Application of SIRT2 protein in delaying body heart senescence through STAT3-CDKN2B signal channel

Abstract

The invention discloses an application of SIRT2 protein in delaying heart senescence of an organism through an STAT3-CDKN2B (Signal Transducer and Activator of Transcription 3-CDKN2B) signal channel. Through deep exploration of the mechanism, the SIRT2 protein can regulate and control the acetylation level of the STAT3 protein and further regulate and control the downstream target gene CDKN2B so as to regulate and control aging of myocardial cells. The invention also finds that the aging of myocardial cells can be delayed by inhibiting CDKN2B or supplementing SIRT2. Rich resources are provided for studying senescence and tissue, cell and molecular changes of young hearts under multiple omics levels, and the important effects of the key regulatory factor SIRT2 in regulating senescence of non-human primate hearts and human myocardial cells and improving heart senescence of mice through an STAT3-CDKN2B signal channel are disclosed.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and specifically relates to the application of SIRT2 protein in delaying heart aging via a STAT3-CDKN2B signaling pathway. Background Art

[0002] Aging is the primary risk factor for cardiovascular disease, which can lead to a decline in the structure and function of the heart, such as cardiac hypertrophy, fibrillation, and diastolic dysfunction. These are often accompanied by an increase in the prevalence of angina pectoris, acute coronary syndrome, heart failure, etc., which in turn damages the health and life span of life. As the global elderly population continues to grow, further exploring the key molecular mechanisms of heart aging and developing new prevention and treatment strategies will help us better cope with the challenges brought by heart aging and cardiovascular diseases caused by aging.

[0003] Cardiac aging can be triggered by a variety of intrinsic and / or extrinsic stimuli, such as chronic inflammation, oxidative stress, telomere damage, epigenetic changes, and proteomic disorders. Previous studies have been mainly based on rodent models, and they have identified a series of molecular mechanisms involved in cardiac aging or related phenotypes, such as mTOR, AMPK, and PPARα / PGC-1α signaling pathways. However, due to the high complexity and dynamics of cardiac aging, more comprehensive and systematic research is urgently needed. At present, high-throughput multi-omics (such as genomics, transcriptomics, and proteomics) technologies have been developed, but there are few reports on the study of primate cardiac aging through multidimensional methods, especially the potential molecular mechanisms of aging are still under development. Therefore, using proteomics and transcriptomics technologies to study the proteome and transcriptome profiles of the aged heart is of great significance for analyzing the important biological events of cardiac aging and further exploring the related molecular mechanisms.

[0004] Due to ethical restrictions, it is difficult to obtain disease-free and age-matched cardiac biopsy tissue from healthy individuals. Nonhuman primates (NHPs) are very similar to humans in terms of cardiac structure, electrophysiology, and pharmacokinetics. In addition, nonhuman primates live longer than other model animals, which is partly why nonhuman primates suffer from spontaneous cardiovascular diseases similar to humans. Therefore, nonhuman primates are an ideal model for studying cardiac aging and diseases related to cardiac aging, and are also a valuable physiologically relevant model for conducting preclinical research and drug development on cardiac aging or related diseases. Summary of the invention

[0005] The technical problem to be solved by the present invention is how to delay aging.

[0006] In a first aspect, the present invention protects a new use of a substance for regulating the SIRT2-STAT3-CDKN2B signaling pathway.

[0007] The present invention protects the use of a substance for regulating the SIRT2-STAT3-CDKN2B signaling pathway in any of the following A1)-A4):

[0008] A1) Delaying the aging of the body, organs, tissues or cells;

[0009] A2) Preparation of products that delay aging of the body, organs, tissues or cells;

[0010] A3) Improve the functional disorders of the aging body, organs, tissues or cells;

[0011] A4) Preparation of products for improving dysfunction of aging organisms, organs, tissues or cells;

[0012] The substance regulating the SIRT2-STAT3-CDKN2B signaling pathway includes substance R and / or substance S and / or substance T;

[0013] The substance R is SIRT2 protein or a substance that increases the activity and / or content of SIRT2 protein;

[0014] The substance S is a substance that reduces the acetylation level of STAT3 protein;

[0015] The substance T is a substance that reduces the activity and / or content of CDKN2B protein.

[0016] In a second aspect, the present invention protects a product, the function of which is any one of the following B1) or B2):

[0017] B1) Delaying the aging of the body, organs, tissues or cells;

[0018] B2) Improve the functional disorders of the aging body, organs, tissues or cells;

[0019] The active ingredient of the product is a substance that regulates the SIRT2-STAT3-CDKN2B signaling pathway.

[0020] The substance regulating the SIRT2-STAT3-CDKN2B signaling pathway includes substance R and / or substance S and / or substance T;

[0021] The substance R is SIRT2 protein or a substance that increases the activity and / or content of SIRT2 protein;

[0022] The substance S is a substance that reduces the acetylation level of STAT3 protein;

[0023] The substance T is a substance that reduces the activity and / or content of CDKN2B protein.

[0024] In any of the above-mentioned applications or products, the substance that increases the activity and / or content of SIRT2 protein may be a nucleic acid molecule encoding SIRT2 protein or an expression cassette, recombinant vector, recombinant microorganism, or recombinant cell line containing the nucleic acid molecule.

[0025] The substance that reduces the activity of CDKN2B protein can be a protein, polypeptide or small molecule compound that inhibits the function of CDKN2B protein.

[0026] The substance that reduces the content of CDKN2B protein can be a substance that inhibits CDKN2B protein synthesis or promotes CDKN2B protein degradation or knocks down or knocks out the CDKN2B protein encoding gene.

[0027] Furthermore, the recombinant microorganism may be a recombinant virus, and the recombinant virus may be a recombinant lentivirus or a recombinant retrovirus.

[0028] The substance for knocking down the gene encoding the CDKN2B protein may be siRNA or shRNA that inhibits the expression of the CDKN2B gene.

[0029] The substance for knocking out the CDKN2B protein encoding gene may be a CDKN2B gene editing system; the CDKN2B gene editing system includes a Cas9 nuclease and an sgRNA targeting the CDKN2B gene.

[0030] Furthermore, the substance that increases the activity and / or content of SIRT2 protein is a recombinant lentiviral vector containing a nucleic acid molecule encoding SIRT2 protein or a lentivirus expressing SIRT2. Specifically, the recombinant lentiviral vector is a vector obtained by connecting mouse SIRT2 cDNA to a pLE4 vector. The lentivirus expressing SIRT2 is obtained by transfecting the recombinant lentiviral vector into lentiviral packaging cells and then culturing the cells.

[0031] The substance for knocking out the CDKN2B protein encoding gene may specifically be a sgCDKN2B vector.

[0032] In a third aspect, the present invention protects new uses of a substance for detecting SIRT2 expression levels and / or a substance for detecting STAT3 protein acetylation levels and / or a substance for detecting CDKN2B expression levels.

[0033] The present invention provides a method for detecting the expression level of SIRT2 and / or the acetylation level of STAT3 protein and / or the CDKN2B expression level in any one of the following C1) or C2):

[0034] C1) Identifying or assisting in identifying the level of aging of an organism, organ, tissue or cell;

[0035] C2) Prepare products for identifying or assisting in identifying the level of aging of an organism, organ, tissue or cell.

[0036] In a fourth aspect, the present invention protects a product for identifying or assisting in identifying the level of aging of an organism, organ, tissue or cell; the product includes a substance for detecting the expression level of SIRT2 and / or a substance for detecting the acetylation level of STAT3 protein and / or a substance for detecting the expression level of CDKN2B.

[0037] In a fifth aspect, the present invention protects a new use of a substance that regulates the SIRT2-STAT3-CDKN2B signaling pathway;

[0038] The present invention protects the use of a substance for regulating the SIRT2-STAT3-CDKN2B signaling pathway in any of the following D1)-D6):

[0039] D1) Construction of senescent cells;

[0040] D2) preparing products of constructed cells;

[0041] D3) Screening or assisting in the screening of drugs that delay aging;

[0042] D4) preparing products for screening or assisting in screening of drugs for delaying aging;

[0043] D5) Research or assist in researching the aging mechanism of organisms, organs, tissues or cells;

[0044] D6) Preparation of products for studying or assisting in studying the aging mechanism of the body, organs, tissues or cells;

[0045] The substance regulating the SIRT2-STAT3-CDKN2B signaling pathway includes substance X and / or substance Y and / or substance Z;

[0046] The substance X is a substance that reduces the activity and / or content of SIRT2 protein;

[0047] The substance Y is a substance that increases the acetylation level of STAT3 protein;

[0048] The substance Z is CDKN2B protein or a substance that increases the activity and / or content of CDKN2B protein.

[0049] In a sixth aspect, the present invention protects a product, the function of which is any one of the following E1)-E3):

[0050] E1) Construction of senescent cells;

[0051] E2) Screening or assisting in the screening of drugs that delay aging;

[0052] E3) Research or assist in researching the aging mechanism of the body, organs, tissues or cells;

[0053] The active ingredient of the product is a substance that regulates the SIRT2-STAT3-CDKN2B signaling pathway;

[0054] The substance regulating the SIRT2-STAT3-CDKN2B signaling pathway includes substance X and / or substance Y and / or substance Z;

[0055] The substance X is a substance that reduces the activity and / or content of SIRT2 protein;

[0056] The substance Y is a substance that increases the acetylation level of STAT3 protein;

[0057] The substance Z is CDKN2B protein or a substance that increases the activity and / or content of CDKN2B protein.

[0058] In any of the above-mentioned applications or products, the substance that reduces the activity of SIRT2 protein may be a protein, polypeptide or small molecule compound that inhibits the function of SIRT2 protein.

[0059] The substance that reduces the content of SIRT2 protein may be a substance that inhibits SIRT2 protein synthesis or promotes SIRT2 protein degradation or knocks down or knocks out the SIRT2 gene.

[0060] The substance that increases the activity and / or content of CDKN2B protein can be a nucleic acid molecule encoding CDKN2B protein or an expression cassette, a recombinant vector, a recombinant microorganism, or a recombinant cell line containing the nucleic acid molecule.

[0061] Furthermore, the substance for knocking down the gene encoding SIRT2 protein may be siRNA or shRNA that inhibits the expression of SIRT2 gene.

[0062] The substance for knocking out the SIRT2 protein encoding gene may be a SIRT2 gene editing system; the SIRT2 gene editing system includes a Cas9 nuclease and an sgRNA targeting the SIRT2 gene.

[0063] Furthermore, the RNA sequence of the shRNA that inhibits SIRT2 gene expression is: CAGCGCGTTTCTTCTCCTGTA (sequence 1).

[0064] The target sequence of the sgRNA targeting the SIRT2 gene is specifically: GCGTTCGCTCTGCATGTACC (sequence 2).

[0065] In the seventh aspect, the present invention protects any one of the following methods F1)-F7):

[0066] F1) A method for delaying aging of an organism, organ, tissue or cell, comprising the step of contacting the substance for regulating the SIRT2-STAT3-CDKN2B signaling pathway described in the above "first aspect" with the organism, organ, tissue or cell;

[0067] F2) A method for improving dysfunction of an aging body, organ, tissue or cell, comprising the step of contacting the substance regulating the SIRT2-STAT3-CDKN2B signaling pathway described in the above "first aspect" with the aging body, organ, tissue or cell;

[0068] F3) A method for identifying or assisting in identifying the level of aging of an organism, organ, tissue or cell, comprising the step of detecting the expression level of SIRT2 and / or the acetylation level of STAT3 protein and / or the expression level of CDKN2B in a sample from the subject;

[0069] F4) A method for constructing senescent cells, comprising the step of introducing the substance regulating the SIRT2-STAT3-CDKN2B signaling pathway described in the above "fifth aspect" into a recipient cell;

[0070] F5) A method for screening or assisting in screening a drug for delaying aging, comprising the step of screening a drug for delaying aging using senescent cells constructed by the method described in F4);

[0071] F6) A method for studying or assisting in studying the aging mechanism of an organism, organ, tissue or cell, comprising the step of using senescent cells constructed by the method described in F4) to study the aging mechanism of an organism, organ, tissue or cell;

[0072] F7) A method for changing the aging state of in vitro cells, comprising the step of introducing the substance regulating the SIRT2-STAT3-CDKN2B signaling pathway described in the above "first aspect" or "fifth aspect" into recipient cells.

[0073] In the above F3), the SIRT2 expression level may be the SIRT2 protein expression level or the SIRT2 mRNA expression level.

[0074] The substance for detecting the expression level of SIRT2 may be a substance for detecting the expression level of SIRT2 by immunofluorescence tissue staining, plasma ELISA, (single cell) transcriptomics, plasma proteomics or a combination thereof.

[0075] The CDKN2B expression level may be the CDKN2B protein expression level or the CDKN2B mRNA expression level. The substance for detecting the CDKN2B expression level may be a substance for detecting the CDKN2B expression level by immunofluorescence tissue staining, plasma ELISA, (single cell) transcriptomics, plasma proteomics or a combination thereof.

[0076] The STAT3 protein acetylation level may be the acetylation level of the lysine residue at position 685 of the STAT3 protein. The substance for detecting the acetylation level of the STAT3 protein may be a substance for detecting the acetylation modification level of the lysine residue at position 685 of the STAT3 protein by Western blotting technology.

[0077] The method may specifically include the following steps: determining the SIRT2 expression level and / or the STAT3 protein acetylation level and / or the CDKN2B expression level in the sample from the subject; comparing the SIRT2 expression level and / or the STAT3 protein acetylation level and / or the CDKN2B expression level with a reference value; identifying or assisting in identifying the aging level of the subject.

[0078] Preferably, the sample is selected from a tissue or blood sample, such as whole blood, serum or plasma.

[0079] Preferably, the reference value is the SIRT2 expression level (or average expression level) or STAT3 protein acetylation level (or average acetylation level) or CDKN2B expression level (or average expression level) in the same type of sample from young, healthy individuals (or groups) with normal cardiac function.

[0080] Preferably, the aging level includes normal aging, accelerated aging and / or delayed aging.

[0081] Preferably, when the SIRT2 expression level in the sample from the subject is lower than the reference value and / or the STAT3 protein acetylation level is higher than the reference value and / or the CDKN2B expression level is higher than the reference value, it indicates that the subject is in an aging state. The subject in an aging state is specifically manifested at the tissue level in: an increase in the cross-sectional area of ​​cardiomyocytes in cardiac tissue; disorder of sarcomeres in cardiac tissue (Z-disc bending and sarcomere lengthening); an increase in the expression of BNP, a marker of myocardial hypertrophy, in cardiac tissue; an increase in the proportion of SA-β-gal positive cells in cardiac tissue; an increase in fibrosis in cardiac tissue; an upregulation of the expression level of p21, a marker of aging, in cardiac tissue; an increase in the transcription level of inflammatory factor IL-8 in cardiac tissue; an increase in protein aggregates (aggresomes) in cardiac tissue; an increase in the proportion of IL-1β and / or TNFα and / or S100A8 and / or S100A9 in cardiac tissue.

[0082] The increase in the proportion of SA-β-gal positive cells in the cardiac tissue refers to an increase in the SA-β-gal staining positive area and / or the proportion of SA-β-gal staining positive cells in the cardiac tissue.

[0083] The cross-sectional area of ​​myocardial cells in the heart tissue is the cross-sectional area of ​​myocardial cells evaluated by HE staining and / or WGA / cTnT staining.

[0084] Fibrosis in the heart tissue was reflected by the positive area in Masson's staining.

[0085] The expression level of the aging marker p21 in the heart tissue is reflected by the expression level of p21 protein detected by Western blotting and / or the proportion of p21 positive cells in IHC staining.

[0086] The protein aggregates in the cardiac tissue are reflected by the fluorescence intensity of aggresome stained by IF.

[0087] The IL-1β and / or TNFα in the heart tissue is reflected by the positive area of ​​IL-1β and / or TNFα in IHC staining.

[0088] The S100A8 and / or S100A9 in the heart tissue is reflected by the proportion of S100A8 and / or S100A9 positive cells in IHC staining.

[0089] In the above F4), the recipient cells are cardiomyocytes differentiated from human embryonic stem cells and / or human induced pluripotent stem cells.

[0090] The phenotype of the senescent cells is manifested as at least one of the following: an increase in the cross-sectional area of ​​cardiomyocytes; a disordered sarcomere (bending of the Z-disc and elongation of the sarcomere); an increase in the expression of the myocardial hypertrophy marker BNP; an increase in the proportion of SA-β-gal positive cells; an up-regulation of the expression level of the senescence marker p21; an increase in the level of the inflammatory factor IL-8; an increase in the number of mitochondria; an increase in the mass of mitochondria; a decrease in mitochondrial respiratory function; an increase in the amplitude of intracellular calcium ions; and a decrease in calcium ion events.

[0091] The inflammatory factor IL-8 level is the transcriptional expression level of IL-8 detected by RT-qPCR method and / or the secretion level of IL-8 protein in the cell culture supernatant detected by enzyme-linked immunosorbent assay (ELISA) method.

[0092] The number of mitochondria is the number of mitochondria detected by electron microscopy;

[0093] The mitochondrial quality is assessed by staining the cells with nonylacridine orange (NAO) and detecting the fluorescence intensity of NAO using a flow cytometry method.

[0094] The mitochondrial respiratory function is detected by using a seahorse energy metabolism analyzer to detect the basal oxygen consumption, maximum oxygen consumption, and oxygen consumption rate (OCR) of ATP generation in cells.

[0095] The intracellular calcium ion amplitude or the calcium ion event is to detect the calcium transient of the cell using a laser confocal microscope to analyze the calcium ion amplitude ((F-F0) / F0) and / or the calcium ion events occurring within the same time (20s).

[0096] In the above F6), the aging mechanism may be a mechanism whereby knockout or knockdown of SIRT2 promotes aging, or overexpression of SIRT2 delays aging, or overexpression of CDKN2B promotes aging, or knockout or knockdown of CDKN2B delays aging.

[0097] In any of the above-mentioned applications, products or methods, the improvement of dysfunction of an aging body, organ, tissue or cell is improvement of aging heart dysfunction (or functional decline).

[0098] The improvement of aging heart dysfunction (or functional decline) is manifested in increasing the ejection fraction (EF) and short axis shortening rate (FS) of the heart tissue of old mice and / or reducing the size of heart tissue cells of old mice (or improving myocardial hypertrophy of old mice). Specifically, the ejection fraction (EF) and short axis shortening rate (FS) of old mice can be significantly improved after intramyocardial injection of lentivirus overexpressing SIRT2 into the heart of old mice compared with the control group; the size of myocardial tissue cells can be significantly reduced after intramyocardial injection of lentivirus overexpressing SIRT2 into the heart of old mice.

[0099] In one embodiment of the present invention, the SIRT2 protein interacts with the STAT3 protein, which is specifically verified by an exogenous Co-IP experiment overexpressing SIRT2 protein or overexpressing STAT3 protein in HEK293T cells or an endogenous Co-IP experiment using SIRT2 antibody or STAT3 antibody in wild-type cardiomyocytes.

[0100] In one embodiment of the present invention, the SIRT2 protein can deacetylate the STAT3 protein at the K685 site, which is specifically manifested as: when STAT3 and SIRT2 proteins are overexpressed in HEK293T cells, the acetylation level of the STAT3 protein is reduced; when STAT3 protein and SIRT2-H187Y mutant protein are overexpressed in HEK293T cells, the acetylation level of the STAT3 protein remains unchanged; when STAT3-K685R mutant protein and SIRT2 protein are overexpressed in HEK293T cells, the acetylation level of the STAT3 protein remains unchanged compared with the Flag-Luc control group.

[0101] In one embodiment of the present invention, the SIRT2-STAT3-CDKN2B signaling pathway changes after the SIRT2 protein is knocked out or knocked down in cardiomyocytes differentiated from human embryonic stem cells or pluripotent stem cells, which is specifically manifested in that: after the SIRT2 protein is knocked out and / or knocked down in the cells, the total STAT3 protein level of the cells remains unchanged; the protein level of acetylated STAT3 and / or acetylated STAT3 (K685) is significantly increased; and the transcription level and / or protein level of CDKN2B is significantly upregulated.

[0102] In one embodiment of the present invention, the changes in the SIRT2-STAT3-CDKN2B signaling pathway after knocking out or knocking down SIRT2 protein in cardiomyocytes differentiated from human embryonic stem cells or pluripotent stem cells do not have gender differences, which is specifically manifested as follows: in cardiomyocytes differentiated from female human embryonic stem cells (female hESCs) and / or male human embryonic stem cells (male hESCs) and / or male human induced pluripotent stem cells (male iPSCs), after knocking out or knocking down SIRT2 protein, the protein levels of acetylated STAT3 and / or acetylated STAT3 (K685) in cardiomyocytes are significantly increased, and the protein levels of CDKN2B are significantly increased.

[0103] In one embodiment of the present invention, changes occur in the SIRT2-STAT3-CDKN2B signaling pathway in aging or aged tissues, which are specifically manifested as: SIRT2 protein in cardiac tissue is significantly downregulated; the protein level of acetylated STAT3 and / or acetylated STAT3 (K685) in cardiac tissue is significantly increased; and the CDKN2B protein level is significantly increased.

[0104] In one embodiment of the present invention, changes in the SIRT2-STAT3-CDKN2B signaling pathway in aging or aged tissues are not gender-specific, specifically: SIRT2 protein is significantly downregulated in the hearts of elderly female crab-eating monkeys and / or elderly male crab-eating monkeys; the acetylated STAT3 protein level in the hearts of elderly female crab-eating monkeys and / or elderly male crab-eating monkeys is significantly increased; the CDKN2B protein level in the hearts of elderly female crab-eating monkeys and / or elderly male crab-eating monkeys is significantly increased.

[0105] In one embodiment of the present invention, knocking down CDKN2B protein can delay the aging phenotype of SIRT2 knockout cardiomyocytes, which is specifically manifested as: in SIRT2 knockout cardiomyocytes, knocking down the expression of CDKN2B protein can reduce cardiomyocyte hypertrophy and / or reduce the proportion of SA-β-gal staining positive signal area.

[0106] In one embodiment of the present invention, replenishing SIRT2 protein in cardiomyocytes can delay the aging phenotype of SIRT2 knockout cells, which is specifically manifested as follows: in SIRT2 knockout cardiomyocytes, replenishing the expression of SIRT2 protein by a retroviral method can reduce the hypertrophy of cardiomyocytes and / or reduce the proportion of SA-β-gal staining-positive cells; replenishing the SIRT2-H187Y acetylation site mutant by a retroviral method cannot reduce the hypertrophy of cardiomyocytes and / or reduce the proportion of SA-β-gal staining-positive cells.

[0107] In any of the above-mentioned uses, products or methods, the organism may be a mammal.

[0108] Furthermore, the mammal may be a primate or a mouse.

[0109] Still further, the primate may be a human or a non-human primate.

[0110] Furthermore, the non-human primate may be a cynomolgus monkey.

[0111] The organ, tissue or cell may be an isolated organ, tissue or cell.

[0112] Further, the organ may be a heart.

[0113] The tissue may be the left ventricle of the heart.

[0114] The cell may be a cardiomyocyte.

[0115] Furthermore, the cardiomyocytes may be cardiomyocytes differentiated from embryonic stem cells or induced pluripotent stem cells.

[0116] In any of the above-mentioned applications, products or methods, the SIRT2 protein or the STAT3 protein or the CDKN2B protein may be a natural protein, such as a protein derived from a mammal, or a non-natural protein, such as a recombinant protein, etc. The recombinant protein only needs to have the function of a natural protein.

[0117] The SIRT2 protein can be a human SIRT2 protein, a cynomolgus monkey SIRT2 protein, or a mouse SIRT2 protein. The GenBank number of the amino acid sequence of the human SIRT2 protein is NP_036369.2, the GenBank number of the amino acid sequence of the cynomolgus monkey SIRT2 protein is XP_005589202.1, and the GenBank number of the amino acid sequence of the mouse SIRT2 protein is NP_071877.3.

[0118] The SIRT2 gene can be a human SIRT2 gene, a cynomolgus monkey SIRT2 gene, or a mouse Sirt2 gene. The GenBank number of the human SIRT2 gene is NM_012237.4, and its coding sequence is a DNA molecule whose nucleotide sequence is shown at positions 98-1267 of NM_012237.4; the GenBank number of the cynomolgus monkey SIRT2 gene is XM_005589145.3, and its coding sequence is a DNA molecule whose nucleotide sequence is shown at positions 122-1291 of XM_005589145.3; the GenBank number of the mouse Sirt2 gene is NM_022432.5, and its coding sequence is a DNA molecule whose nucleotide sequence is shown at positions 86-1255 of NM_022432.5.

[0119] The STAT3 protein can be a human STAT3 protein, a cynomolgus monkey STAT3 protein, or a mouse SIRT2 protein. The GenBank number of the amino acid sequence of the human STAT3 protein is NP_644805.1, the GenBank number of the amino acid sequence of the cynomolgus monkey STAT3 protein is XP_045230767.1, and the GenBank number of the amino acid sequence of the mouse STAT3 protein is NP_998824.1.

[0120] The STAT3 gene can be a human STAT3 gene, a cynomolgus monkey STAT3 gene, or a mouse Stat3 gene. The GenBank number of the human STAT3 gene is NM_139276.3, and its coding sequence is a DNA molecule whose nucleotide sequence is shown at positions 188-2500 of NM_139276.3; the GenBank number of the cynomolgus monkey STAT3 gene is XM_045374832.1, and its coding sequence is a DNA molecule whose nucleotide sequence is shown at positions 449-2761 of XM_045374832.1; the GenBank number of the mouse Stat3 gene is NM_213659.3, and its coding sequence is a DNA molecule whose nucleotide sequence is shown at positions 309-2621 of NM_213659.3.

[0121] The CDKN2B protein can be a human CDKN2B protein, a cynomolgus monkey CDKN2B protein, or a mouse CDKN2B protein. The GenBank number of the amino acid sequence of the human CDKN2B protein is NP_004927.2, the GenBank number of the amino acid sequence of the cynomolgus monkey CDKN2B protein is XP_045229262.1, and the GenBank number of the amino acid sequence of the mouse CDKN2B protein is NP_031696.1.

[0122] The CDKN2B gene can be a human CDKN2B gene, a cynomolgus monkey CDKN2B gene, or a mouse Cdkn2b gene. The GenBank number of the human CDKN2B gene is NM_004936.4, and its coding sequence is a DNA molecule whose nucleotide sequence is shown at positions 353-769 of NM_004936.4; the GenBank number of the cynomolgus monkey CDKN2B gene is XM_045373327.1, and its coding sequence is a DNA molecule whose nucleotide sequence is shown at positions 345-761 of XM_045373327.1; the GenBank number of the mouse Cdkn2b gene is NM_007670.4, and its coding sequence is a DNA molecule whose nucleotide sequence is shown at positions 236-628 of NM_007670.4.

[0123] Any of the above-mentioned applications or methods may be for the purpose of diagnosis and treatment of diseases, or for the purpose of diagnosis and treatment of non-diseases.

[0124] The beneficial technical and / or therapeutic effects achieved by the present invention are as follows:

[0125] 1) The present invention establishes for the first time the proteome and transcriptome maps of left ventricular tissues of young and old healthy cynomolgus monkeys, and for the first time the transcriptome maps of cardiomyocytes differentiated from human embryonic stem cells with SIRT2 knockout. Based on these data sets, important biological events of left ventricular aging in non-human primates, regulatory networks of key proteins and / or genes, and gene regulatory networks of aging of human cardiomyocytes with SIRT2 knockout were determined, providing a rich protein / gene database related to cardiac aging.

[0126] 2) The present invention analyzed the proteomic data of the left ventricular tissue of crab-eating macaques with the cardiovascular disease database, aging database, epigenetic database, and plasma protein database, and for the first time found a significant decrease in SIRT2, an important protein for resisting cardiac aging, in the hearts of non-human primates. Human cardiomyocytes with SIRT2 knockout showed the same phenotype as the aging of the crab-eating macaque heart, and through further bioinformatics analysis and protein spectrum analysis, STAT3, a key transcription factor potentially regulated by SIRT2 protein, was discovered. Through in-depth exploration of the mechanism, the present invention discovered that SIRT2 can regulate the aging of cardiomyocytes by regulating the acetylation level of STAT3 and then regulating the downstream target gene CDKN2B. The present invention also discovered that the aging of cardiomyocytes can be delayed by inhibiting CDKN2B or replenishing SIRT2.

[0127] 3) The present invention is the first to perform intramyocardial injection of SIRT2 virus into the hearts of aged mice and found that it can effectively improve the ejection fraction (EF) and fractional shortening (FS) of the hearts of aged mice and reduce the hypertrophy of cardiomyocytes of aged mice, suggesting that it can significantly improve the function of the hearts of aged mice.

[0128] 4) The present invention can promote the understanding of changes in cardiac aging and the development of new aging intervention strategies, including the development of therapeutic strategies targeting SIRT2 protein and / or SIRT2-STAT3-CDKN2B signaling pathway by using agonists and / or gene therapy, so as to delay and / or improve and / or treat cardiac aging or aging-related cardiovascular diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0129] Figure 1 Analysis of phenotypic changes in aged cynomolgus monkeys.

[0130] Figure 2 Proteomic analysis of aged cynomolgus monkeys.

[0131] Figure 3 Phenotypic analysis of myocardial aging and functional decline caused by SIRT2 knockout in human cardiomyocytes.

[0132] Figure 4 SIRT2 deficiency may lead to disrupted changes in STAT3 transcriptional regulation.

[0133] Figure 5 SIRT2 deacetylates STAT3 at K685.

[0134] Figure 6 Acetylated STAT3-K685 transcriptionally activates the expression of CDKN2B.

[0135] Figure 7 Knockdown of CDKN2B or intramyocardial injection of a virus overexpressing SIRT2 improved the phenotype of myocardial aging.

[0136] Figure 8 Combined analysis of differentially expressed proteins associated with aging in cynomolgus monkeys.

[0137] Fig. 9 For identification of hESCs.

[0138] Fig.10 Transcriptome analysis of cynomolgus monkey hearts and human cardiomyocytes.

[0139] Fig.11 The RNA and protein expression levels of STAT3 in cynomolgus monkey hearts and human cardiomyocytes.

[0140] Fig.12 The omics level changes of SIRT2-STAT3-CDKN2B signaling pathway in cardiac aging of female and male cynomolgus monkeys.

[0141] Fig.13 Changes in the SIRT2-STAT3-CDKN2B signaling pathway in female and male hearts.

[0142] Fig.14 Changes in the SIRT2-STAT3-CDKN2B signaling pathway in cardiomyocytes differentiated from male-derived hESCs and / or male-derived iPSCs.

[0143] Fig.15 Analysis of the senescence phenotype of wild-type cardiomyocytes caused by overexpression of CDKN2B. DETAILED DESCRIPTION

[0144] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0145] The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are purchased from conventional biochemical reagent stores unless otherwise specified. All animal experiments in the following examples were approved by the Animal Protection and Use Committee of the Chinese Academy of Sciences.

[0146] The experimental data in the following examples were processed using GraphPad Prism 8 statistical software, and the experimental results were expressed as mean ± standard deviation. A two-tailed t-test was used, with P < 0.05 indicating statistical significance, P < 0.01 indicating a significant difference, and P < 0.001 indicating a very significant difference.

[0147] The sources of biological materials in the following examples are as follows: cynomolgus monkeys are products of Beijing Xieerxin Biological Resources Institute; C57BL6 / J mice are products of Beijing Sibeifu Biotechnology Co., Ltd. NOD / SCID mice are products of Beijing Weitonglihua Experimental Animal Technology Co., Ltd. The animals used in this study have been approved by the Ethics Review Committee of the Institute of Zoology, Chinese Academy of Sciences.

[0148] Cardiomyocyte Differentiation Medium:

[0149] RPMI / B2-insulin cardiomyocyte culture medium: 485 volumes of 1640 culture medium (Gibco, #A1049101) were supplemented with 10 volumes of B2-insulin (dilution factor 50×, Cauliscell, #600501) and 5 volumes of penicillin-streptomycin (final concentration 1%, Gibco).

[0150] RPMI / B2+insulin cardiomyocyte culture medium: 485 volumes of 1640 culture medium (Gibco, #A1049101) were supplemented with 10 volumes of B2+insulin (dilution factor 50×, Cauliscell, #600601) and 5 volumes of penicillin-streptomycin (final concentration 1%, Gibco).

[0151] Cardiomyocyte purification medium: 485 volumes of 1640 medium without glucose (Gibco, #11879020) were added with 10 volumes of B2+insulin (dilution factor 50×, Cauliscell, #600601), 10 volumes of penicillin-streptomycin (final concentration 1%, Gibco) and Sodium DL-lactate (final concentration 5 mM, Sigma, #L4263).

[0152] HEK293T cell culture medium: 89 volumes of DMEM high glucose medium (Hyclone), 10 volumes of fetal bovine serum (Gibco), and 1 volume of penicillin / streptomycin (Gibco).

[0153] The sources of the biological materials in the following examples are as follows:

[0154] Human embryonic kidney 293T cells (HEK293T cells): ATCC, CRL-3216.

[0155] Human embryonic stem cells hESCs H9 cell line (female) and H1 cell line (male) are products of WiCell Research Institute in Madison, Wisconsin, USA.

[0156] Human pluripotent stem cells iPSCs are recorded in the document "Modeling CADASIL vascular pathologies with patient-derived induced pluripotent stem cells. Ling C, et al., Protein Cell. 2019 Apr; 10(4): 249-271." (named WT#1 in the document). The public can obtain the biological material from the applicant only for repeating the relevant experiments of the present invention and cannot be used for other purposes.

[0157] Lentiviral packaging vector psPAX2 (referred to as plasmid psPAX2): Addgene product, #12260.

[0158] Lentiviral packaging vector pMD2.G (referred to as plasmid pMD2.G): Addgene product, #12259.

[0159] The pLE4 vector is recorded in the document "A genome-wide CRISPR-based screen identifies KAT7 as a driver of cellular senescence. Wang W, et.al,. Sci Transl Med. 2021 Jan 6; 13(575): eabd2655." The public can obtain the biological material from the applicant only for repeating the relevant experiments of the present invention and cannot be used for other purposes.

[0160] FLAG-SIRT2-WT vector: constructed on the pLE4 vector. The specific construction method is detailed in the following examples.

[0161] FLAG-SIRT2-H187Y vector: a vector obtained by mutating the 559th base C to the base U in the SIRT2 protein encoding gene sequence on the FLAG-SIRT2-WT vector.

[0162] HA-SIRT2-WT vector: constructed on the pLE4 vector. The specific construction method is detailed in the following examples.

[0163] HA-SIRT2-H187Y vector: a vector obtained by mutating the 559th base of the SIRT2 protein encoding gene sequence on the HA-SIRT2-WT vector from base C to base U.

[0164] FLAG-STAT3-WT vector: constructed on the pLE4 vector. The specific construction method is detailed in the following examples.

[0165] FLAG-STAT3-K685R vector: a vector obtained by mutating the 2054th base of the STAT3 protein encoding gene sequence on the FLAG-STAT3-WT vector from A to G.

[0166] shSIRT2 vector: a vector obtained by ligating the shSIRT2 coding sequence into the pLVTHM vector (Addgene product, #12247).

[0167] FLAG-Luciferase (Luc) vector: constructed on the pLE4 vector, which is recorded in the document "Stabilization of heterochromatin by CLOCK promotes stem cell rejuvenation and cartilage regeneration. Liang C, et al., Cell Res. 2021 Feb; 31(2): 187-205" (named FLAG-Luc in the document). The public can obtain the biological material from the applicant only for repeating the relevant experiments of the present invention and cannot be used for other purposes.

[0168] CDKN2B vector: constructed on the pLE4 vector, which is described in the literature "A genome-wide CRISPR-based screen identifies KAT7 as a driver of cellular senescence. Wang W, et al,. Sci Transl Med. 2021 Jan 6; 13(575): eabd2655." (The name in the literature is FLAG-p15 INK4b The public can obtain the biological material from the applicant only for repeating the relevant experiments of the present invention and cannot use it for other purposes.

[0169] sgCDKN2B vector: constructed on the lentiCRISPRv2 vector (Addgene product, #52961), which is described in the literature "A genome-wide CRISPR-based screen identifies KAT7 as a driver of cellular senescence. Wang W, et al,. Sci Transl Med. 2021 Jan 6; 13(575): eabd2655." (the name in the literature is sg-p15 INK4b The public can obtain the biological material from the applicant only for repeating the relevant experiments of the present invention and cannot use it for other purposes.

[0170] The sources of the reagents used in the following examples are as follows: anti-Cardiac Troponin T Antibody (cTnT) (Cat. No.: MA5-12960), Hoechst 33342 (Cat. No.: H3570), Alexa fluor 488 donkey anti-mouse IgG (Cat. No.: A21202), Alexa fluor 488 donkey anti-rabbit IgG (Cat. No.: A21206), and Alexa fluor 568 donkey anti-rabbit IgG (Cat. No.: A10042) are all products of ThermoFisher Scientific. Anti-p21 (Cat. No. 2947s), anti-STAT3 (Cat. No. 9139s), anti-HA (Cat. No. 3724S), anti-Acetylated-Lysine (Cat. No. 9441s), anti-Acetyl-Stat3(Lys685) (Cat. No. 2523), anti-FOXA2 (Cat. No. 8186S), Normal rabbit IgG (Cat. No. 2729s) are all products of CST. Anti-IL-1β (Cat. No. sc-52012), anti-GAPDH (Cat. No. sc-365062), Normal mouse IgG (Cat. No. sc-2025) are all products of Santa Cruz. Anti-TNFα (Cat. No. ab1793), anti-MRP8 (S100A8) (Cat. No. ab92331), anti-S100A9 (Cat. No. ab92507), anti-SIRT2 (Cat. No. ab134171), anti-p15 (CDKN2B) (Cat. No. ab53034), and anti-Ki67 (Cat. No. ab15580) are all products of Abcam. Anti-SIRT2 (Cat. No. 19655-1-AP) is a product of Proteintech. Anti-FLAG (Cat. No. F1804), anti-TUJ1 (Cat. No. T2200), and anti-SMA (Cat. No. A5228) are all products of Sigma-Aldrich. Anti-GAPDH (Cat. No.: YN5585), anti-Tubulin (Cat. No.: YM3030), and anti-p15 (CDKN2B) (Cat. No.: YT3492) are all products of Immunoway. Aggresome detection kit (item number: ENZ-51035-K100) is a product of Enzo.

[0171] Example 1. Analysis of phenotypic changes in aging cynomolgus monkeys

[0172] 1. Experimental Grouping and Materials Collection

[0173] 1. Experimental Grouping

[0174] The experimental grouping and gender information of the two groups of cynomolgus monkeys are as follows:

[0175] Young group: 8 cynomolgus monkeys (4 females and 4 males) aged 4-6 years.

[0176] Aged group: 8 cynomolgus monkeys (4 females and 4 males) aged 18-21 years.

[0177] 2. Obtain materials

[0178] The perfusion was performed under anesthesia in the cynomolgus monkey. After the perfusion, the heart tissue was quickly separated, and the fat tissue around the heart was carefully separated and removed. According to the anatomical structure of the heart, the left ventricular tissue of the heart was carefully separated. The separated left ventricular tissue was fixed with 4% paraformaldehyde and embedded into paraffin tissue blocks or prepared into OCT cryopreserved samples. The remaining left ventricular tissue was directly and quickly frozen in liquid nitrogen for subsequent RNA extraction, protein extraction, or other analysis.

[0179] 2. Experimental Methods

[0180] 1. HE staining

[0181] Paraffin-embedded tissues were sliced ​​at a thickness of 5 μm using a rotary microtome. The sections were dewaxed in xylene three times for 10 minutes each, immersed in gradient ethanol (100%, 100%, 95%, 80%, 70%) for 5 minutes each, and then rehydrated in water for 10 minutes. The tissue was incubated in hematoxylin solution to stain the nucleus, rinsed in tap water to remove excess hematoxylin, differentiated with 1% acidic ethanol for 1 second, and rinsed in tap water for 10 minutes. Stained with 0.5% eosin solution for 3 minutes and washed in tap water. Finally, the sections were dehydrated in gradient ethanol and xylene and sealed with neutral gum, images were collected under a microscope, and the area of ​​the positive area was quantified by ImageJ.

[0182] 2. Electron microscope detection

[0183] Heart tissue or cultured cells were fixed with glutaraldehyde (2.5%, vol / vol) plus phosphate buffer (PB, 0.1M, pH 7.4) and rinsed twice with PB and distilled water, respectively. The tissue was then immersed in OsO4 (1%, wt / vol) and potassium ferricyanide aqueous solution (1.5%, wt / vol) at 4°C for 2 hours. After washing three times in distilled water, the samples were dehydrated into pure acetone (2×10 minutes) using graded alcohol solutions (30%, 50%, 70%, 80%, 90%, 100% and 100%, 10 minutes for each tissue). The samples were then infiltrated with graded mixtures (3:1, 1:1, 1:3) of acetone and SPI-PON812 resin (21 ml SPI-PON812, 13 ml DDSA and 11 ml NMA) and pure resin. Finally, the tissue was further embedded in pure resin containing BDMA (1.5%) and polymerized at 45°C and 60°C for 12 hours and 48 hours, respectively. Ultrathin 70 nm sections were cut on a Leica microscope (EMUC6), double stained with uranyl acetate and lead citrate, and examined under TEM (FEI Tecnai Spirit 120 kV). ImageJ software was used to analyze the sarcomere Z disk and sarcomere length of myocardial tissue.

[0184] 3. SA-β-gal staining

[0185] Heart tissue samples from each group were taken for senescence-associated β-galactosidase staining analysis. Senescence-associated β-galactosidase staining is a method for staining senescent tissues based on the upregulation of SA-β-gal (senescence-associated-β-galactosidase) activity levels during aging.

[0186] The specific steps are as follows: The frozen sections of the heart tissue are restored to room temperature and dried, washed with PBS, and fixed with 2% formaldehyde and 0.2% glutaraldehyde for 15 minutes at room temperature. Then stain with staining solution at 37°C for 96 hours. Then fix the slides with 80% glycerol. Images are collected under a microscope (Nikon Eclipse or Olympus). Using X-Gal as a substrate, a dark blue product is generated under the catalysis of aging-specific β-galactosidase. The aging of the tissue can be observed under an ordinary optical microscope, and the percentage or intensity of the SA-β-gal positive area can be quantified by ImageJ.

[0187] The formula of the staining solution is as follows: 40 mM citric acid / sodium phosphate buffer, 5 mM K4[Fe(CN)6]·6H2O, 5 mM K3[Fe(CN)6], 150 mM NaCl, 2 mM MgCl2, and 1 mg / ml X-gal (Amresco).

[0188] 4. Masson staining

[0189] Masson staining was performed using the Masson trichrome staining kit (Solarbio, G1346) and according to its instructions. After paraffin embedding, the tissue was sectioned at 5 μm thickness, dewaxed with xylene, and hydrated with 100% ethanol, 95% ethanol, 70% ethanol, and tap water. The sections were then stained with potassium dichromate solution overnight. After rinsing with tap water for 10 minutes, the sections were stained in azure blue staining solution for 3 minutes, and after rinsing with tap water, the sections were stained in hematoxylin working solution for 5 minutes, and then rinsed with tap water, differentiated with 1% hydrochloric acid ethanol for 1 second, and after rinsing with tap water for 5 minutes, stained in Lichunhong Fuchsin solution for 10 minutes. Then differentiated in phosphomolybdic acid solution for 10 minutes, stained with aniline blue solution for 5 minutes, and differentiated in 1% acetic acid solution for 2 minutes. Then dehydrated twice with 95% alcohol, dehydrated twice with anhydrous ethanol, transparentized with xylene, covered with a coverslip, and sealed with neutral gum.

[0190] 5. Immunohistochemical staining

[0191] After paraffin embedding, the tissue was sectioned at 5 μm thickness, dewaxed with xylene, and hydrated with 100% ethanol, 100% ethanol, 90% ethanol, 80% ethanol, 70% ethanol, 50% ethanol, and tap water. The sections were microwaved 5 times in 10 mM sodium citrate buffer (pH 6.0) for 3 min each time. After cooling to room temperature (RT), the sections were gently washed three times with PBS, permeabilized in 0.4% Triton X-100 / PBS solution for 1 hour, and then washed twice with PBS buffer for 5 minutes each time. Then incubated in 3% H2O2 for 10 minutes to block the activity of endogenous peroxidase. After the sections were blocked with PBS containing 10% donkey serum at room temperature for 1 hour, the primary antibody was added and incubated overnight at 4°C, and the next day, the enzyme-labeled secondary antibody was incubated at room temperature for 1 hour, and then the DAB staining kit (ZSJQ-BIO) was used for color detection. The sections were counterstained with hematoxylin, differentiated with 1% hydrochloric acid ethanol, dehydrated with graded alcohols (50%, 70%, 80%, 90%, 100% and 100%) and xylene, and then mounted with neutral gum. Images were taken with a VectroPolaris instrument (PerkinElmer) or under a microscope (Nikon Eclipse).

[0192] 6. Tissue Immunofluorescence Staining

[0193] After paraffin embedding, the tissue was sectioned at 5 μm thickness, dewaxed with xylene, and hydrated with 100% ethanol, 100% ethanol, 90% ethanol, 80% ethanol, 70% ethanol, 50% ethanol, and tap water. The sections were microwaved 5 times in 10 mM sodium citrate buffer (pH 6.0) for 3 min each time. After cooling to room temperature (RT), the sections were gently washed three times with PBS, permeabilized in 0.4% Triton X-100 / PBS solution for 1 hour, and washed twice with PBS. After the sections were blocked with PBS containing 10% donkey serum at room temperature for 1 hour, the primary antibody was added and incubated overnight at 4°C, and the next day, the fluorescent secondary antibody was incubated at room temperature for 1 hour, and the cell nucleus was stained with the DNA-specific dye Hoechst 33342 (Thermo Fisher Scientific), and finally the sections were sealed with a fluorescent antifade (Vector Laboratories). The images were taken using a laser confocal (Leica TCS SP5 II or Zeiss LSM 900).

[0194] 7. RT-qPCR

[0195] Total RNA was extracted from cardiac tissue using TRIzol reagent (Thermo Fisher Scientific, #15596018), and then reverse transcribed into cDNA using the GoScript reverse transcription kit (Promega, #A5001). RT-qPCR was then performed using Thunderbird qPCR Mix (TOYOBO, #QPS-201) reagent and Real-Time System (Bio-Rad Laboratories, Inc. or Thermo Fisher Scientific) instrument.

[0196] Table 1: Primer sequences for monkey RT-qPCR

[0197] sequence name Nucleotide sequence (5'-3') GAPDH-Forward TCGGAGTCAACGGATTTGGT GAPDH-Reverse TTGCCATGGGTGGAATCATA BNP-Forward TGGAAACGTCTGGGTTACAG BNP-Reverse CTGATCCGGTCCATCTTCCT IL8-Forward ACTGAGAGTGATTGAGAGTGGAC IL8-Reverse AACCCTCTGCACCCATGGTTC

[0198] 8. Western blotting experiment

[0199] After the heart tissue was removed, it was placed in a cryovial and quickly frozen in liquid nitrogen. Then the tissue was removed and ground in liquid nitrogen, and fully lysed with 1× SDS lysis buffer (62.5mM Tris-HCl, pH 6.8, 2% (wt / vol) SDS), and boiled at 105°C for 10 minutes. After centrifugation at 13000rpm and 4°C for 15 minutes, the protein supernatant was carefully collected, and the protein concentration was determined using a BCA kit, and the protein lysate was subjected to SDS-PAGE. After electrophoresis and transfer, the PVDF membrane (Millipore) was blocked with TBST containing 5% skim milk powder (BBI Life Sciences), washed 3 times with TBST, 10 minutes each time, incubated with primary antibody at 4°C overnight, and then incubated with enzyme-labeled secondary antibody (Jackson ImmunoResearch) at room temperature for 1 hour. After washing three times with TBST for 10 minutes each time, the samples were developed and photographed using the ChemiDoc XRS system (Bio-Rad) and Image Lab software, and the images were quantified using ImageJ software.

[0200] 9. Protein Extraction and Trypsin Digestion

[0201] The heart tissue samples of cynomolgus monkeys were placed in a mortar pre-cooled with liquid nitrogen and fully ground into powder with liquid nitrogen. Four times the volume of lysis buffer (8M urea, 1% protease inhibitor and 2mM EDTA) was added to each group of samples, and ultrasonic lysis was performed. Centrifuge at 4°C, 12000g for 10 minutes to remove cell debris, transfer the supernatant to a new centrifuge tube, and use the BCA kit to determine the protein concentration. Dithiothreitol was added to the protein solution to make the final concentration of 5mM, and reduced at 56°C for 30 minutes. Then iodoacetamide was added to make the final concentration of 11mM, and incubated at room temperature in the dark for 15 minutes. Finally, the urea concentration of the sample was diluted to less than 2M. Pancreatin was added at a mass ratio of 1:50 (pancreatin: protein) and enzymatic hydrolysis was performed at 37°C overnight. Pancreatin was added at a mass ratio of 1:100 (pancreatin: protein) and enzymatic hydrolysis was continued for 4 hours.

[0202] 10. TMT quantitative proteomics sequencing

[0203] The peptides digested by trypsin were desalted with Strata X C18 (Phenomenex) and then freeze-dried in vacuum. The peptides were dissolved in 0.5 MTEAB and labeled according to the TMT kit instructions. The operation steps were as follows: the labeling reagent was thawed and dissolved in acetonitrile, mixed with the peptides and incubated at room temperature for 2 h. The labeled peptides were mixed and desalted and freeze-dried in vacuum. The peptides were fractionated by high pH reverse HPLC, and the chromatographic column was Agilent 300Extend C18 (5 μm particle size, 4.6 mm inner diameter, 250 mm length). QExactiveTM LC-MS / MS analysis was performed using a Thermo Plus ultra-high performance liquid chromatograph.

[0204] 11. Quantitative proteomics data analysis

[0205] Tandem mass spectrometry data were analyzed using the Maxquant search engine (v.1.5.2.8). Tandem mass spectra were matched against the UniProt cynomolgus monkey database. The enzyme specificity was set to Trypsin / P, and up to 2 undigested sites were allowed. The mass tolerance of precursor ions in the first search and the main search was set to 20 ppm and 5 ppm, respectively. The mass tolerance of fragment ions was 0.02 Da. The false discovery rate threshold was less than 0.01, and the minimum score of peptides was set to 40. Protein abundance was normalized by row mean and column median, and a two-tailed unpaired Student's t-test was performed. The threshold for differentially expressed proteins (DEPs) was: the absolute value of log2 (fold change) was greater than 0.26, and Benjamini-Hochberg corrected P < 0.05.

[0206] 3. Experimental Results

[0207] 1. Changes in cardiac aging-related phenotypes in cynomolgus monkeys

[0208] In order to study the physiological changes of primate heart aging, the present invention used 8 young and 8 old cynomolgus monkeys to conduct relevant research ( Figure 1 HE staining and WGA / cTnT staining revealed that the heart cross-sectional area of ​​the old group of cynomolgus monkeys was significantly larger than that of the young group of cynomolgus monkeys (P<0.0001, Figure 1 Medium b and Figure 1 The results of electron microscopy showed that the Z-disk structure of the sarcomere of the old group of cynomolgus monkeys was bent and the length of the sarcomere was longer than that of the young group of cynomolgus monkeys, indicating the abnormality of the cardiomyocyte structure of the old non-human primates ( Figure 1 RT-qPCR results showed that the BNP gene, a marker of hypertrophy in the aged group of cynomolgus monkeys, was significantly upregulated ( Figure 1 These results suggest that the aged nonhuman primate heart exhibits a typical phenotype associated with cardiomyocyte hypertrophy.

[0209] Furthermore, the present invention also detected other markers of degeneration and / or aging in the hearts of non-human primates. Among them, a significant increase in the staining area of ​​the classic aging marker, senescence-associated β-galactosidase (SA-β-gal), was found in the hearts of aged non-human primates ( Figure 1 In addition, the present invention also found that the area of ​​fibrosis increased in the hearts of aged non-human primates ( Figure 1 g), which suggests that the fibrosis repair process is increased in the aged heart. At the same time, the present invention also found other aging-related changes, such as the up-regulated expression of p21 level ( Figure 1 Medium h and Figure 1 j), the increase of protein aggregates ( Figure 1 (k).

[0210] Since inflammation is also a common phenomenon in the aging process, the present invention found a significant upregulation of inflammatory factors in the hearts of aged non-human primates, such as IL-8, IL-1β, TNFα, S100A8 and S100A9 ( Figure 1 Neutral Figure 1 In summary, the above results suggest that the old cynomolgus monkeys, under the condition of physiological aging, not only present the typical phenotype of myocardial hypertrophy, but also present a series of phenotypes closely related to aging.

[0211] 2. Proteomic changes in the heart of aging cynomolgus monkeys

[0212] To dissect the molecular mechanisms of the multifaceted phenotypes of primate cardiac aging, we first performed quantitative proteomic analysis of young and old cynomolgus macaque heart samples. A total of 126 upregulated and 43 downregulated aging-related differentially expressed proteins (DEPs) were identified ( Figure 2 Further analysis of these DEPs showed that the upregulated DEPs were mainly involved in inflammatory response (i.e. leukocyte degranulation), blood coagulation process (i.e. coagulation), and fibrosis-related signaling pathways (i.e. extracellular matrix organization), most of which were consistent with the phenotypes previously observed in the aged cynomolgus monkey heart ( Figure 1 In g, i, lo and Figure 2 Meanwhile, downregulated DEPs were associated with protein synthesis, mitochondrial respiratory chain complex assembly, and lipid metabolism, indicating that protein homeostasis disorder, mitochondrial dysfunction, and lipid metabolism changes existed in the hearts of aged cynomolgus monkeys ( Figure 2 (b)

[0213] 3. SIRT2 protein is significantly downregulated in non-human primate cardiac aging

[0214] In order to explore the potential association between aging-related molecular perturbations and the increased risk of aging-related cardiovascular diseases, the present invention conducted a joint analysis of aging DEPs and aging-related cardiovascular disease hotspot genes ( Figure 2 c). It is worth noting that NAD + The histone deacetylase SIRT2 was identified as the only one of the four cardiovascular diseases and was downregulated in the hearts of aged cynomolgus monkeys. Figure 2In addition, SIRT2 was identified as the only downregulated DEP in the joint analysis with the Aging Atlas database ( Figure 2 The present invention also found that SIRT2 was the only downregulated DEP in the joint analysis of genes related to epigenetic regulation ( Figure 8 (f)

[0215] Furthermore, the present invention found that upregulation of inflammation-related factors (KNG1 and C3), blood coagulation-related proteins (such as F2, FGB, FGG), and serine protease inhibitors (i.e., SERPINA1, SERPINA3, and SERPINF2) in DEP was associated with four cardiovascular diseases ( Figure 2 In addition, FGG and SERPINA3 have also been reported to be upregulated in plasma protein levels in the elderly ( Figure 8 g), indicating that they have the potential to serve as serum biomarkers for aging-related cardiovascular diseases. In addition, the present invention also found that most of the DEPs that have not been associated with aging-related cardiovascular diseases are associated with adaptive immune responses, such as the immunoglobulin family (IGKV2D-29, IGLL5, IGHA2), suggesting that inflammatory responses increase in primate heart aging ( Figure 8 In conclusion, the present invention systematically analyzed the molecular characteristics of the heart of aged cynomolgus monkeys and found that SIRT2 is a potential important regulatory protein in the aging of the heart of aged non-human primates.

[0216] Western blotting results showed that SIRT2 protein was significantly downregulated in the hearts of aged non-human primates (P<0.0001, Figure 2 f). To further verify whether the downregulation of SIRT2 protein is gender-specific, the present invention performed proteomic analysis and Western blotting verification on the hearts of young and old female or male cynomolgus monkeys. The results showed that compared with young female cynomolgus monkeys, SIRT2 protein in the hearts of old female cynomolgus monkeys was significantly downregulated; compared with young male cynomolgus monkeys, SIRT2 protein in the hearts of old male cynomolgus monkeys was significantly downregulated ( Fig.12 A and Fig.13 (a)

[0217] Example 2: Knockout of SIRT2 protein causes senescence and functional decline of human cardiomyocytes

[0218] 1. Experimental Methods

[0219] 1. Obtaining SIRT2 knockout human embryonic stem cells

[0220] CRISPR / Cas9 technology was used to knock out SIRT2 protein in human embryonic stem cells. The specific steps are as follows: the nucleic acid molecule formed by annealing sgSIRT2-F and sg-SIRT2-R (containing a sequence homologous to the vector and an sgRNA target sequence targeting exon 4 of the SIRT2 gene, the sgRNA target sequence is shown in Table 2) was connected to the pCAG-mCherry-gRNA plasmid (Addgene, plasmid number: 87110) by homologous recombination to obtain a SIRT2 knockout plasmid.

[0221] The sequences of sgSIRT2-F and sg-SIRT2-R are as follows (the sequences in bold are the sgRNA target sequences):

[0222] sgSIRT2-F:

[0223]

[0224] sgSIRT2-R:

[0225]

[0226] Table 2: sgRNA target sequences

[0227] sequence name Nucleotide sequence (5'-3') SIRT2 sgRNA GCGTTCGCTCTGCATGTACC

[0228] SIRT2 + / + hESCs (H9 hESCs (female) were digested and cultured in mTeSR medium in a culture plate coated with Matrigel in advance for 24 hours, and the ROCK inhibitor Y-27632 (Selleck) was added to the culture medium. Then, the constructed plasmid targeting SIRT2 (SIRT2 knockout plasmid) and the vector expressing Cas9 nuclease (pCAG-1BPNLS-Cas9-1BPNLS-2AGFP, plasmid number: 87109; Addgene) were electroporated into SIRT2 using Lonza's 4D nucleofector nuclear transfection instrument. + / + hESCs cells. The electroporated cells were cultured for 48 hours in fresh mTeSR medium in a culture plate coated with Matrigel in advance, and the ROCK inhibitor Y-27632 was added to the culture medium. After the culture, GFP was detected by flow cytometry (BD Influx). + / mCherry + The cells were sorted and cultured on MEF feeder cells. After culture, genomic DNA was extracted and analyzed from the clones derived from the single cells.

[0229] 2. Differentiate human embryonic stem cells and human induced pluripotent stem cells into cardiomyocytes

[0230] hESCs (H9 hESCs (female) or H1 hESCs (male)) or iPSCs were differentiated into cardiomyocytes by induction with small molecule compounds. The specific steps are as follows: hESCs or iPSCs were separated by digestion with 0.5mM EDTA for about 5 minutes, digested into small cell blocks, terminated with mTeSR medium, centrifuged at 1000rpm for 5 minutes, resuspended with mTeSR medium, plated on culture plates coated with Matrigel in advance, and cultured for 2 days to reach 90% confluence. On day 0, hESCs were treated with 5μM CHIR99021 (Selleck, #S1263) in RPMI (Gibco, #A1049101) / B2-insulin (Cauliscell, #600501) cardiomyocyte culture medium for 24h. On days 3-5, hESCs were treated with 5 μM IWR-1 (Selleck, #S7086) in RPMI / B2-insulin cardiomyocyte medium. The medium was then changed to RPMI / B2+insulin cardiomyocyte medium, and the medium was changed every 3 days. On day 11, beating human cardiomyocytes were purified with glucose-free cardiomyocyte purification medium, and the purified cardiomyocyte medium was subsequently replenished every 2 days. On day 17, after 6 days of purification, the medium was changed to RPMI / B2+insulin cardiomyocyte medium for cardiomyocyte culture. After 20 days of differentiation, immature cardiomyocytes derived from hESC or iPSC were treated with 20 ng / ml 3,3′,5-triiodo-L-thyronine sodium salt (T3, Sigma, #T6397) for 10 days to promote cardiomyocyte maturation, and the medium was changed every other day.

[0231] 3. Flow cytometry identification of cardiomyocytes

[0232] Human cardiomyocytes at day 20 of differentiation were fixed and stained with cTnT antibody, incubated with Alexflour-488-labeled goat anti-mouse secondary antibody for 30 minutes, washed twice with PBS, and analyzed using flow cytometer (BD Fortessa) and FlowJo (Version X10).

[0233] 4. Cell Immunofluorescence Staining

[0234] The cultured cells were fixed in 4% PFA for 20 minutes, washed twice with PBS, and permeabilized in 0.4% Triton X-100 / PBS for 1 hour, and washed twice with PBS. After blocking with PBS containing 10% donkey serum at room temperature for 1 hour, the primary antibody was added and incubated overnight at 4°C, washed three times with TBST, and the fluorescent secondary antibody was added and incubated at room temperature for 1 hour, and the cell nucleus was stained with DNA-specific dye Hoechst 33342 (Thermo Fisher Scientific), and finally sealed with fluorescent antifade agent (Vector Laboratories). Laser confocal (Leica TCS SP5 II or Zeiss LSM 900) was used for shooting.

[0235] 5. Electron microscope detection

[0236] Heart tissue or cultured cells were fixed with glutaraldehyde (2.5%, vol / vol) plus phosphate buffer (PB, 0.1M, pH 7.4) and rinsed twice with PB and distilled water, respectively. The tissue was then immersed in OsO4 (1%, wt / vol) and potassium ferricyanide aqueous solution (1.5%, wt / vol) for 2 h at 4°C. After washing three times in distilled water, the samples were dehydrated into pure acetone (2×10 min) using gradient alcohol solutions (30%, 50%, 70%, 80%, 90%, 100% and 100%, 6 min for cultured cells). The samples were then infiltrated with graded mixtures (3:1, 1:1, 1:3) of acetone and SPI-PON812 resin (21 ml SPI-PON812, 13 ml DDSA and 11 ml NMA) and pure resin. Finally, the tissue was further embedded in pure resin containing BDMA (1.5%) and polymerized at 45°C and 60°C for 12 h and 48 h, respectively. Ultrathin 70 nm sections were cut on a Leica microscope (EMUC6), double stained with uranyl acetate and lead citrate, and examined under TEM (FEI Tecnai Spirit 120 kV). ImageJ software was used to analyze the sarcomere Z disk and sarcomere length of human cardiomyocytes.

[0237] 6. RT-qPCR

[0238] Total RNA was extracted from cells using TRIzol reagent (Thermo Fisher Scientific), and then reverse transcribed and synthesized into cDNA using the GoScript reverse transcription kit (Promega). RT-qPCR was then performed using Thunderbird qPCR Mix reagent and Real-Time System (Bio-Rad Laboratories, Inc. or Thermo Fisher Scientific) instrument.

[0239] Table 3: Primer sequences for human RT-qPCR

[0240]

[0241]

[0242] 7. Cell SA-β-gal staining

[0243] The cultured cells were washed twice with PBS and fixed with 2% formaldehyde and 0.2% glutaraldehyde for 3-5 min at room temperature, and then stained in 1 mg / mL X-gal staining solution at 37°C overnight. Images were collected under a microscope (Nikon Eclipse or Olympus), and the percentage or intensity of SA-β-gal positive area or cells was calculated using ImageJ.

[0244] 8. Western blotting experiment

[0245] For the extraction of cell proteins, the cultured cells were directly lysed using 1× SDS lysis buffer. After centrifugation at 13000rpm and 4°C for 15 minutes, the protein supernatant was carefully collected, and the protein concentration was determined using a BCA kit, and the protein lysate was subjected to SDS-PAGE. After electrophoresis and transfer, the PVDF membrane (Millipore) was blocked with TBST containing 5% skim milk powder (BBI Life Sciences), washed 3 times with TBST for 10 minutes each time, incubated with primary antibody at 4°C overnight, and then incubated with enzyme-labeled secondary antibody at room temperature for 1 hour. After washing 3 times with TBST for 10 minutes each time, the ChemiDoc XRS system (Bio-Rad) and Image Lab software were used for development and photography, and the acquired images were quantified using ImageJ software.

[0246] 9. ELISA test

[0247] ELISA kit was used to detect SIRT2 + / + and SIRT2 - / -The protein level of IL-8 in the culture medium of defective human cardiomyocytes was measured according to the instructions (R&D, #D8000C). The data were read at 450 nm using a BioTek Synergy H1 multi-function microplate reader.

[0248] 10. Detect mitochondrial quality and function

[0249] Mitochondrial quality was evaluated using 2.5 μM nonylacridine orange (NAO). Oxygen consumption (OCR) was measured using a Seahorse XF96 cell energy analyzer to assess mitochondrial respiratory function. XF96 culture plates were coated with Matrigel in advance, and cardiomyocytes were plated at 2×10 4 Cells were seeded at a density of 1 μg / mL per well in the plate. One hour before measurement, the medium was replaced with Agilent Seahorse XF DMEM basal medium containing 2 mmol / L glutamine, 10 mmol / L glucose and 1 mmol / L sodium pyruvate. In the mitochondrial stress test, different regulators were added during the measurement: oligomycin (1.5 μM), FCCP (1 μM), rotenone / antimycin A (0.5 μM). Finally, the OCR values ​​were normalized to the number of cells per well.

[0250] 11. Detection of calcium ions

[0251] SIRT2 + / + and SIRT2 - / - Human cardiomyocytes were digested into single cells and plated on glass slides coated with Matrigel in advance. After 3-4 days of culture, the cells were loaded with 5 μM Fluo-4 AM for 10 minutes at 37°C and then washed 3 times. The release of calcium ions was detected using the line scanning mode of Carl Zeiss confocal microscope (720). Confocal software was used to display and analyze Ca 2+ Imaging data.

[0252] 12. Detection of Teratoma

[0253] In the teratoma experiment, SIRT2-deficient human embryonic pluripotent stem cells cultured on Matrigel were digested into single cells using TrypLE and counted. 6 Human embryonic pluripotent stem cells with SIRT2 deficiency were resuspended in a mixture of Matrigel / mTeSR (1:4) and injected subcutaneously into the groin of NOD / SCID mice (6-8 weeks old, male). After 8-12 weeks, teratomas were removed and frozen sections and immunostaining were performed.

[0254] 13. Karyotype analysis

[0255] Karyotype analysis was performed by Beijing San Valley Diagnostics. Human embryonic pluripotent stem cells were cultured in a cell culture flask to a density of 70%, and treated with KaryoMAX Colcemid Solution in HBSS (Thermo Fisher Scientific, #15210040) to arrest the cells in the M phase. After the cells were digested with trypsin, the next step of karyotype analysis was performed.

[0256] 2. Experimental Results

[0257] 1. Knockout of SIRT2 protein causes senescence of human cardiomyocytes

[0258] In order to study the role of SIRT2 in cardiomyocyte aging, the present invention uses CRISPR / Cas9 gene editing technology to obtain SIRT2 knockout human female embryonic stem cells (SIRT2 - / - hESCs, Fig. 9 A and Fig. 9 b), which has a normal karyotype and the ability to differentiate into three germ layers and proliferate ( Fig. 9 ce). SIRT2 is induced by small molecule compounds - / - hESCs differentiated into human cardiomyocytes ( Figure 3 >95% of the control group (SIRT2 + / + hESCs and SIRT2-deficient human embryonic stem cells (SIRT2 - / - hESCs) expressed cTnT, a typical marker of cardiomyocytes ( Figure 3 b), which suggests that SIRT2 deficiency will not cause changes in cardiomyocyte differentiation efficiency. At the same time, the present invention uses Western blotting to verify that SIRT2 protein has been knocked out in human cardiomyocytes ( Figure 3 (c).

[0259] Compared with the control group (SIRT2 + / + Compared with human ESCs, SIRT2-deficient human cardiomyocytes (SIRT2 - / - hESCs) showed significant enlargement, an important criterion for cardiomyocyte hypertrophy, and this phenotype is consistent with that observed in aged nonhuman primate hearts ( Figure 3 In addition, the present invention found myocardial Z-disk disorder and sarcomere elongation in human myocardial cells lacking SIRT2 ( Figure 3 e), similar to the phenotype observed in aged nonhuman primate hearts ( Figure 1At the same time, the present invention also found a significant upregulation of the myocardial hypertrophy gene BNP in SIRT2-deficient myocardial cells ( Figure 3 In addition, SIRT2-deficient cardiomyocytes also showed the appearance of cellular senescence-related phenotypes, such as an increase in the proportion of SA-β-gal-positive cells ( Figure 3 Middle g), the expression of p21 protein was upregulated ( Figure 3 h), and increased secretion of SASP factors such as IL-8 ( Figure 3 Neutral Figure 3 (j).

[0260] 2. Knockout of SIRT2 protein causes functional decline of human cardiomyocytes

[0261] Since mitochondrial respiratory chain dysfunction is another typical feature of aging cardiomyocytes, and the present invention has found changes in the signal pathways related to the assembly of mitochondrial respiratory chain complexes in the hearts of aging non-human primates, the present invention has tested some mitochondrial related parameters in human cardiomyocytes with SIRT2 deficiency. The results showed that SIRT2 deficiency can lead to an increase in the number and mass of mitochondria in human cardiomyocytes ( Figure 3 Medium K and Figure 3 In line with this, the present invention also found that SIRT2 deficiency impairs the respiratory capacity of mitochondria, which is manifested by reduced basal and maximum respiratory oxygen consumption, as well as downregulated ATP production ( Figure 3 Chinese Figure 3 In addition, based on the fact that calcium ion homeostasis plays an important role in the excitation-contraction coupling of cardiomyocytes, the present invention uses Fluo-4 AM dye to detect calcium ions in cardiomyocytes. The present invention observed abnormal calcium transients in SIRT2-deficient cardiomyocytes, which are manifested in the reduction of calcium ion events and the increase of calcium ion amplitude ( Figure 3 (middle o), indicating that human cardiomyocytes lacking SIRT2 exhibit calcium ion disorder.

[0262] The above results indicate that SIRT2 deficiency can cause typical aging and hypertrophy phenotypes and functional loss, indicating that SIRT2 plays an important role in preventing cardiomyocyte aging.

[0263] Example 3: STAT3 is a key regulatory factor mediating transcriptional disorders caused by SIRT2 deficiency

[0264] 1. Experimental Methods

[0265] 1. Transcriptome sequencing

[0266] Total RNA from cynomolgus monkey heart tissue and human cardiomyocytes was extracted using TRIzol reagent. After RNA quality was assessed, libraries were constructed and high-throughput sequencing was performed for each sample. UltraTM RNALibraryPrep Kit for (NEB, USA) to prepare libraries and create indexes for each sample. The libraries were then sequenced on an Illumina paired-end sequencing platform (Novogene Bioinformatics Technology Co. Ltd.) with a read length of 150 base pairs.

[0267] 2. Transcriptome data analysis

[0268] The raw transcriptome data obtained from cynomolgus macaque heart and human cardiomyocyte samples were processed by Trim Galore software (version 0.4.5) to remove low-quality reads and adapter-containing sequences. Subsequently, the cynomolgus macaque heart sample data were aligned to the cynomolgus macaque MacFas5.0 reference genome using HISAT2 software (version 2.0.4), and the human cardiomyocyte sample data were aligned to the human hg19 genome using HISAT2 software (version 2.0.4). HTSeq (version 0.11.0) was used to determine the expression level corresponding to each gene. The number of fragments per kilobase (FPKM) of each gene was calculated by StringTie (version 2.1.4). The R package DESeq2 (version 1.22.2) was used to identify differentially expressed genes (DEGs). Referring to previous studies involving transcriptomes of different tissues in cynomolgus macaques, the thresholds for DEGs between old and young cynomolgus macaque hearts were P < 0.01 and |log2(foldchange)|> 0.5. For DEGs between SIRT2-deficient human cardiomyocytes and wild-type controls, the criteria were set as Benjamini-Hochberg corrected P < 0.01 and |log2(fold change)| > 0.5.

[0269] 3. Pathway enrichment analysis

[0270] Pathway enrichment analysis was performed using Metascape.

[0271] The STAT3 target gene list was obtained from the TRRUST database.

[0272] 2. Experimental Results

[0273] 1. Changes in transcriptional profile of human cardiomyocytes with SIRT2 deficiency

[0274] In order to explore the molecular basis of SIRT2's anti-aging effect in cardiomyocytes, the present invention further studied the changes in transcriptional profiles caused by SIRT2 deficiency and compared them with the changes in the hearts of aged cynomolgus monkeys at the tissue level ( Figure 4 Middle ab, Fig.10 a, c). Comparing SIRT2-deficient human cardiomyocytes with wild-type controls, the present invention identified 1,753 upregulated and 1,981 downregulated differentially expressed genes (DEGs) ( Figure 4 In SIRT2-deficient human cardiomyocytes, the upregulated DEGs were mainly related to hypertrophic cardiomyopathy, MAPK signaling pathway, PI3K-Akt pathway, and apoptosis, while the downregulated DEGs were mainly related to tissue morphogenesis, lipid metabolism, and Wnt signaling ( Figure 4 Medium c and Fig.10 b), which is consistent with the perturbed transcriptional events in the aged cynomolgus monkey heart ( Figure 4 Medium c and Fig.10 Meanwhile, gene set enrichment analysis showed that calcium signaling pathways were upregulated in both SIRT2-deficient human cardiomyocytes and aged cynomolgus monkey hearts ( Fig.10 (e)

[0275] 2. STAT3 is a key regulatory factor mediating transcriptional disorders caused by SIRT2 deficiency

[0276] In order to further clarify the potential core transcription factors involved in transcriptional perturbations in human cardiomyocytes lacking SIRT2, the present invention constructed a transcriptional regulatory network using the TRRUST database ( Figure 4 Among them, the key pro-inflammatory factor STAT3 and the aging regulator TP53 were identified as the core transcription factors that regulate the up-regulated DEGs in SIRT2-deficient human cardiomyocytes ( Figure 4 STAT3, along with other well-known inflammatory regulators CEBPB, STAT1, and SP1, was also identified as a core transcription factor regulating cardiac DEGs in aged cynomolgus monkeys ( Figure 4 Zhongehe Fig.10 f). Notably, STAT3 was the only transcription factor regulating DEGs in SIRT2-deficient human cardiomyocytes and aged cynomolgus monkey hearts of both sexes ( Figure 4 Medium f, Fig.12 In addition, STAT3 target genes (such as senescence-inducing factors CDKN2B and CDKN1A) are mainly related to cell senescence, cytokine signaling pathways of the immune system, and MAPK cascades ( Figure 4 gh), which have been reported to be activated in aged cardiomyocytes.

[0277] Example 4: SIRT2 interacts with STAT3 and deacetylates STAT3 at lysine 685

[0278] 1. Experimental Methods

[0279] 1. Construction of plasmid

[0280] Human SIRT2 cDNA was obtained by PCR amplification from human cardiomyocytes (total RNA was extracted from human cardiomyocytes, total cDNA was obtained by reverse transcription, and cDNA was used as a template to amplify human FLAG-SIRT2-OE-F and FLAG-SIRT2-OE-R by PCR). The human FLAG-SIRT2 cDNA was ligated into the pLE4 vector using the plus One-step PCR cloning kit (Novoprotein, #NR005) to obtain the human FLAG-SIRT2-WT vector.

[0281] The human FLAG-SIRT2-H187Y vector was obtained using the human FLAG-SIRT2-WT vector using the Fast Mutagenesis System (Transgen biotech, #FM111-02). The human FLAG-SIRT2-H187Y vector is a vector obtained by mutating the 559th base C of the SIRT2 protein encoding gene sequence on the human FLAG-SIRT2-WT vector to the base U.

[0282] Human SIRT2 cDNA was obtained by PCR amplification from human cardiomyocytes (total RNA was extracted from human cardiomyocytes, total cDNA was obtained by reverse transcription, and cDNA was used as a template to amplify human HA-SIRT2 cDNA using HA-SIRT2-OE-F and HA-SIRT2-OE-R). The human HA-SIRT2 cDNA was ligated into the pLE4 vector using the plus One-step PCR cloning kit (Novoprotein, #NR005) to obtain the human HA-SIRT2-WT vector.

[0283] The human HA-SIRT2-H187Y vector was obtained using the human HA-SIRT2-WT vector using the Fast Mutagenesis System (Transgen biotech, #FM111-02). The human HA-SIRT2-H187Y vector is a vector obtained by mutating the 559th base C of the SIRT2 protein encoding gene sequence on the human HA-SIRT2-WT vector to the base U.

[0284] Human STAT3 cDNA was obtained by PCR amplification from human cardiomyocytes (total RNA was extracted from human cardiomyocytes, total cDNA was obtained by reverse transcription, and cDNA was used as a template to amplify human FLAG-STAT3-OE-F and FLAG-STAT3-OE-R by PCR). The human FLAG-STAT3 cDNA was ligated into the pLE4 vector using the plus One-step PCR cloning kit (Novoprotein, #NR005) to obtain the human FLAG-STAT3-WT vector.

[0285] The human FLAG-STAT3-K685R vector was obtained using the human FLAG-STAT3-WT vector using the Fast Mutagenesis System (Transgen biotech, #FM111-02). The human FLAG-STAT3-K685R vector is a vector obtained by mutating the 2054th base of the STAT3 protein encoding gene sequence on the human FLAG-STAT3-WT vector from base A to base G.

[0286] For lentiviral shRNA-mediated gene knockdown, the human shSIRT2 coding sequence (double-stranded DNA sequence formed by annealing shSIRT2-F and sh-SIRT2-R) was cloned into the pLVTHM vector (Addgene, #12247) to obtain the human shSIRT2 vector. The shSIRT2 vector can express shSIRT2, and the RNA sequence of shSIRT2 is CAGCGCGTTTCTTCTCCTGTA.

[0287] The sequences of FLAG-SIRT2-OE-F and FLAG-SIRT2-OE-R are as follows:

[0288] FLAG-SIRT2-OE-F: 5'-ACTCTAGAGGATCCCTCGAGATGGACTACAAGGACGACGACGACAAGGGCGCAGAG CCAGACCCCTCTCA-3';

[0289] FLAG-SIRT2-OE-R: 5'-GGTTGATTGTCGACACGCGTTCACTGGGGTTTCTCCCTCT-3'; FLAG-STAT3-OE-F and FLAG-STAT3-OE-R sequences are as follows:

[0290] FLAG-STAT3-OE-F: 5'-ACTCTAGAGGATCCCTCGAGATGGACTACAAGGACGACGACGACAAGGGCGCCCAA TGGAATCAGCTACAGCAGCTT-3';

[0291] FLAG-STAT3-OE-R: 5'-GGTTGATTGTCGACACGCGTTCACATGGGGGAGGTAGCGCACT-3';

[0292] The sequences of HA-SIRT2-OE-F and HA-SIRT2-OE-R are as follows:

[0293] HA-SIRT2-OE-F: 5'-ACTCTAGAGGATCCCTCGAGATGTACCCATACGACGTCCCAGACTACGCTGCAGAGC CAGACCCTCTCCA-3';

[0294] HA-SIRT2-OE-R: 5'-GGTTGATTGTCGACACGCGTTCACTGGGGTTTCTCCCCT-3';

[0295] The sequences of SIRT2-H187Y-F and SIRT2-H187Y-R are as follows:

[0296] SIRT2-H187Y-F: 5'-TTGGTGGAGGCGTACGGCACCTTCTACAC-3';

[0297] SIRT2-H187Y-R: 5'-ACGCCTCCACCAAGTCCTCCTTGTTCCAGCC-3';

[0298] The sequences of STAT3-K685R-F and STAT3-K685R-R are as follows:

[0299] STAT3-K685R-F: 5'-GGAGGCATTCGGAAGGTATTGTCGGCCAG-3';

[0300] STAT3-K685R-R: 5'-CTTCCGAATGCCTCCTCCTTGGGAATGTCAG-3';

[0301] The sequences of shGL2-F and shGL2-R are as follows:

[0302] shGL2-F: 5'-CGCGTGCGTACGCGGAATACTTCGATTCAAGAGATCGAAGTATTCCGCGTACGCTTTTTTGGAAAT-3';

[0303] shGL2-R: 5'-CGATTTCCAAAAAAGCGTACGCGGAATACTTCGATCTCTTGAATCGAAGTATTCCGCGTACGCA-3';

[0304] The sequences of shSIRT2-F and sh-SIRT2-R are as follows:

[0305] shSIRT2-F: 5'-CGCGTGCAGCGCGTTTCTTCTCCTGTATTCAAGAGATACAGGAGAAGAAACCGGCTG CTTTTTTGGAAAT-3';

[0306] shSIRT2-R: 5'-CGATTTCCAAAAAAGCAGCGCGTTTCTTCTCCTGTATCTCTTGAATACAGGAGAAGAA ACGCGCTGCA-3'.

[0307] 2. Lentivirus packaging

[0308] (1) 10 μg of lentiviral plasmid, 10 μg of psPAX2 plasmid and 3 μg of pMD2.G plasmid were co-transfected into HEK293T cells in a 10 cm dish using Lipo3000 transfection kit (Thermo Fisher Scientific). After 8 hours of culture, the culture medium was replaced with new one.

[0309] (2) Collect the supernatant at 24 h, 48 h, and 72 h, filter using a 0.22 μm filter, and store the filtered viral supernatant at 4 °C.

[0310] (3) Centrifuge at 19400 rpm and 4°C for 2.5 h, discard the supernatant, resuspend in myocardial culture medium, obtain recombinant lentivirus, and store in aliquots at -80°C.

[0311] (4) For virus titration, overexpression virus and shRNA virus were detected by immunostaining.

[0312] 3. LC-MS / MS analysis and peptide identification

[0313] In order to identify the interacting proteins of SIRT2, the present invention performed LC-MS / MS analysis. The specific steps are as follows: first, HEK293T cells were transfected with a plasmid expressing FLAG-luciferase (Luc) or FLAG-SIRT2, and then FLAG-Luc or FLAG-SIRT2 was purified and incubated with cynomolgus monkey heart lysate. The protein eluted by immunoprecipitation was run using 10% SDS-PAGE and stained with Coomassie Brilliant Blue (Beijing Dingguo Changsheng Biotechnology Co., Ltd., #WB-0101). The gel band containing the protein band was carefully cut out, cut into small pieces, dehydrated (100% acetonitrile), reduced (10mMDTT in 25mM NH4HCO3, at 56°C, 45 minutes), and alkylated (40mM iodoacetamide in 25mM NH4HCO3, room temperature, protected from light, 45 minutes). Next, the small pieces of gel strips were dried and digested with sequencing grade modified trypsin (40 ng per strip) in 25 mM NH4HCO3 at 37°C overnight. The digestion was terminated by adding formic acid at a final concentration of 1%. The digested solution was then carefully transferred to a sample vial for LC-MS / MS analysis.

[0314] High-resolution mass spectrometry data were acquired at 70,000 (m / z 200) using a Q Exactive mass spectrometer (Thermo Scientific). Protein identification was performed using Proteome Discovery (version 2.2.0.388) and peptide data were searched using the UniProtMacacafascicularis database (updated in October 2017).

[0315] 4. Co-IP Experiment

[0316] For exogenous Co-IP experiments, HEK293T cells were transfected with plasmids expressing FLAG-luciferase (Luc), FLAG-SIRT2-WT plasmids, FLAG-SIRT2-H187Y plasmids, or FLAG-STAT3-WT plasmids. Transfected HEK293T cells were lysed using CHAPS lysis buffer (120 mM NaCl, 0.3% CHAPS, 40 mM HEPES (pH 7.5), 1 mM EDTA, and complete protease inhibitor cocktail (Roche)). For exogenous acetylation Co-IP experiments, HEK293T cells were transfected with FLAG-STAT3-WT plasmids or FLAG-STAT3-K685R plasmids, and HA-Luc, HA-SIRT2-WT plasmids, or HA-SIRT2-H187Y plasmids were added. Transfected HEK293T cells were lysed with whole cell lysis buffer (50 mM Tris-HCl (pH 7.8), 137 mM NaCl, 1 mM NaF, 1 mM NaVO3, 1% Triton X-100, 0.2% sarkosyl, 1 mM DTT, 10% glycerol, complete protease inhibitor cocktail (Roche), 5 mM nicotinamide (NAM, Sigma, #N0636) and 10 μM trichostatin A (TSA, Sigma, #V900931). Lysed cells were rotated at 4°C for 2 hours and then centrifuged at 12,000×g for 30 minutes at 4°C. The resulting supernatant was quantified and gently mixed with anti-FLAG M2 affinity gel (Sigma, #A2220) and rotated at 4°C overnight. The interacting protein complexes captured by anti-FLAG affinity gel were competitively eluted with FLAG-peptide and then analyzed by Western blotting.

[0317] For endogenous Co-IP, human cardiomyocytes (SIRT2 + / + or SIRT2 - / -Human cardiomyocytes) or monkey heart tissue (young or old) were lysed using NP40 lysis buffer (50mM Tris-HCl (PH7.5), 150mM NaCl, 10% glycerol, 1% NP40, 1mM PMSF and complete protease inhibitor cocktail (Roche)); for endogenous acetylated Co-IP, 20mM NAM and 4μM TSA were added to the above NP40 lysis buffer and lysed at 4°C for 2 hours, followed by centrifugation at 4°C, 12,000×g for 30 minutes. The quantified supernatant was incubated with anti-SIRT2 antibody (Proteintech, #19655-1-AP) or anti-STAT3 antibody (CST, #9139s) or anti-acetylated lysine antibody (CST, #9441s) and rotated overnight at 4°C. Normal mouse IgG (Santa Cruz, #sc-2025) or normal rabbit IgG (CST, #2729s) was used as negative control. After lysis overnight, the protein antibody mixture was incubated with Protein A / G-PLUS agarose beads (Santa Cruz, #sc-2003) at 4°C for 2 hours with rotation. Finally, protein samples were collected for Western blotting analysis, and samples from the same group of cynomolgus monkeys were combined for Western blotting analysis.

[0318] 5. Western blotting experiment

[0319] For the extraction of cell proteins, the cultured cells were directly lysed using 1× SDS lysis buffer. After centrifugation at 13000rpm and 4°C for 15 minutes, the protein supernatant was carefully collected, and the protein concentration was determined using a BCA kit, and the protein lysate was subjected to SDS-PAGE. After electrophoresis and transfer, the PVDF membrane (Millipore) was blocked with TBST containing 5% skim milk powder (BBI Life Sciences), washed 3 times with TBST for 10 minutes each time, incubated with primary antibody at 4°C overnight, and then incubated with enzyme-labeled secondary antibody at room temperature for 1 hour. After washing 3 times with TBST for 10 minutes each time, the ChemiDoc XRS system (Bio-Rad) and Image Lab software were used for development and photography, and the acquired images were quantified using ImageJ software.

[0320] 2. Experimental Results

[0321] 1. SIRT2 protein interacts with STAT3

[0322] In order to verify whether the activity of STAT3 is regulated by SIRT2, the present invention uses co-immunoprecipitation (Co-IP) combined with mass spectrometry to identify SIRT2-interacting proteins ( Figure 5 In addition to the known protein partners of SIRT2 (such as ANXA1), a few transcription factors that directly interact with SIRT2 were also identified, and STAT3 was one of them ( Figure 5 b). To further confirm the interaction between SIRT2 and STAT3, FLAG-tagged SIRT2 plasmid or FLAG-tagged STAT3 plasmid was transferred into HEK293T cells for exogenous Co-IP experiment verification. The exogenous Co-IP results showed that STAT3 and SIRT2 can interact ( Figure 5 Medium c and Figure 5 In addition, the present invention also uses SIRT2 antibody or STAT3 antibody in SIRT2 + / + Endogenous Co-IP experiments were performed in human cardiomyocytes, and the experimental results further confirmed that SIRT2 and STAT3 interact with each other ( Figure 5 Zhongehe Figure 5 (f)

[0323] 2. SIRT2 can deacetylate STAT3

[0324] Since SIRT2 is a NAD + In order to study whether SIRT2 can recognize STAT3 as its deacetylation substrate, the present invention simultaneously transferred FLAG-tagged STAT3-WT plasmid and HA-tagged Luc plasmid or HA-tagged SIRT2-WT plasmid into HEK293T cells. Co-IP results showed that overexpression of HA-SIRT2-WT could reduce the acetylation level of STAT3 ( Figure 5 Medium g and Figure 5 This suggests that SIRT2 can deacetylate STAT3.

[0325] 3. SIRT2-H187Y mutant cannot deacetylate STAT3

[0326] Furthermore, by point mutation, the histidine at position 187 of SIRT2 was mutated to tyrosine, generating the deacetylase activity mutant of SIRT2, SIRT2-H187Y. Based on the above experiments, the FLAG-tagged STAT3-WT plasmid, as well as the HA-tagged Luc plasmid or the HA-tagged SIRT2-WT plasmid or the HA-tagged SIRT2-H187Y (deacetylase activity mutant of SIRT2) plasmid were transferred into HEK293T cells. The results of Co-IP showed that overexpression of HA-SIRT2-WT could reduce the acetylation level of STAT3, but the HA-SIRT2-H187Y mutant could not reduce the acetylation level of STAT3 ( Figure 5 Medium g and Figure 5 i).

[0327] 4. SIRT2 can deacetylate STAT3 at Lys685

[0328] Since previous studies have found that STAT3 can be acetylated at lysine 685, in order to study whether SIRT2 will deacetylate STAT3 at lysine 685, the present invention converts the lysine (Lys685) at position 685 of the FLAG-tagged STAT3 plasmid into arginine (K685R) by point mutation, and co-transfects it with the HA-tagged Luc plasmid or the HA-tagged SIRT2-WT plasmid into HEK293T cells. Co-IP results show that the STAT3-K685R mutant cannot be deacetylated by SIRT2, while STAT3-WT can be deacetylated by SIRT2 ( Figure 5 Medium g and Figure 5 In summary, these results suggest that SIRT2 can deacetylate STAT3 through the lysine 685 site, thereby regulating the activity of STAT3.

[0329] 5. STAT3 acetylation levels in human cardiomyocytes with SIRT2 deletion and / or knockdown are increased and are not sex-specific

[0330] Since SIRT2 and STAT3 interact, the present invention further detected whether the level of STAT3 protein in human cardiomyocytes lacking SIRT2 changed. First, the transcriptome of human cardiomyocytes lacking SIRT2 was analyzed. The results showed that the level of STAT3 protein in human cardiomyocytes lacking SIRT2 changed. + / + Compared with the control group, at the transcriptome level, there was no significant difference in STAT3 levels in human cardiomyocytes lacking SIRT2 ( Fig.11 Furthermore, RT-qPCR and Western blotting experiments confirmed the interaction with SIRT2. + / +There was no significant difference in the transcription (gene) and protein levels of STAT3 in SIRT2-deficient human cardiomyocytes ( Fig.11 b and c).

[0331] Since SIRT2 can deacetylate STAT3, in order to study whether SIRT2 deficiency will lead to upregulation of acetylated STAT3 levels, the present invention uses acetylation antibody (anti-Ac-K) in SIRT2 + / + and SIRT2 - / - Endogenous acetylation Co-IP experiments were performed in human cardiomyocytes (female origin). The results showed that SIRT2 + / + Compared with the control group, human cardiomyocytes lacking SIRT2 had higher levels of acetylated STAT3 ( Figure 5 Furthermore, Western blotting experiments revealed that the level of acetylated STAT3-K685 in human cardiomyocytes lacking SIRT2 was significantly increased ( Figure 5 (middle l).

[0332] To further confirm whether the increase in STAT3 acetylation caused by SIRT2 deficiency is sex-specific, male human embryonic stem cells (male hESCs) and / or male human pluripotent stem cells (male iPSCs) were differentiated into human cardiomyocytes, and SIRT2 protein was knocked down in the cells using shSIRT2 ( Fig.14 The results showed that with the knockdown of SIRT2 protein, the level of BNP, a gene related to cardiac hypertrophy in human cardiomyocytes, was significantly upregulated ( Fig.14 b and d), and the protein level of acetylated STAT3-K685 was significantly upregulated ( Fig.14 e and f).

[0333] In summary, SIRT2 deficiency and / or knockdown does not cause changes in total STAT3 levels in human cardiomyocytes, but leads to upregulation of acetylated STAT3 levels, partly through the lysine 685 site (K685).

[0334] 6. STAT3 acetylation levels increase in aged non-human primate hearts and are not sex-specific

[0335] Since SIRT2 protein can regulate STAT3 activity through deacetylation at the cellular level, in order to study whether there is corresponding regulation at the tissue level, firstly, by analyzing the transcriptome and proteome of the heart, it was found that there was no significant difference in the transcriptome and proteome levels of STAT3 in the hearts of young and old cynomolgus monkeys ( Fig.11Furthermore, the same trend was confirmed by RT-qPCR and Western blotting experiments ( Fig.11 This is consistent with the results found in cells, suggesting that the total level of STAT3 remains unchanged in the aged heart.

[0336] Next, the acetylation level of STAT3 in young and old non-human primate hearts was detected. First, acetylation Co-IP experiments were performed in young and old cynomolgus monkey hearts using STAT3 antibodies (anti-STAT3). The results showed that compared with the young group, the level of acetylated STAT3 in the hearts of old cynomolgus monkeys was significantly increased ( Figure 5 Furthermore, Western blotting experiments revealed that acetylated STAT3-K685 significantly increased in the hearts of aged cynomolgus monkeys ( Figure 5 In order to further confirm whether the increase in STAT3 acetylation levels in the hearts of aged non-human primates is sex-specific, female and male (4 in each young and old group) cynomolgus monkey hearts were subjected to Co-IP experiments for acetylated STAT3. The results showed that compared with the young female cynomolgus monkeys, the acetylated STAT3 levels in the aged female cynomolgus monkeys were significantly increased ( Fig.13 Similarly, compared with the young group of male cynomolgus monkeys, the level of acetylated STAT3 in the old group of male cynomolgus monkeys was significantly increased ( Fig.13 (c).

[0337] The above results show that the total STAT3 level in aged non-human primates remains unchanged, but the acetylated STAT3 level increases significantly and is not gender specific.

[0338] Example 5: Acetylated STAT3-mediated CDKN2B activation can induce senescence of human cardiomyocytes

[0339] 1. Experimental Methods

[0340] 1. RT-qPCR

[0341] Total RNA was extracted from cells using TRIzol reagent (Thermo Fisher Scientific), and then reverse transcribed to synthesize cDNA using the GoScript reverse transcription kit (Promega), followed by RT-qPCR using Thunderbird qPCR Mix reagent and Real-Time System (Bio-Rad Laboratories, Inc. or Thermo Fisher Scientific). The primer sequences for RT-qPCR are shown in Tables 4 and 5.

[0342] Table 4: Primer sequences for human RT-qPCR

[0343] sequence name Nucleotide sequence (5'-3') GAPDH-Forward TCGGAGTCAACGGATTTGGT GAPDH-Reverse TTGCCATGGGTGGAATCATA CDKN2B-Forward AGGAAAAGCCCGGAGCTAAC CDKN2B-Reverse CATCATCATGACCTGGATCGC STAT3-Forward CATATGCGGCCAGCAAAGAA STAT3-Reverse ATACCTGCTCTGAAGAAACT BNP-Forward TGGAAACGTCCGGGTTACAG BNP-Reverse CTGATCCGGTCCATCTTCCT

[0344] Table 5: Primer sequences for RT-qPCR in cynomolgus monkeys

[0345] sequence name Nucleotide sequence (5'-3') GAPDH-Forward TCGGAGTCAACGGATTTGGT GAPDH-Reverse TTGCCATGGGTGGAATCATA CDKN2B-Forward CGCTGTAGCAAACTCAGTGC CDKN2B-Reverse TCTGCACCCTGAGACACTCT STAT3-Forward CATATGCGGCCAGCAAAGAA STAT3-Reverse ATACCTGCTCTGAAGAAACT

[0346] 2. Western blotting experiment

[0347] For the extraction of cell proteins, the cultured cells were directly lysed using 1× SDS lysis buffer. After centrifugation at 13000rpm and 4°C for 15 minutes, the protein supernatant was carefully collected, and the protein concentration was determined using a BCA kit, and the protein lysate was subjected to SDS-PAGE. After electrophoresis and transfer, the PVDF membrane (Millipore) was blocked with TBST containing 5% skim milk powder (BBI Life Sciences), washed 3 times with TBST for 10 minutes each time, incubated with primary antibody at 4°C overnight, and then incubated with enzyme-labeled secondary antibody at room temperature for 1 hour. After washing 3 times with TBST for 10 minutes each time, the ChemiDoc XRS system (Bio-Rad) and Image Lab software were used for development and photography, and the acquired images were quantified using ImageJ software.

[0348] 3. Chip-qPCR

[0349] The cells were collected, washed twice in PBS, and then cross-linked with 1% (vol / vol) formaldehyde in PBS for 12 minutes. 0.125M glycine was added and incubated at room temperature for 5 minutes to terminate cross-linking. After washing with PBS, the cells were lysed in lysis buffer (50mM Tris-HCl, 1% SDS, 10mM EDTA, pH 8.0) for 10 minutes. After lysis, the cells were sonicated with a Covaris S220 ultrasonic disruptor and centrifuged at 4°C, 12,000×g for 10 minutes. The supernatant was collected and incubated overnight at 4°C with Dynabeads protein A magnetic beads (Thermo Fisher Scientific, 10004D) and 2μg of STAT3 antibody (CST, 9139s) or rabbit IgG antibody (CST, 2729s). Elution and decoupling were performed by shaking at 68°C for 2 hours. DNA was then collected by phenol-chloroform-isoamyl alcohol extraction and ethanol precipitation, and then qPCR was used to detect the enrichment of STAT3 on the CDKN2B promoter. The primer sequences of Chip-qPCR are shown in Table 6.

[0350] Table 6: Primer sequences for Chip-qPCR

[0351] sequence name Nucleotide sequence (5'-3') ChIP-CDKN2B-site 1-Forward GGCTCAAGAATTGGGTCAGACT ChIP-CDKN2B-site 1-Reverse CACCTGGACAGGGAAGGGAA ChIP-CDKN2B-site 2-Forward TTTGAAAACCAGGTTGAGCAGG ChIP-CDKN2B-site 2-Reverse CACGGACAGCGCTTTGCTTAT ChIP-CDKN2B-site 3-Forward GTGAAATGTCATCTTTGAAGTCTGG ChIP-CDKN2B-site 3-Reverse CAGCTGTCATGGTAGGCTTAACT ChIP-CDKN2B-site 4-Forward TTTGCTGGCAAATATCAGACGCTGCTT ChIP-CDKN2B-site 4-Reverse ATGAACAGATCTGCCATCCTCTTTT

[0352] 4. Construction of plasmid

[0353] use plus One-step PCR cloning kit was used to connect human CDKN2B cDNA into the pLE4 vector to obtain the CDKN2B vector.

[0354] The sgCDKN2B oligonucleotides were cloned into the lentiCRISPRv2 vector (Addgene, #52961) to generate the sgCDKN2B vector.

[0355] The primer sequences used are as follows:

[0356] The sequences of CDKN2B-OE-F and CDKN2B-OE-R are as follows:

[0357] CDKN2B-OE-F: 5'-ATGGACTACAAGGACGACGACGACAAGGGCCGCGAGGAGAACAAGGG-3';

[0358] CDKN2B-OE-R: 5'-TTCAGTCCCCCGTGGCTGTGC-3';

[0359] The sequences of sgCDKN2B-F and sgCDKN2B-R are as follows:

[0360] sgCDKN2B-F: 5'-CACCGCGGGGCCACCGCGACGTTGC-3';

[0361] sgCDKN2B-R: 5'-AAACGCAACGTCGCGGTGGCCCCGC-3';

[0362] The sequences of sgNTC-F and sg-NTC-R are as follows:

[0363] sgNTC-F: 5'-CACCGACGGAGGCTAAGCGTCGCAA-3';

[0364] sgNTC-R: 5'-AAACTTGCGACGCTTAGCCTCCGTC-3'.

[0365] 5. Lentivirus packaging

[0366] (1) 10 μg of lentiviral plasmid, 10 μg of psPAX2 plasmid and 3 μg of pMD2.G plasmid were co-transfected into HEK293T cells in a 10 cm dish using Lipo3000 transfection kit (Thermo Fisher Scientific). After 8 hours of culture, the culture medium was replaced with new one.

[0367] (2) Collect the supernatant at 24 h, 48 h, and 72 h, filter using a 0.22 μm filter, and store the filtered viral supernatant at 4 °C.

[0368] (3) Centrifuge at 19400 rpm and 4°C for 2.5 h, discard the supernatant, resuspend in myocardial culture medium, obtain recombinant lentivirus, and store in aliquots at -80°C.

[0369] (4) For virus titration, overexpressed viruses were detected by immunostaining, and sgRNA viruses were detected by puromycin selection.

[0370] 6. Cell Immunofluorescence Staining

[0371] The cultured cells were fixed in 4% PFA for 20 minutes, washed twice with PBS, and permeabilized in 0.4% Triton X-100 / PBS for 30 minutes, and washed twice with PBS. After blocking with PBS containing 10% donkey serum at room temperature for 1 hour, the primary antibody was added and incubated overnight at 4°C, and the fluorescent secondary antibody was incubated at room temperature for 1 hour the next day, and the cell nucleus was stained with DNA-specific dye Hoechst33342 (Thermo Fisher Scientific), and finally the slide was sealed with fluorescent antifade (Vector Laboratories). Laser confocal (Leica TCS SP5 II or Zeiss LSM 900) was used for shooting.

[0372] 7. Cell SA-β-gal staining

[0373] The cultured cells were washed twice with PBS and fixed with 2% formaldehyde and 0.2% glutaraldehyde for 3-5 min at room temperature, and then stained in 1 mg / mL X-gal staining solution at 37°C overnight. Images were collected under a microscope (Nikon Eclipse or Olympus), and the percentage or intensity of SA-β-gal positive area or cells was calculated using ImageJ.

[0374] 2. Experimental Results

[0375] 1. Discovery of the common target gene CDKN2B

[0376] Through the combined analysis of STAT3 target genes, SIRT2-deficient human cardiomyocyte DEGs, and aged cynomolgus monkey heart DEGs, it was speculated that CDKN2B may be one of the key target genes regulated by the SIRT2-STAT3 axis ( Figure 6 Middle a). CDKN2B encodes p15 INK4b , is a cell cycle-dependent kinase inhibitor.

[0377] 2. CDKN2B transcription level is significantly upregulated in SIRT2-deficient cardiomyocytes

[0378] Transcriptome data analysis showed that compared with wild-type controls, the expression level of CDKN2B was significantly upregulated in SIRT2-deficient cardiomyocytes ( Figure 6 (b)

[0379] Furthermore, RT-qPCR experiments confirmed that the transcription level of CDKN2B in human cardiomyocytes lacking SIRT2 was significantly increased ( Figure 6 (d)

[0380] 3. CDKN2B transcription levels are significantly upregulated in aged non-human primate hearts

[0381] Transcriptome data analysis showed that CDKN2B expression levels were significantly upregulated in the hearts of aged cynomolgus monkeys compared with young controls ( Figure 6 (c).

[0382] Furthermore, RT-qPCR experiments confirmed that CDKN2B transcription levels in aged non-human primates were significantly increased ( Figure 6 (e)

[0383] 4. CDKN2B protein levels are significantly upregulated in human cardiomyocytes with SIRT2 deletion and / or knockdown, and this is not gender specific

[0384] Western blotting was used to detect SIRT2 + / + and SIRT2 - / - The protein level of CDKN2B in human cardiomyocytes (female origin) was verified. The results showed that it was related to SIRT2 + / + Compared with the human cardiomyocyte group, the CDKN2B protein level in SIRT2-deficient human cardiomyocytes was significantly upregulated ( Figure 6 (f)

[0385] To further confirm whether the increase in CDKN2B levels caused by SIRT2 deficiency is sex-specific, human cardiomyocytes differentiated from male human embryonic stem cells (male hESCs) and / or male human pluripotent stem cells (male iPSCs) were knocked down with shSIRT2, and the CDKN2B protein level of the cells was detected. The results showed that compared with the control group (shGL2), SIRT2 knockdown could lead to a significant upregulation of CDKN2B protein in human cardiomyocytes ( Fig.14 Medium g and Fig.14 h).

[0386] The above results suggest that SIRT2 deficiency and / or knockdown will lead to upregulation of CDKN2B protein levels in human cardiomyocytes, and this is not gender specific.

[0387] 5. CDKN2B protein levels are significantly upregulated in the hearts of aged non-human primates, and this is not gender specific

[0388] Western blotting was used to verify the protein level of CDKN2B in the hearts of young and old cynomolgus monkeys. The results showed that compared with the young group, the protein level of CDKN2B in the hearts of old non-human primates was significantly upregulated ( Figure 6 (g).

[0389] To further confirm whether the increase in CDKN2B protein levels in the hearts of aged non-human primates is sex-specific, CDKN2B protein levels were detected in females and males (4 in each of the young and old groups). Western blotting results showed that compared with the young female cynomolgus monkeys, the CDKN2B protein level in the aged female cynomolgus monkeys was significantly increased; compared with the young male cynomolgus monkeys, the CDKN2B protein level in the aged male cynomolgus monkeys was significantly increased ( Fig.13 (d)

[0390] The above results suggest that the CDKN2B protein level in the hearts of aged non-human primates is significantly increased and is not gender specific.

[0391] 6. Acetylated STAT3 mediates CDKN2B activation

[0392] To further confirm whether CDKN2B expression is directly regulated by STAT3, we + / +) were used to perform chromatin immunoprecipitation (ChIP) and quantitative PCR (qPCR) experiments (ChIP-qPCR) in human cardiomyocytes. First, through the analysis of the JASPAR transcription factor database, four predicted STAT3 transcription factor binding sites were found on the promoter of CDKN2B ( Figure 6 h). Furthermore, ChIP-qPCR experiments revealed that in human cardiomyocytes transduced with wild-type STAT3 (STAT3-WT), STAT3 enrichment was observed on the CDKN2B promoter, whereas in human cardiomyocytes transduced with the acetylation mutant of STAT3 (STAT3-K685R), this enrichment was abolished ( Figure 6 i).

[0393] At the same time, RT-qPCR and Western blotting experiments revealed that SIRT2 + / + Overexpression of wild-type STAT3 (STAT3-WT) in human cardiomyocytes can increase the transcription and protein levels of CDKN2B; however, transduction of mutant STAT3 (STAT3-K685R) does not cause an increase in CDKN2B. Figure 6 Middle J, Figure 6 Medium K and Fig.12 (e)

[0394] The above results suggest that acetylation is essential for the transcriptional activation of CDKN2B by STAT3 in human cardiomyocytes.

[0395] 7. Overexpression of CDKN2B can lead to senescence of human cardiomyocytes

[0396] To further explore whether CDKN2B, as a downstream effector molecule of SIRT2-STAT3 axis, can regulate the aging of human cardiomyocytes, CDKN2B was overexpressed in wild-type human cardiomyocytes by introducing CDKN2B vector. Western blotting results showed that CDKN2B protein was upregulated ( Fig.15 Middle a, Fig.15 Medium b and Fig.15 cTnT and SA-β-gal staining results showed that compared with the FLAG-Luc group (control group), the volume of human cardiomyocytes in the CDKN2B overexpression group was enlarged ( Fig.15 c), and the proportion of SA-β-gal positive cells increased ( Fig.15 (d)

[0397] On the contrary, the present invention also knocked down the expression of CDKN2B in human cardiomyocytes lacking SIRT2. The results of Western blotting showed that the expression of CDKN2B was downregulated ( Figure 7 a, b and Fig.15 cTnT and SA-β-gal staining results showed that compared with the FLAG-Luc group, the volume of human cardiomyocytes in the CDKN2B knockdown group was reduced ( Figure 7 c), and the SA-β-gal positive signal area decreased ( Figure 7 (d)

[0398] The above results indicate that CDKN2B is a key downstream factor in primate cardiomyocyte aging caused by SIRT2 deficiency.

[0399] 8. SIRT2 replenishment can rescue human cardiomyocyte senescence caused by SIRT2 deficiency

[0400] In order to investigate whether SIRT2 regulates the activity of the STAT3-CDKN2B pathway in an acetylation-dependent manner, the functional effects of wild-type SIRT2 (SIRT2-WT) and SIRT2-H187Y (a mutant with deacetylase activity defect) were compared in human cardiomyocytes. Figure 7 e). The results showed that in human cardiomyocytes lacking SIRT2, overexpression of wild-type SIRT2 reduced the expression level of CDKN2B; however, overexpression of mutant SIRT2-H187Y could not reduce the expression of CDKN2B ( Figure 7 In addition, reintroduction of wild-type SIRT2 into SIRT2-deficient human cardiomyocytes rescued the hypertrophic phenotype of the cells and reduced the proportion of SA-β-gal-positive cells; however, introduction of mutant SIRT2-H187Y could not reduce the hypertrophic phenotype of the cells and the proportion of SA-β-gal-positive cells ( Figure 7 Medium g and Figure 7 h).

[0401] Example 6: Intramyocardial injection of lentivirus expressing SIRT2 can improve cardiac dysfunction in aged mice

[0402] 1. Experimental Methods

[0403] 1. Plasmid construction

[0404] Plasmid expressing SIRT2: Mouse SIRT2 cDNA was obtained by PCR amplification from mouse heart tissue (total RNA was extracted from mouse heart tissue, total cDNA was obtained by reverse transcription, and cDNA was used as a template to amplify mouse SIRT2 cDNA by PCR using FLAG-SIRT2-OE-F and FLAG-SIRT2-OE-R). plus One-step PCR cloning kit (Novoprotein, #NR005) to connect mouse SIRT2 cDNA into the pLE4 empty vector to obtain a plasmid expressing SIRT2. The sequences of FLAG-SIRT2-OE-F and FLAG-SIRT2-OE-R are as follows:

[0405] FLAG-SIRT2-OE-F: 5'-ACTCTAGAGGATCCCTCGAGATGGACTACAAGGACGACGACGACAAGGGCGCCGAG CCGGACCCCT-3';

[0406] FLAG-SIRT2-OE-R: 5'-GGTTGATTGTCGACACGCGTTTACTGCTGTTCCTCTTTCTCTT-3'.

[0407] Plasmid expressing luciferase: FLAG-Luciferase (Luc) plasmid.

[0408] 2. Lentivirus packaging

[0409] (1) 10 μg of lentiviral plasmid, 10 μg of psPAX2 plasmid and 3 μg of pMD2.G plasmid were co-transfected into 293T cells in a 10 cm dish using Lipo3000 transfection kit (Thermo Fisher Scientific). After 8 hours of culture, the culture medium was replaced with new one.

[0410] (2) Collect the supernatant at 24 h, 48 h, and 72 h, filter using a 0.22 μm filter, and store the filtered viral supernatant at 4 °C.

[0411] (3) Centrifuge at 19400 rpm and 4°C for 2.5 hours, discard the supernatant, resuspend in myocardial culture medium, obtain recombinant lentivirus, and store in aliquots at -80°C.

[0412] (4) For virus titration, overexpressed virus was detected by immunostaining.

[0413] 3. Intramyocardial Lentivirus Injection in Mice

[0414] Experimental groups and test mice:

[0415] Young-lenti-Luc group: 14 2-month-old male C57BL6 / J mice;

[0416] Aged-lenti-Luc group: 9 24-month-old male C57BL6 / J mice;

[0417] Aged-lenti-SIRT2 group: 10 male C57BL6 / J mice aged 24 months.

[0418] Each group of mice was anesthetized by inhalation of 2% isoflurane. The hair on the chest was removed with a depilatory cream, and then a left thoracotomy was performed. The pectoralis minor and major muscles were carefully dissected, and the heart was exposed through the fourth intercostal space. A 30G syringe (5×10 6 TU / 30 μL / mouse) were injected into the left ventricle at three points with lentivirus expressing luciferase (Luc) or SIRT2, and then the chest cavity was quickly closed with pre-placed purse-string sutures.

[0419] 4. Echocardiographic analysis

[0420] Cardiac function by transthoracic echocardiography was examined using the Vevo LAZR imaging system (Visual sonic, Inc.). Mice were anesthetized by inhalation of 2% isoflurane. M-mode echocardiography was obtained by placing the M-mode axis at the middle level of the parasternal short axis (PSAX) view. Left ventricular ejection fraction (EF) and fractional shortening (FS) were calculated by measuring three consecutive cardiac cycles.

[0421] 5. H&E and tissue immunofluorescence staining

[0422] The dyeing method is the same as in Example 1.

[0423] 2. Experimental Results

[0424] 1. SIRT2 protein levels increased in the hearts of mice injected intramyocardially with lentivirus expressing SIRT2

[0425] In order to study whether SIRT2 supplementation and / or overexpression can achieve preventive or therapeutic effects in the process of cardiac aging, the present invention injected a lentivirus expressing SIRT2 into the heart of aged mice by intramyocardial injection ( Figure 7 i).

[0426] Compared with control mice injected with lentivirus expressing luciferase (lenti-Luc), SIRT2 protein was increased in the hearts of mice injected intramyocardially with lentivirus expressing SIRT2 ( Figure 7 (j), which demonstrates that SIRT2 protein expression is increased in mouse hearts.

[0427] 2. Intramyocardial injection of lentivirus expressing SIRT2 can improve age-related cardiac dysfunction in mice

[0428] The present invention uses transthoracic echocardiography to examine whether intramyocardial injection of a lentivirus expressing SIRT2 can improve age-related cardiac dysfunction in mice.

[0429] The results showed that compared with young control mice injected with lentivirus expressing luciferase (young-lenti-Luc), the ejection fraction (EF) and short-axis shortening rate (FS) of old mice injected with lentivirus expressing luciferase (aged-lenti-Luc) were significantly decreased; however, the ejection fraction (EF) and short-axis shortening rate (FS) of old mice injected with lentivirus expressing SIRT2 (aged-lenti-SIRT2) were significantly increased two weeks after virus injection ( Figure 7 Middle k). This indicates that intramyocardial injection of lentivirus expressing SIRT2 can improve age-related cardiac dysfunction in mice.

[0430] 3. Intramyocardial injection of lentivirus expressing SIRT2 can shrink the cardiomyocytes of aged mice

[0431] The results of HE staining and WGA / cTnT staining showed that compared with young control mice injected with lentivirus expressing luciferase (young-lenti-Luc), the cardiomyocytes of old mice injected with lentivirus expressing luciferase were significantly enlarged (aged-lenti-Luc); however, the cardiomyocytes of old mice injected with lentivirus expressing SIRT2 (aged-lenti-SIRT2) were significantly reduced two weeks after injection ( Figure 7 Zhongl and Figure 7 (m).

[0432] The above results indicate that intramyocardial injection of lentivirus expressing SIRT2 can improve cardiac dysfunction in aged mice. SIRT2 is a key cardiac protective factor in cardiac aging. The experimental results of the present invention also provide direct evidence for rejuvenating the naturally aged mouse heart by supplementing SIRT2.

Claims

1. Use of a substance that regulates the SIRT2-STAT3-CDKN2B signaling pathway in any of the following A1)-A4): A1) Delaying the aging of the body, organs, tissues or cells; A2) Preparation of products that delay aging of the body, organs, tissues or cells; A3) Improve the functional disorders of the aging body, organs, tissues or cells; A4) Preparation of products for improving dysfunction of aging organisms, organs, tissues or cells; The substance regulating the SIRT2-STAT3-CDKN2B signaling pathway includes substance R and / or substance S and / or substance T; The substance R is SIRT2 protein or a substance that increases the activity and / or content of SIRT2 protein; The substance S is a substance that reduces the acetylation level of STAT3 protein; The substance T is a substance that reduces the activity and / or content of CDKN2B protein.

2. A product, the active ingredient of which is a substance that regulates the SIRT2-STAT3-CDKN2B signaling pathway; the function of the product is any one of the following B1) or B2): B1) Delaying the aging of the body, organs, tissues or cells; B2) Improve the functional disorders of the aging body, organs, tissues or cells; The substance regulating the SIRT2-STAT3-CDKN2B signaling pathway includes substance R and / or substance S and / or substance T; The substance R is SIRT2 protein or a substance that increases the activity and / or content of SIRT2 protein; The substance S is a substance that reduces the acetylation level of STAT3 protein; The substance T is a substance that reduces the activity and / or content of CDKN2B protein.

3. The use according to claim 1 or the product according to claim 2, characterized in that: The organ is a heart; Or, the substance that increases the activity and / or content of SIRT2 protein is a nucleic acid molecule encoding SIRT2 protein or an expression cassette, recombinant vector, recombinant microorganism, or recombinant cell line containing the nucleic acid molecule; Or, the substance that reduces the activity of CDKN2B protein is a protein, polypeptide or small molecule compound that inhibits the function of CDKN2B protein; Alternatively, the substance that reduces the content of CDKN2B protein may be a substance that inhibits CDKN2B protein synthesis or promotes CDKN2B protein degradation or knocks down or knocks out the CDKN2B gene.

4. Use of a substance for detecting SIRT2 expression level and / or a substance for detecting STAT3 protein acetylation level and / or a substance for detecting CDKN2B expression level in any of the following C1) or C2): C1) Identifying or assisting in identifying the level of aging of an organism, organ, tissue or cell; C2) Prepare products for identifying or assisting in identifying the level of aging of an organism, organ, tissue or cell.

5. A product for identifying or assisting in identifying the aging level of an organism, organ, tissue or cell, comprising a substance for detecting the expression level of SIRT2 and / or a substance for detecting the acetylation level of STAT3 protein and / or a substance for detecting the expression level of CDKN2B.

6. Use of a substance that regulates the SIRT2-STAT3-CDKN2B signaling pathway in any of the following D1)-D6): D1) Construction of senescent cells; D2) preparing products of constructed cells; D3) Screening or assisting in the screening of drugs that delay aging; D4) preparing products for screening or assisting in screening of drugs for delaying aging; D5) Research or assist in researching the aging mechanism of organisms, organs, tissues or cells; D6) Preparation of products for studying or assisting in studying the aging mechanism of the body, organs, tissues or cells; The substance regulating the SIRT2-STAT3-CDKN2B signaling pathway includes substance X and / or substance Y and / or substance Z; The substance X is a substance that reduces the activity and / or content of SIRT2 protein; The substance Y is a substance that increases the acetylation level of STAT3 protein; The substance Z is CDKN2B protein or a substance that increases the activity and / or content of CDKN2B protein.

7. A product, the active ingredient of which is a substance that regulates the SIRT2-STAT3-CDKN2B signaling pathway; the function of the product is any one of the following E1)-E3): E1) Construction of senescent cells; E2) Screening or assisting in the screening of drugs that delay aging; E3) Research or assist in researching the aging mechanism of the body, organs, tissues or cells; The substance regulating the SIRT2-STAT3-CDKN2B signaling pathway includes substance X and / or substance Y and / or substance Z; The substance X is a substance that reduces the activity and / or content of SIRT2 protein; The substance Y is a substance that increases the acetylation level of STAT3 protein; The substance Z is CDKN2B protein or a substance that increases the activity and / or content of CDKN2B protein.

8. The use according to claim 6 or the product according to claim 7, characterized in that: The organ is a heart; Or, the substance that reduces the activity of SIRT2 protein is a protein, polypeptide or small molecule compound that inhibits the function of SIRT2 protein; Alternatively, the substance that reduces the SIRT2 protein content may be a substance that inhibits SIRT2 protein synthesis or promotes SIRT2 protein degradation or knocks down or knocks out the SIRT2 gene; Alternatively, the substance that increases the activity and / or content of CDKN2B protein is a nucleic acid molecule encoding CDKN2B protein or an expression cassette, recombinant vector, recombinant microorganism, or recombinant cell line containing the nucleic acid molecule.

9. Any of the following methods F1)-F7): F1) A method for delaying aging of an organism, organ, tissue or cell, comprising the step of contacting the substance for regulating the SIRT2-STAT3-CDKN2B signaling pathway as described in claim 1 with the organism, organ, tissue or cell; F2) A method for improving dysfunction of an aging organism, organ, tissue or cell, comprising the step of contacting the substance for regulating the SIRT2-STAT3-CDKN2B signaling pathway as described in claim 1 with the aging organism, organ, tissue or cell; F3) A method for identifying or assisting in identifying the level of aging of an organism, organ, tissue or cell, comprising the step of detecting the expression level of SIRT2 and / or the acetylation level of STAT3 protein and / or the expression level of CDKN2B in a sample from the subject; F4) A method for constructing senescent cells, comprising the step of introducing the substance for regulating the SIRT2-STAT3-CDKN2B signaling pathway as described in claim 6 into a recipient cell; F5) A method for screening or assisting in screening a drug for delaying aging, comprising the step of screening a drug for delaying aging using senescent cells constructed by the method described in F4); F6) A method for studying or assisting in studying the aging mechanism of an organism, organ, tissue or cell, comprising the step of using senescent cells constructed by the method described in F4) to study the aging mechanism of an organism, organ, tissue or cell; F7) A method for changing the aging state of in vitro cells, comprising the step of introducing the substance regulating the SIRT2-STAT3-CDKN2B signaling pathway described in claim 1 or the substance regulating the SIRT2-STAT3-CDKN2B signaling pathway described in claim 6 into recipient cells.

10. The method according to claim 9, characterized in that: The organ is the heart.

Images