washed with HBSS (free of calcium and magnesium ions) for three times, 30 μL of calcium ion fluorescent probe Rhod-2 reagent was added, and the cells were incubated at room temperature (37 °C) for 30 min before the fluorescence intensity was detected, the excitation light was 549 nm, and the emission light was 578 nm. The results are shown below:

[0073] Table 7: Fluorescence intensities of different groups

[0074]

[0075] In Table 7, the relative fluorescence intensity refers to the relative negative group (i.e., the cells not treated with the cooling substances). The above results show that the cell model constructed in the application can be used to evaluate the cooling effect of the cooling substances.

[0076] Example 3

[0077] Referring to Example 2, the difference lies in that the amount of the fluorescent reagent Rhod-2 added is 25 μL;

[0078] The final concentrations of menthol and menthol nicotinate are 1 mM and 0.1%, respectively;

[0079] The detection results are as follows:

[0080] Table 8: Fluorescence intensities of different groups

[0081]

[0082] The results in Table 8 show that the cooling effect of menthol and menthol nicotinate is affected after the amount of the fluorescent reagent Rhod-2 added is reduced.

[0083] Example 4

[0084] Referring to Example 2, the difference lies in that the cooling substances are WS-3 and WS-5, which are known cooling substances on the market, and the final concentrations of WS-3 and WS-5 added are 3.7 μM and 4.3 μM, respectively. The detection results are as follows:

[0085] Table 9: Fluorescence intensities of different groups

[0086]

[0087] The results in Table 9 show that under the negative group control, the cooling effect of WS-3 is better than that of WS-5, which is consistent with the fact that WS-3 is better than WS-5 in terms of cooling.

[0088] Comparative Example 1

[0089] The experiment was carried out by replacing the calcium ion fluorescent probe Rhod-2 in Example 2 with Fluo3, and the results were counted.

[0090] Table 10 Fluorescent intensity of different groups

[0091]

[0092] Comparative Example 2

[0093] Referring to Example 2, the final concentration of menthol was adjusted to 3 mM.

[0094] Table 11 Fluorescent intensity of different groups

[0095]

[0096] Comparative Example 3:

[0097] Referring to Example 2, the incubation time of the fluorescent probe was adjusted to 40 min.

[0098] Table 12 Fluorescent intensity of different groups

[0099]

[0100] The results of Table 10, Table 11 and Table 12 show that replacing the fluorescent probe, adjusting the concentration of menthol and adjusting the incubation time of the fluorescent probe do not have as good a technical effect as that of Example 2 of the present application.

[0101] Finally, it should be noted that the above content is only used to illustrate the technical solutions of the present application, and is not a limitation on the protection scope of the present application. Simple modifications or equivalent replacements of the technical solutions of the present application made by those skilled in the art do not deviate from the essence and scope of the technical solutions of the present application.

Claims

1. TRPM8 The application of genes in the evaluation of cooling substances is characterized by, The aforementioned TRPM8 The nucleotide sequence of the gene is as shown in SEQ ID No: 1, and the application is as follows: using TRPM8 Gene-constructed cell models were used, and the relative values ​​of fluorescence intensity in the cell models were measured after treating them with cooling substances to evaluate the cooling substances. The process included the following steps: The cell model was cultured in liquid culture medium, treated with a cooling substance for 30 min, the culture medium was discarded, and after washing, 30 μL of calcium ion fluorescent probe Rhod-2 reagent was added. After incubation at 37℃ for 30 min, the fluorescence intensity was detected. The cooling substance includes menthol or menthol nicotinate, with final concentrations of 1 mM and 0.1%, respectively.

2. The application according to claim 1, characterized in that, The evaluation includes screening or quality control.

3. The application according to claim 1, wherein the cell model includes a vector, and the vector comprises... TRPM8 Genes, as described TRPM8 The nucleotide sequence of the gene is shown in SEQ ID No:

1.

4. The application according to claim 3, characterized in that, The vector is a lentiviral vector, and the cell model is based on HEK293.

5. The application according to claim 1, characterized in that, The fluorescence intensity reflects the ion influx of calcium labeled by the fluorescent probe.

Images