American ginseng polysaccharide XYS1 as well as preparation method and application thereof

Abstract

The invention discloses American ginseng polysaccharide XYS1 and a preparation method and application thereof, the American ginseng polysaccharide XYS1 is neutral alpha glucan, the main chain is composed of 1, 4-alpha-Glcp and 1, 6-alpha-Glcp, C6 of every three 1, 4-alpha-D-Glcp is substituted by one terminal Glcp, and the weight-average molecular weight is 5-100 kDa. Crude polysaccharide is extracted from American ginseng and is identified as neutral alpha glucan through compound enzyme extraction, ion column chromatography purification and spectrum identification, and it is proved that the polysaccharide XYS1 can significantly inhibit depression-like behaviors of mice and reverse behavioral changes caused by chronic stress, and can be used for preparing polysaccharide drugs or functional products for treating depression. The polysaccharide XYS1 can also inhibit liver fatty degeneration and liver fibrosis induced by CCl4, has a certain protection effect on liver cells in vivo, relieves the fibrosis degree, and can be used for preparing polysaccharide drugs or functional products for preventing and treating liver fibrosis.

Description

Technical Field

[0001] The present invention belongs to the technical field of polysaccharide extraction, and specifically relates to a Panacis quinquefolii polysaccharide XYS1 and a preparation method and application thereof, namely a method for extracting the polysaccharide XYS1 from Panacis quinquefolii radix, the polysaccharide XYS1 extracted by the method, and the application of the polysaccharide XYS1 in the preparation of anti-depression and anti-liver fibrosis drugs or functional products. Background Art

[0002] Chronic unpredictable mild stress (CUMS) is a chronic stress that can cause biochemical and behavioral changes and is associated with endogenous depression and neuropsychiatric disorders. CUMS-induced depression is often used to mimic depressive behaviors in mouse models and has been shown to have predictive validity in previous studies. The CUMS model is suitable for exploring the pathophysiology of depression and the antidepressant effects of various drugs. Currently, chemical agents are used as the first choice for treating depression, but existing chemical agents are not effective for all patients with depression and often cause adverse side effects. Therefore, it is crucial to find a more effective and safer drug to treat depression.

[0003] Fibrosis is a type of chronic metabolic organ disease with significant damage, characterized by an abnormal increase in myofibroblasts and excessive production and deposition of extracellular matrix (ECM) proteins. As the disease progresses, it can easily lead to cancer and death (Sisto, M.; Ribatti, D.; Lisi, S. Organ Fibrosis and Autoimmunity: The Role of Inflammation in TGFβ-Dependent EMT. Biomolecules 2021, 11.). Long-term use of existing therapeutic drugs may have a negative impact on other systems of the body and affect the quality of life of patients. Therefore, although these drugs show therapeutic effects on fibrosis to a certain extent, due to adverse reactions, there is an urgent need to find a safer and more effective alternative treatment method.

[0004] In recent years, studies have found that polysaccharides have significant anti-tumor activity and relatively little toxicity to the human body. The study of the biological activity of polysaccharides has become a hot topic for experts and scholars at home and abroad in the medical field. So far, the polysaccharide drugs that have been put on the market in my country mainly include: Lentinan injection, Polyporus polysaccharide injection, Yunzhi polysaccharide capsule, Astragalus polysaccharide, Yunzhi Gantai, Grifola frondosa capsule, etc. Foreign countries also attach great importance to the research on polysaccharides. At present, many plant polysaccharides have been used in clinical treatment for adjuvant treatment of tumors and to reduce the side effects of chemotherapy (Schepetkin IA, Quinn MT. Botanical polysaccharides: Macrophage immunomodulation and therapeutic potential [J]. Int Immunopharmacol, 2006, 6 (3): 317-333.). At present, there are few reports on the research on the drug development of natural American ginseng polysaccharides in the treatment of depression and fibrosis, which makes it have great application prospects as a potential candidate drug for the treatment of depression and fibrosis. Summary of the invention

[0005] The main purpose of the present invention is to provide a American ginseng polysaccharide XYS1, which is a neutral α-glucan. The American ginseng polysaccharide XYS1 can significantly inhibit the depressive-like behavior of mice caused by CUMS modeling at the animal level, and can also significantly inhibit the activation, migration and proliferation of fibroblasts, inhibit CCl4-induced liver tissue degeneration and liver fibrosis, have a certain protective effect on liver cells in vivo, and reduce the degree of fibrosis.

[0006] Another object of the present invention is to provide a method for preparing the American ginseng polysaccharide XYS1, wherein a neutral α-glucan is obtained by using American ginseng as a raw material through a simple and effective polysaccharide extraction process and method.

[0007] Another object of the present invention is to provide the use of the American ginseng polysaccharide XYS1 in the preparation of medicines or functional products for treating depression.

[0008] Another object of the present invention is to provide the use of the American ginseng polysaccharide XYS1 in the preparation of medicines or functional products for preventing or treating liver fibrosis.

[0009] To achieve the above object, the present invention adopts the following technical solution:

[0010] The present invention provides a Panax quinquefolius polysaccharide XYS1, which is a neutral α-glucan, the main chain of which is composed of 1,4-linked glucose (1,4-α-Glcp) and 1,6-linked glucose (1,6-α-Glcp), and C6 of every three 1,4-α-D-Glcp is substituted with one terminal Glcp, and the structure is:

[0011]

[0012] Wherein, the range of n is 3-65, and the weight average molecular weight is 5-100 kDa.

[0013] Preferably, the weight average molecular weight of the American ginseng polysaccharide XYS1 is 10-50 kDa.

[0014] More preferably, the weight average molecular weight of the American ginseng polysaccharide XYS1 is 10-20 kDa.

[0015] Preferably, the American ginseng polysaccharide XYS1 is composed of 60.02% 1,4-α-Glcp, 11.33% 1,6-α-Glcp, 18.47% 1,4,6-α-Glcp, 3.31% 1,3,4-α-Glcp, and 6.87% T-α-Glcp; wherein the molar ratio of 1,4-α-Glcp, 1,6-α-Glcp and 1,4,6-α-Glcp is 6:1:2.

[0016] The present invention also provides a method for preparing the American ginseng polysaccharide XYS1, comprising the following steps:

[0017] Step a, polysaccharide extraction: dried American ginseng is defatted by ethanol, extracted by complex enzymes, filtered, and the obtained filtrate is concentrated, centrifuged, dialyzed, re-concentrated, and vacuum dried to obtain enzyme-extracted American ginseng crude polysaccharides;

[0018] Step b, polysaccharide purification: The enzyme-extracted American ginseng crude polysaccharide is subjected to graded purification using a DEAE cellulose anion column, eluted with water and 0.1 M NaCl in sequence, and the 0.1 M NaCl elution fraction is collected to obtain a purified polysaccharide, namely American ginseng polysaccharide XYS1.

[0019] Preferably, in step a, the polysaccharide extraction process includes: heating and refluxing the dried American ginseng with 75%-95% ethanol for defatting, drying, adding deionized water, adding papain and trypsin for extraction under heating conditions, filtering, combining the filtrates, and then heating and concentrating, centrifuging, dialysis, re-concentrating, and vacuum drying to obtain enzyme-extracted American ginseng crude polysaccharides.

[0020] More preferably, in step a, the polysaccharide extraction process includes: adding deionized water to the American ginseng defatted powder at a ratio of 1:30, adjusting the solution pH to 6 after stirring evenly, then adding papain with a mass concentration of 2.5% of the defatted powder, stirring and extracting at 60°C for 12 hours, then inactivating the solution at 100°C for 15 minutes, and adjusting the pH to 8 after cooling, adding trypsin with a mass concentration of 2.5% of the defatted powder, stirring and extracting at 37°C for 12 hours, and inactivating the solution at 100°C for 15 minutes again, and after cooling, centrifuging the solution to obtain the supernatant, dialyzing, concentrating, and vacuum drying.

[0021] Preferably, in step b, the polysaccharide purification process includes: taking the enzyme-extracted American ginseng crude polysaccharide, dissolving it in water, centrifuging it, separating the supernatant through a DEAE cellulose anion column, eluting it with distilled water and 0.1M NaCl in turn, detecting it with sulfuric acid-phenol, collecting and combining the 0.1M NaCl eluate, concentrating it, dialyzing it, and freeze-drying it.

[0022] More preferably, in step b, the polysaccharide purification process includes: taking the enzyme-extracted American ginseng crude polysaccharide, adding 10 times the weight of water to dissolve, centrifuging, separating the supernatant through a DEAE cellulose anion column, eluting with distilled water and 0.1M NaCl in turn, detecting with sulfuric acid-phenol, collecting and combining the 0.1M NaCl eluate, concentrating, dialyzing, and freeze-drying.

[0023] The present invention also provides the use of the American ginseng polysaccharide XYS1 in preparing medicines or functional products for treating depression.

[0024] The present invention also provides the use of the American ginseng polysaccharide XYS1 in preparing medicines or functional products for preventing or treating liver fibrosis.

[0025] Compared with the prior art, the beneficial effects of the present invention are as follows: the present invention uses American ginseng as raw material to extract crude polysaccharides, obtains an American ginseng polysaccharide XYS1 after complex enzyme extraction, ion column chromatography purification and spectral identification, and pharmacological experiments show that the polysaccharide can significantly inhibit the depressive-like behavior of mice caused by CUMS modeling at the animal level, reverse the behavioral changes caused by chronic stress, and is expected to be developed into a carbohydrate drug or functional product for the treatment of depression. At the same time, the American ginseng polysaccharide XYS1 can significantly inhibit the activation, migration and proliferation of fibroblasts, inhibit CCl4-induced liver fatty degeneration and liver fibrosis, have a certain protective effect on liver cells in vivo, reduce the degree of fibrosis, and is expected to become a polysaccharide drug or functional product for the prevention and treatment of liver fibrosis, with huge market prospects and economic value. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 Schematic diagram of the preparation process and animal experiment of American ginseng polysaccharide XYS1 in the examples.

[0027] Figure 2 IR spectrum, monosaccharide and molecular weight of American ginseng polysaccharide XYS1 prepared in the example.

[0028] Figure 3 This is the total ion current chromatogram of the methylation results of American ginseng polysaccharide XYS1 prepared in the example.

[0029] Figure 4 This is a flowchart of the establishment and treatment of a mouse model of liver fibrosis using American ginseng polysaccharide XYS1 prepared in the examples.

[0030] Figure 5 These are the test results of the antidepressant effect of American ginseng polysaccharide XYS1 prepared in the examples.

[0031] Figure 6 The results show the effect of American ginseng polysaccharide XYS1 prepared in the examples on the morphology of human hepatic stellate cells LX-2.

[0032] Figure 7 Schematic diagram showing the effect of American ginseng polysaccharide XYS1 prepared in the example on the growth and proliferation of human hepatic stellate cells LX-2 as a function of concentration.

[0033] Figure 8 Schematic diagram showing the growth inhibitory effect of American ginseng polysaccharide XYS1 prepared in the example on activated human hepatic stellate cells LX-2 as a function of concentration.

[0034] Fig. 9 Schematic diagram of the inhibitory effect of American ginseng polysaccharide XYS1 prepared in the example on the migration of activated human hepatic stellate cells LX-2.

[0035] Fig.10 The results show the effect of American ginseng polysaccharide XYS1 prepared in the example on the expression of α-SMA, COL1A1 and FN1 in activated human hepatic stellate cells LX-2.

[0036] Fig.11 The results show the effects of American ginseng polysaccharide XYS1 prepared in the examples on ALT, AST and TG in mice with liver fibrosis.

[0037] Fig.12 The results are as follows: the effect of American ginseng polysaccharide XYS1 prepared in the example on liver tissue pathology (HE staining) in mice with liver fibrosis.

[0038] Fig.13 The results of the effect of American ginseng polysaccharide XYS1 prepared in the example on liver tissue pathology (Masson staining) in mice with liver fibrosis. DETAILED DESCRIPTION

[0039] The technical scheme of the present invention is further described below by way of examples. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other implementation methods obtained by those skilled in the art without creative work are within the scope of protection of the present invention.

[0040] Example 1

[0041] Reference Figure 1 The American ginseng polysaccharide XYS1 was prepared as shown in the following steps:

[0042] a. Polysaccharide extraction:

[0043] The dried American ginseng was defatted with 95% ethanol and then dried naturally at room temperature. Deionized water was added to 100g of American ginseng defatted powder at a ratio of 1:30, and the solution pH was adjusted to 6 after stirring evenly. Then, papain (2.5% by weight of the defatted powder) was added, and the solution was inactivated at 100°C for 15min after stirring and extracting at 60°C for 12h. After cooling, the pH was adjusted to 8 again, and trypsin (2.5% by weight of the defatted powder) was added. After stirring and extracting at 37°C for 12h, the solution was inactivated again at 100°C for 15min. After cooling, the solution was centrifuged to obtain the supernatant, dialyzed, concentrated, and vacuum dried to obtain 9.2g of enzyme-extracted American ginseng crude polysaccharide.

[0044] b. Polysaccharide purification:

[0045] Take 1 g of the crude American ginseng polysaccharide prepared above, dissolve it in 100 mL of water, centrifuge to remove insoluble matter, and perform preliminary separation on the supernatant by passing it through a Cl-type DEAE-cellulose anion column. Elution was performed with distilled water and 0.1 M NaCl in turn, and sulfuric acid-phenol was used for detection. The 0.1 M NaCl eluate was collected and combined, concentrated, dialyzed, and freeze-dried to obtain 0.52 g of American ginseng polysaccharide XYS1.

[0046] c. Polysaccharide structure identification:

[0047] The relative molecular mass of American ginseng polysaccharide XYS1 was determined to be 12.59 kDa by high performance gel permeation chromatography (HPGPC). The American ginseng polysaccharide XYS1 was subjected to monosaccharide composition analysis, that is, the polysaccharide was completely hydrolyzed, reduced, acetylated, extracted, concentrated and then sent to GC for analysis. The monosaccharide composition analysis showed that American ginseng polysaccharide XYS1 mainly contained glucose (95%). The infrared spectrum showed that 3229 cm -1 OH stretching vibration absorption peak, 2933cm -1 is the CH stretching vibration absorption peak, 1000-1400cm -1 Nearby are the vibration signals of CO and sugar ring, 1720cm -1 There is no absorption peak near it, indicating that the polysaccharide does not contain uronic acid ( Figure 2 ). The methylation result spectrum showed that the main linking mode was 60.02% 1,4-α-Glcp, 11.33% 1,6-α-Glcp, 18.47% 1,4,6-α-Glcp, 3.31% 1,3,4-α-Glcp, and 6.87% terminal Glcp. The molar ratio of 1,4-α-Glcp, 1,6-α-Glcp, and 1,4,6-α-Glcp was 6:1:2. Combined with infrared, methylation and nuclear magnetic resonance analysis ( Figure 2 and 3 ), it was determined that the American ginseng polysaccharide XYS1 is a neutral α-glucan, the main chain is composed of 1,4-α-Glcp and 1,6-α-Glcp, and every three 1,4-α-D-Glcp C6 has a terminal Glcp substitution, the structure is:

[0048]

[0049] The range of n is 3-65, and the weight average molecular weight is 5-100 kDa, and can further be 10-50 kDa, and can further be 10-20 kDa.

[0050] Example 2: Antidepressant effect of American ginseng polysaccharide XYS1

[0051] Construction of CUMS (chronic unpredictable mild stress) depression mouse model

[0052] like Figure 3 As shown, the mice in the model group were housed in a single cage. At 11:00 a.m. and 16:00 p.m. every day, the mice were randomly exposed to different stimulation methods, including: 7h tilted cage 45°, 24h fasting, 24h water deprivation, 24h cage sharing, 3h noise, 4℃ cold water for 5min, 24h light, 24h no bedding, 15min restraint and 24h wet bedding. Two stimulations were randomly given every day, and the same stimulation could not be applied for 3 consecutive days for 28 days (four weeks). The specific steps are as follows:

[0053] Tilted cage: Raise one end of the cage and tilt it 45° for 7 hours.

[0054] Fasting: Remove the mouse food but not the water bottle for 24 hours.

[0055] Water deprivation: Remove the water bottle but not the mouse food for 24 hours.

[0056] Cage combination: Cage mice in single cages into one cage for 24 hours.

[0057] Noise: Mice were placed in an intermittent noise environment with a noise intensity of 85 decibels for 3 h.

[0058] Cold water stimulation: Place the mice in 4° cold water for stimulation for 5 min.

[0059] Lighting: Turn on the lights to create a bright environment for 24 hours.

[0060] No bedding: Mice were placed in a no bedding environment for 24 h.

[0061] Restraint: Mice were placed in a 50 mL plastic centrifuge tube for 15 min.

[0062] Wet bedding: Mice were placed in an unclean bedding environment for 24 h.

[0063] Mouse grouping and drug administration

[0064] Adaptive feeding was performed one week before the experiment to ensure that the mice adapted to the environment in the animal barrier. During this period, 4-5 mice were kept in a cage and fed a normal diet. The mice were divided into 4 groups using a random number table, with 10 mice in each group, namely: control group (CON), chronic stress group (CUMS), chronic stress + XYS1 group (CUMS + XYS1), chronic stress + fluoxetine group (CUMS + Flu). The mice in the chronic stress group were kept in a single cage.

[0065] After all chronic stress groups received four weeks of chronic stimulation, gavage administration began in the 5th week of the experiment. The CON and CUMS groups were gavaged with 0.1 mL of 0.9% sodium chloride solution once a day for 28 days at the same time period; the CUMS+XYS1 group was gavaged with 0.1 mL of fluoxetine suspension at a dose of 15 mg / kg once a day for 28 days before daily stimulation; the CUMS+XYS1 group was gavaged with 0.1 mL of 250 mg / kg once a day before daily stimulation for 28 days.

[0066] Tail suspension test (TST)

[0067] The XR-XQ202 mouse forced swimming tail suspension integrated box was used. The mice were allowed to adapt to the environment in the animal behavior room for 1 hour before the behavioral test, and they had to remain quiet throughout the test. The mouse tail was taped to a hanging hook about 50 cm from the ground (the tape was about 2 cm from the end of the mouse tail). The video was started while it was hung up. Each mouse was recorded for 6 minutes, and the total time the mouse gave up struggling and did not move in the last 5 minutes was analyzed. The time when the mouse stopped struggling and the body was suspended vertically and motionless was defined as the immobility time, and the SuperTst data analysis system was used to count the immobility time.

[0068] Forced swim test (FST)

[0069] The mice were allowed to adapt to the environment for 1 hour, and the surrounding environment must be kept quiet throughout the test. A clean, transparent cylinder (about 30 cm high and 20 cm in diameter) was filled with water about 22 cm high (the water temperature was maintained between 22-24°C during the test). The cylinder with the adjusted water temperature was placed in the test box, and the mice were placed in the center of the cylinder. Video recording and data collection were started at the same time. Each mouse was recorded for 6 minutes, and the total time that the mouse gave up struggling and floated in the next 5 minutes was analyzed. The immobility time was counted using the SuperFst data analysis system.

[0070] Depend on Figure 5 B shows that after four weeks of modeling stimulation, the immobility time of CUMS mice in the tail suspension test and forced swimming test was significantly higher than that of CON group mice, with obvious differences. The results show that after four weeks of CUMS modeling, mice can develop depressive-like behaviors.

[0071] Depend on Figure 5 C shows that compared with the CUMS group, the CUMS+Flu group significantly shortened the immobility time of mice in the tail suspension test and the forced swimming test. The results showed that fluoxetine intervention could reverse the behavioral changes caused by CUMS. The CUMS+XYS1 group was the same as the CUMS+Flu group. Compared with the CUMS group, the immobility time of mice in the tail suspension test and the forced swimming test was also significantly shortened, indicating that XYS1 also has the ability to reverse the behavioral changes caused by CUMS.

[0072] Example 3: Polysaccharide XYS1 inhibits hepatic stellate cell activation, proliferation and migration

[0073] Cell proliferation assay

[0074] Cultured in RPMI-1640 medium containing 10% FBS, the medium was changed once a day. The incubator temperature was set to 37°C and the carbon dioxide concentration was set to 5%. Cultured to the logarithmic phase, trypsin digested, and plated. The cells were divided into 9 groups, specifically: 1 blank group (containing culture medium only), 8 experimental groups (containing 0μg / mL, 25μg / mL, 50μg / mL, 100μg / mL, 200μg / mL, 400μg / mL, 800μg / mL, 1000μg / mL) with 3 parallels in each group. The number of cells was approximately 1×10 4 100 μL / well of culture medium was added to each well of a 96-well plate. After culturing for 24 hours, the old culture medium was discarded and 100 μL of drug-containing culture medium was added to each well. The blank group was added with drug-free culture medium. After culturing for 48 hours, the old culture medium was discarded. 100 μL of 10% CCK-8 culture medium was added in the dark, and the cells were incubated in the dark for 1 hour. The absorbance was measured at 450 nm.

[0075] Cytotoxicity assay

[0076] 10 ng / mL recombinant TGF-β1 was used to induce LX-2 cell activation and construct a HF cell model. The number of cells was approximately 1×10 4 / well, evenly divided into 96-well plates, and 100 μL / well of culture medium was added. The cell experiment groups were as follows: blank control group (Control), induced activation group (TGF-β1), induced activation + 8 experimental groups (containing 0μg / mL, 25μg / mL, 50μg / mL, 100μg / mL, 200μg / mL, 400μg / mL, 800μg / mL, 1000μg / mL), 3 parallels in each group, the Control group was cultured normally with RPMI-1640 complete medium; the TGF-β1 group was treated with 10ng / mL recombinant TGF-β1; the TGF-β1+XYS1 group was co-treated with 10ng / mL recombinant TGF-β1 and different concentrations of XYS1, 100μL of 10% CCK-8 medium was added in the dark, incubated in the dark for 1h, and the absorbance was measured at 450nm.

[0077] Cell scratch assay

[0078] After the cells were cultured to the logarithmic growth phase, they were digested with trypsin and 5×10 5 LX-2 cells were evenly spread in a 6-well plate. Three parallel lines were drawn on the bottom back of the 6-well plate, and then the 6-well plate was placed in a carbon dioxide incubator for culture until the cells adhered to the wall and the degree of fusion reached 80%. At this time, a 200μL gun tip was used to make cell scratches perpendicular to the marked line, the cell fragments were washed with PBS, and then the state of 0h was observed and recorded under an inverted microscope. Next, culture medium containing different concentrations of polysaccharide solution was added and co-cultured with LX-2 cells for 48h. The specific experimental grouping included a blank group and three experimental groups (containing 200μg / mL, 400μg / mL and 800μg / mL polysaccharide solutions), each group had three parallel treatments, and after 48 hours of culture, photos were taken and recorded.

[0079] RT-qPCR experiments

[0080] The cells were divided into 5 groups: 1 blank group (containing only culture medium), 1 control group (containing 10 ng / mL TGF-β1), and 3 experimental groups (containing 200 μg / mL, 400 μg / mL, and 800 μg / mL polysaccharide solutions), with 3 parallel samples in each group. When the cells grew to the logarithmic phase, they were plated and 3×10 6After overnight attachment, the cells were washed, and 10 ng / mL of transforming growth factor-1 was added to the blank wells for 24 h. The cells were washed, and medium containing 200 μg / mL, 400 μg / mL, and 800 μg / mL polysaccharide solution was added and incubated for 48 h. After the administration, RNA was extracted according to the Sparkeasy Cell RNA Kit of Sparkjet.

[0081] After measuring the concentration of the obtained sample, reverse transcription is performed, that is, the reaction system containing template RNA, primers, RecationBuffer, RNase Inhibitor, dNTP Mix, and M-MLV reverse transcriptase is placed in the PCR instrument. Set the reverse transcription program and perform reverse transcription. Take an appropriate amount of reverse transcription solution, add 2×QuantiNova SYBR Green PCR MasterMix, front primers, and back primers, use a 20μL system, and set the program fluorescence quantitative instrument for amplification. Finally, perform data analysis and determine whether the amplification data is usable based on the melting curve. If it is usable, use 2 -ΔΔCt The primers used were shown in Table 1.

[0082] Table 1

[0083] Upstream primer Downstream primer GAPDH ACTTTGGTATCGTGGAAGGACT GTAGAGGCAGGGATGATGTTCT α-SMA CATGAAGTGTGACATCGACATC TGATCTTGATCTTCATGGTGCT COL1A1 CCTGGATGCCATCAAAGTCT CGCCATACTCGAACTGGAAT FN1 CCATCGCAAACCGCTGCCAT AACACTTCTCAGCTATGGGCTT

[0084] Effects of XYS1 on the morphology of LX-2 cells

[0085] The LX-2 cells in the control group were star-shaped, with a relatively high cell density and good adherence to the wall. The XYS group had fewer star-shaped cells, a relatively low relative density, and poor adherence to the wall. Figure 6 ). In the control group, the nuclei were similar in size, oval or round, with a larger number and weaker fluorescence intensity; in the XYS group, the nuclei were of different sizes, diverse in shape, with a smaller number and stronger fluorescence intensity.

[0086] Subsequently, cell viability was tested to evaluate the safety of XYS1. The results showed that there was no significant effect on LX-2 cell viability ( Figure 7 ). Compared with the TGF-β1-induced model group, XYS1 significantly inhibited the proliferation of activated LX-2 in a concentration-dependent manner ( Figure 8 ).

[0087] like Fig. 9As shown in the figure, after different concentrations of polysaccharide XYS1 acted on LX-2 cells for 48 hours, it can be seen that polysaccharide can inhibit the migration ability of activated LX-2 cells to a certain extent, among which the inhibition ability of medium and high doses is better. Compared with the CT group, there was no significant difference in the expression of α-SMA, COL1A1 and FN1 in LX-2 cells in the XYS1 administration group; compared with the TGF-β1 model group, the expression of α-SMA, COL1A1 and FN1 in the TGF-β1+XYS1 group was significantly reduced ( Fig.10 ).

[0088] Example 4: Polysaccharide XYS1 inhibits liver fibrosis and protects the liver

[0089] Experimental animal grouping, modeling and drug administration

[0090] Preparation of CCl4 solution for experiment: A 10% mixed solution of olive oil and CCl4 was prepared after autoclaving and injected intraperitoneally at 2 mL / kg body weight. Ultrapure water was used to dissolve XYS1 and Fuzheng Huayu powder, respectively (XYS1 low dose: 5.0 mg mL -1 , XYS1 medium dose: 20.0 mg·mL -1 , XYS1 high dose 40.0 mg·mL -1 The aqueous solution of Fuzheng Huayu was 0.10mL·10g -1 Sixty male C57BL / 6J mice aged 6-8 weeks (weight 18-22 g) were randomly divided into six groups after one week of adaptive feeding, as shown in the table: blank control group (Control), CCl4 model group (Model), XYS1 low-dose group (XYS-L, 50 mg kg -1 ), XYS1 medium dose group (XYS-M, 200 mg kg -1 ), XYS1 high-dose group (XYS-H, 400 mg kg -1 ), positive control group (FZHY, 1.2 g·kg -1 ), 10 in each group, as shown in Table 2.

[0091] Table 2

[0092]

[0093] Liver sample collection

[0094] At the end of the 8th week, after fasting for 12 hours, 2% sodium pentobarbital was injected intraperitoneally for anesthesia. The liver was cut and washed, and the liver capsule and surrounding residual tissue were removed, and then dried with filter paper. The liver was weighed, and the middle and outer lobes of the liver were fixed in 4% formalin at room temperature for more than 48 hours. The remaining tissue was quickly frozen in liquid nitrogen and stored in a -80℃ refrigerator for examination.

[0095] Serum AST, ALT, TG detection

[0096] 12 hours after the last administration, 0.8 mL of blood was collected from the eyeball and centrifuged at 4000 r / min at 4°C for 10 minutes to separate the serum; the ALT, AST and TG levels in the serum were detected by the Reiter microplate method according to the kit method.

[0097] Liver histopathological analysis

[0098] The liver lobe was cut into pieces with a size of about 1cm×1cm×1.5cm. After routine dehydration and paraffin embedding, the pieces were sliced ​​into 5μm thick sections, stained with HE and Masson respectively, and observed under a light microscope.

[0099] Serum biochemical indices were observed. The liver cells of mice in the model group produced a large amount of ALT, AST and TG, indicating that the liver cells were severely damaged. Triglyceride deposition in the liver caused oxidative stress, endoplasmic reticulum stress and apoptosis and necrosis of liver cells, leading to liver damage and inflammation, and promoting the occurrence of liver fibrosis, cirrhosis and even liver cancer. The above indicators were significantly different from those in the control group (P<0.01); compared with the model group, ALT, AST, and TG in each drug-treated group decreased to varying degrees (P<0.01), among which the XYS1 medium-dose group and high-dose group showed obvious improvement ( Fig.11 ).

[0100] HE staining showed that the liver lobules of the rats in the normal group were intact, the size and shape of the hepatocytes were normal and orderly, and the hepatocyte cords were arranged radially. The hepatic lobule structure of the rats in the model group was greatly damaged, the hepatocyte cords were disordered, and the inflammatory cell infiltration was obvious. Fat vacuoles and pseudolobules of varying sizes were formed, and a large number of fibrous tissues proliferated in the portal area and formed fibrous septa. Compared with the model group, the liver structure of the rats in each drug-treated group was repaired to varying degrees, the fat vacuoles and pseudolobules were significantly reduced, and the inflammatory cell infiltration and fibrous tissue proliferation were significantly alleviated ( Fig.12 ).

[0101] The results of Masson staining showed that the liver lobules of rats in the normal group had clear structures and orderly arrangement of cells, with only a small amount of blue-stained collagen fibers in the central vein and portal area. The portal area of ​​rats in the model group had a large number of blue-stained collagen fibers, and the fiber intervals were significantly widened and irregular, extending into the liver lobules to separate them into pseudolobules of varying sizes. Compared with the model group, the blue-stained collagen fibers in each drug-treated group were significantly thinner and thinner, the fiber intervals were reduced and narrowed, and the pseudolobule formation was improved ( Fig.13 ).

[0102] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that they can still modify or replace the technical solution of the present invention with equivalents, and these modifications or equivalent replacements cannot cause the modified technical solution to deviate from the scope of the technical solution of the present invention.

Claims

1. A American ginseng polysaccharide XYS1, characterized in that: The American ginseng polysaccharide XYS1 is a neutral α-glucan, the main chain of which is composed of 1,4-linked glucose (1,4-α-Glcp) and 1,6-linked glucose (1,6-α-Glcp), and C6 of every three 1,4-α-D-Glcp is replaced by one terminal Glcp, and the structure is: Wherein, the range of n is 3-65, and the weight average molecular weight is 5-100 kDa.

2. The American ginseng polysaccharide XYS1 according to claim 1, characterized in that The weight average molecular weight of the American ginseng polysaccharide XYS1 is 10-50 kDa.

3. The American ginseng polysaccharide XYS1 according to claim 1, characterized in that The American ginseng polysaccharide XYS1 is composed of 60.02% 1,4-α-Glcp, 11.33% 1,6-α-Glcp, 18.47% 1,4,6-α-Glcp, 3.31% 1,3,4-α-Glcp, and 6.87% terminal Glcp, wherein the molar ratio of 1,4-α-Glcp, 1,6-α-Glcp and 1,4,6-α-Glcp is 6:1:

2.

4. The method for preparing the American ginseng polysaccharide XYS1 according to any one of claims 1 to 3, characterized in that: The following steps are involved: Step a, polysaccharide extraction: dried American ginseng is defatted by ethanol, extracted by complex enzymes, filtered, and the obtained filtrate is concentrated, centrifuged, dialyzed, re-concentrated, and vacuum dried to obtain enzyme-extracted American ginseng crude polysaccharides; Step b, polysaccharide purification: The enzyme-extracted American ginseng crude polysaccharide is subjected to graded purification using a DEAE cellulose anion column, eluted with water and 0.1 M NaCl in sequence, and the 0.1 M NaCl elution fraction is collected to obtain a purified polysaccharide, namely American ginseng polysaccharide XYS1.

5. The method for preparing American ginseng polysaccharide XYS1 according to claim 4, characterized in that: In step a, the polysaccharide extraction process includes: heating and refluxing the dried American ginseng with 75%-95% ethanol for defatting, drying, adding deionized water, adding papain and trypsin for extraction under heating conditions, filtering, combining the filtrates, and then heating and concentrating, centrifuging, dialysis, re-concentrating, and vacuum drying to obtain enzyme-extracted American ginseng crude polysaccharides.

6. The method for preparing American ginseng polysaccharide XYS1 according to claim 5, characterized in that: In step a, the polysaccharide extraction process includes: adding deionized water to the American ginseng defatted powder at a ratio of 1:30, adjusting the solution pH to 6 after stirring evenly, then adding papain with a defatted powder mass concentration of 2.5%, stirring and extracting at 60°C for 12 hours, then inactivating the solution at 100°C for 15 minutes, and adjusting the pH to 8 after cooling, adding trypsin with a defatted powder mass concentration of 2.5%, stirring and extracting at 37°C for 12 hours, and inactivating the solution at 100°C for 15 minutes again, and after cooling, centrifuging the solution to obtain the supernatant, dialyzing, concentrating, and vacuum drying to obtain enzyme-extracted American ginseng crude polysaccharides.

7. The method for preparing American ginseng polysaccharide XYS1 according to claim 4, characterized in that: In step b, the polysaccharide purification process includes: taking the enzyme-extracted American ginseng crude polysaccharide, dissolving it in water, centrifuging it, separating the supernatant through a DEAE cellulose anion column, eluting it with distilled water and 0.1M NaCl in turn, detecting it with sulfuric acid-phenol, collecting and combining the 0.1M NaCl eluate, concentrating it, dialyzing it, and freeze-drying it.

8. The method for preparing American ginseng polysaccharide XYS1 according to claim 7, characterized in that: In step b, the polysaccharide purification process includes: taking the enzyme-extracted American ginseng crude polysaccharide, adding 10 times the weight of water to dissolve, centrifuging, separating the supernatant through a DEAE cellulose anion column, eluting with distilled water and 0.1M NaCl in turn, detecting with sulfuric acid-phenol, collecting and combining the 0.1M NaCl eluate, concentrating, dialyzing, and freeze-drying.

9. Use of the American ginseng polysaccharide XYS1 according to any one of claims 1 to 3 in the preparation of medicines or functional products for treating depression.

10. Use of the American ginseng polysaccharide XYS1 according to any one of claims 1 to 3 in the preparation of a medicine or functional product for preventing or treating liver fibrosis.

Images