Application of THADA in hyperlipidemia and cardiovascular metabolic diseases

Abstract

The application belongs to the technical field of biological medicine, and provides application of THADA in hyperlipidemia and cardiovascular metabolic diseases. THADA is used as a biomarker or target to prepare reagents for disease prediction, screening or diagnosis, and to prepare drugs for preventing or treating diseases. Inhibition or destruction of THADA function has the purposes of reducing blood cholesterol, low-density lipoprotein cholesterol (LDL-C) and triglyceride levels, not affecting high-density cholesterol levels, reducing liver triglyceride deposition and liver steatosis, and improving atherosclerosis, and the effect is clear and effective and has no adverse reactions. The application provides a new biomarker and treatment target for hyperlipidemia and cardiovascular metabolic diseases, and has good practical application value and wide application prospect.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to a new application of THADA in disease diagnosis, screening, prevention and treatment. Background Technology

[0002] The information disclosed in this background section is intended to enhance understanding of the overall background of the invention and is not necessarily to be construed as an admission or in any way implying that such information constitutes prior art known to those skilled in the art.

[0003] With the changing lifestyles and nutrient-rich diets of modern society, hyperlipidemia, dyslipidemia, and related cardiovascular metabolic diseases such as fatty liver disease and atherosclerosis are highly prevalent, becoming common chronic diseases and global healthcare issues. Cardiovascular metabolic diseases are the leading chronic non-communicable diseases threatening human health worldwide. According to the "Guidelines for Lipid Management in China," cardiovascular diseases, primarily atherosclerotic cardiovascular diseases (such as ischemic heart disease and ischemic stroke), are the leading cause of death among urban and rural residents in my country.

[0004] Blood lipids are a collective term for cholesterol, triglycerides, and lipids (such as phospholipids) in serum. Cholesterol and triglycerides are the most clinically relevant blood lipids. In recent decades, the average levels of blood lipids in the Chinese population, including total cholesterol (TC), low-density lipoprotein cholesterol (LDL-C), and triglycerides (TG), have significantly increased.

[0005] Despite this, public awareness, treatment, and control rates of dyslipidemia remain extremely low. For high-risk and susceptible populations of cardiovascular metabolic diseases, the primary focus is on lowering blood cholesterol and triglyceride levels, with prevention and treatment emphasizing improving the treatment rate and lipid target achievement rate of lipid-lowering drugs. However, the types of lipid-lowering drugs currently used clinically are limited, and single-drug therapy is often insufficient to control multiple lipid indicators or may cause adverse reactions such as poor patient tolerance, leading to abnormal high-density lipoprotein (HDL) cholesterol levels. Therefore, one urgent need is to discover new lipid-lowering targets at the genetic level to develop novel and effective lipid-lowering drugs that can simultaneously control multiple lipid indicators such as LDL-C and triglycerides, with low side effects, for the prevention and treatment of hyperlipidemia and cardiovascular metabolic diseases.

[0006] THADA is a protein encoded by a gene associated with thyroid adenoma, initially discovered and named in benign thyroid adenomas. Previous genome-wide association studies (GWAS) have found that... THADAA single nucleotide polymorphism (SNP) site, rs7578597, is significantly associated with type 2 diabetes. A study published in the *Journal of Diabetes Research* validated this association with type 2 diabetes for the first time in an Asian population, observing only rs7578326 among the four lipid-related traits tested. IRS1 The allele for type 2 diabetes risk at the [specific locus] locus showed a significant association with triglyceride levels; several other SNPs associated with type 2 diabetes, according to the GWAS catalog published by the National Human Genome Research Institute (http: / / www.genome.gov / gwastudies / ), had not previously been shown to be associated with lipids. In other words, this study shows an association between type 2 diabetes and [other related factors]. THADA The gene SNP (rs7578597) was not associated with any of the four lipid-related traits.

[0007] A study published in *Human Heredity* (Association of Common Genetic Variants with Diabetes and Metabolic Syndrome Related Traits in the Arizona Insulin Resistance Registry: A Focus on Mexican American Families in the Southwest, 2014) reported... THADA The SNP (rs7578597) was associated with total cholesterol and LDL, but not with triglycerides. Another study published in *Human Reproduction* (Genotype-phenotype correlations of PCOS susceptibility SNPs identified by GWAS in a large cohort of Han Chinese women, 2013) reported on patients with polycystic ovary syndrome. THADA The SNP site rs12478601 in the gene was associated with LDL abnormalities, but not with total cholesterol or triglycerides.

[0008] A study published in *Developmental Cell* (THADA Regulates the Organismal Balance between Energy Storage and Heat Production, 2017) reported... THADA The knockout fruit flies showed significantly higher triglyceride levels than the control fruit flies, which the authors believe is... THADA Knockout has a pathogenic effect of causing hypertriglyceridemia in fruit flies. Furthermore, a study published in *PLOS ONE* (Association Study between Polycystic Ovarian Syndrome and the Susceptibility Genes Polymorphisms in HuiChinese Women, 2015) reported on [the following]. THADA Regarding the SNP site rs13429458, there were no statistically significant differences in triglyceride and low-density lipoprotein levels between patients with polycystic ovary syndrome and the control group.

[0009] It is well known to those skilled in the art that GWAS only identifies the association between differences in the frequency of single nucleotide variants in the genome and phenotypes, and cannot definitively determine pathogenicity. SNPs discovered by GWAS cannot directly locate genes in the region where the genomic site is located, but may exert their effects by influencing other distant or adjacent genes (Macarthur et al. Guidelines for investigating causality of sequence variants in human disease. Nature, 2014, 508(7497):469-76.). Therefore, based on the above research, it is impossible to infer the effect of SNPs on the genomic region where the genomic site is located. THADA Does it affect the expression or function of the gene itself? Based on the above... THADA Studies of negative or opposite correlations between different SNPs in genes show that the impact of genomic-level genetic variation on gene expression and function is unclear; therefore, it is impossible to infer from SNP research data... THADA The expression or function of the gene itself cannot be used to infer whether the gene containing the SNP is pathogenic based on the above genetic association studies. Furthermore, the above... THADA Genetic associations were found in individuals with diabetes or polycystic ovary syndrome, but not in individuals with hyperlipidemia, fatty liver disease, or cardiovascular disease. THADA Reports on gene associations.

[0010] In summary, in the existing technology, no such work has yet been carried out. THADA Independent functional studies of hyperlipidemia and cardiovascular metabolic diseases are still unclear. THADA What is the relationship between this condition and hyperlipidemia and cardiovascular metabolic diseases? Furthermore, THADA Its function and pathogenic role in hepatic lipid metabolism and atherosclerotic cardiovascular disease have not been reported to date. Summary of the Invention

[0011] To address the lack of diagnostic, screening, preventive, and therapeutic reagents for cardiovascular metabolic diseases such as hyperlipidemia, fatty liver disease, and atherosclerotic cardiovascular disease, this invention provides an application of THADA molecules in the diagnosis and treatment of these diseases. Inhibiting or disrupting THADA expression in vivo significantly reduces blood cholesterol, low-density lipoprotein cholesterol (LDL-C), and triglyceride levels without affecting high-density cholesterol levels, reduces hepatic triglyceride deposition and hepatic steatosis, and improves atherosclerosis. The effects are clear and effective with no adverse reactions.

[0012] To achieve the above objectives, the present invention adopts the following technical solution.

[0013] The application of THADA in the preparation of reagents for the prediction, screening, or diagnosis of diseases, including:

[0014] Hyperlipidemia, such as hypercholesterolemia, hypertriglyceridemia, and mixed hyperlipidemia;

[0015] Dyslipidemia;

[0016] Fatty liver disease, such as metabolic dysfunction-related fatty liver disease (also known as metabolic-associated fatty liver disease or non-alcoholic fatty liver disease), and progressive metabolic dysfunction-related steatohepatitis (also known as metabolic-associated steatohepatitis or non-alcoholic steatohepatitis).

[0017] And, atherosclerotic cardiovascular disease.

[0018] The applications include using at least one of the following as biomarkers to prepare reagents for disease prediction, screening, or diagnosis:

[0019] THADA gene;

[0020] mRNA expressed by the THADA gene; and,

[0021] Proteins expressed by the THADA gene.

[0022] High expression of the THADA gene can lead to disease. The above reagents can detect at least one of the following:

[0023] THADA gene expression level;

[0024] mRNA expression level of the THADA gene; and,

[0025] Expression level, localization, or activity of THADA protein.

[0026] The present invention also provides a detection reagent for detecting the content of biomarkers to evaluate whether the test subject suffers from hyperlipidemia, dyslipidemia, hypercholesterolemia, hypertriglyceridemia, fatty liver disease, or atherosclerotic cardiovascular disease or has the risk of such disease. The biomarker is at least one of the following: the THADA gene; mRNA expressed by the THADA gene; and protein expressed by the THADA gene.

[0027] The test subject is a mammal or mammalian cell. The mammal is a human, monkey, or mouse.

[0028] The reagents are used for detection by gene sequencing, PCR, FISH, immunohistochemistry, ELISA, Western blot, or flow cytometry.

[0029] This invention also provides the application of THADA as a target in the preparation of drugs for the prevention or treatment of diseases, wherein the diseases are:

[0030] Hyperlipidemia, such as hypercholesterolemia, hypertriglyceridemia, and mixed hyperlipidemia;

[0031] Dyslipidemia includes primary dyslipidemia and secondary dyslipidemia;

[0032] Fatty liver disease, such as metabolic dysfunction-related fatty liver disease (also known as metabolic-associated fatty liver disease or non-alcoholic fatty liver disease), and progressive metabolic dysfunction-related steatohepatitis (also known as metabolic-associated steatohepatitis or non-alcoholic steatohepatitis).

[0033] And, atherosclerotic cardiovascular disease.

[0034] The drug inhibits or destroys at least one of the following:

[0035] THADA gene expression level;

[0036] mRNA expressed by the THADA gene;

[0037] Expression level, function, location, or activity of THADA proteins.

[0038] The application involves using THADA as a drug target to construct an in vitro cell model or animal model of THADA gene overexpression, and then using the in vitro cell model or animal model to screen for THADA inhibitors.

[0039] A drug that inhibits or destroys at least one of the following:

[0040] THADA gene expression level;

[0041] mRNA expressed by the THADA gene; and,

[0042] Expression level, function, location, or activity of THADA proteins;

[0043] The disease treated by the drug is hyperlipidemia, such as hypercholesterolemia, hypertriglyceridemia, and mixed hyperlipidemia;

[0044] Dyslipidemia;

[0045] Fatty liver disease, such as metabolic dysfunction-related fatty liver disease (also known as metabolic-associated fatty liver disease or non-alcoholic fatty liver disease), and progressive metabolic dysfunction-related steatohepatitis (also known as metabolic-associated steatohepatitis or non-alcoholic steatohepatitis).

[0046] And, atherosclerotic cardiovascular disease.

[0047] The active ingredient of the drug includes at least one of the following options: nucleic acid, polypeptide, protein, enzyme, natural extract, synthetic compound, for RNA interference or knockout of the THADA gene, and a carrier for degrading the THADA protein.

[0048] Preferably, the drug contains nucleic acid and / or a vector for knocking out the THADA gene or RNA interfering with the THADA gene. More preferably, the nucleic acid is selected from at least one of the following: antisense oligonucleotides, double-stranded RNA, ribozymes, small interfering RNA (siRNA), short hairpin RNA (shRNA), guide RNA (gRNA), and a complex formed by guide RNA and Cas9 protein; the vector includes at least one of the following: liposomes, lentiviruses, adenoviruses, adeno-associated viruses and plasmids for constructing viruses, GalNac conjugated modifications, lipid delivery systems, nanomaterial delivery systems, polymer delivery systems, and extravesicles.

[0049] The present invention has the following advantages:

[0050] This invention, through mammalian biological experiments, demonstrates that inhibiting or disrupting THADA expression in vivo can lower blood cholesterol, low-density lipoprotein cholesterol (LDL-C), and triglyceride levels without affecting high-density lipoprotein cholesterol levels, reduce hepatic triglyceride deposition and hepatic steatosis, and improve atherosclerosis. The effects are effective and clear, with no adverse reactions. This protein or gene can be used to prepare predictive, screening, or diagnostic reagents for cardiovascular metabolic diseases such as hyperlipidemia, fatty liver disease, and atherosclerotic cardiovascular disease, and can also be used to prepare drugs for the prevention and treatment of these cardiovascular metabolic diseases. This invention provides new biomarkers and drug targets for hyperlipidemia and cardiovascular metabolic diseases, possessing significant practical application value and broad application prospects. Attached Figure Description

[0051] Figure 1 for Thada Construction strategy for liver knockout mice;

[0052] Figure 2 For comparison and Thada Serum total cholesterol levels in liver knockout mice under normal and high-cholesterol diets;

[0053] Figure 3 For comparison and Thada Serum low-density lipoprotein cholesterol (LDL-C) levels in liver knockout mice under normal and high-cholesterol diets;

[0054] Figure 4 For comparison and Thada Serum high-density lipoprotein cholesterol (HDL-C) levels in liver knockout mice under normal and high-cholesterol diets;

[0055] Figure 5 For comparison and Thada Serum triglyceride levels in liver knockout mice under normal and high-cholesterol diets;

[0056] Figure 6 For comparison and Thada Oil Red staining morphology of liver tissue in liver knockout mice (A) and liver triglyceride levels (B);

[0057] Figure 7 Atherosclerosis model mice Thada - Serum total cholesterol levels after LNP nucleic acid knockdown;

[0058] Figure 8 Atherosclerosis model mice Thada - Serum low-density lipoprotein cholesterol (LDL-C) levels after LNP nucleic acid knockdown;

[0059] Figure 9 Atherosclerosis model mice Thada - Serum triglyceride levels after LNP nucleic acid knockdown;

[0060] Figure 10 Atherosclerosis model mice Thada - Serum high-density lipoprotein cholesterol levels after LNP nucleic acid knockdown;

[0061] Figure 11 Atherosclerosis model mice Thada -LNP nucleic acid knockdown liver morphology staining;

[0062] Figure 12 Atherosclerosis model mice Thada - Aortic plaques after LNP knockdown (A) Oil Red staining and plaque area (B);

[0063] Figure 13 For comparison and Thada Serum total cholesterol levels in mice overexpressing the gene;

[0064] Figure 14 For comparison and Thada Serum low-density lipoprotein cholesterol (LDL-C) levels in mice with overexpression;

[0065] Figure 15 For comparison and Thada Serum triglyceride levels in mice with overexpression;

[0066] Figure 16 For comparison and Thada Oil Red staining morphology of liver tissue from mice overexpressing the gene. Detailed Implementation

[0067] The present invention will be further described below with reference to the embodiments and accompanying drawings, but the present invention is not limited to the following embodiments.

[0068] Example 1: THADA deficiency significantly improved hyperlipidemia in mice.

[0069] 1. Liver-specific Thada Construction of knockout mice

[0070] Targeting using CRISPR / Cas9 technology Thada A targeting sequence was designed for the exon 8 region of the gene. Two loxp sites were designed and constructed at both ends of the exon 8 region. gRNA, a donor vector containing loxP sites, and Cas9 were co-injected into mouse zygotes to generate conditionally knocked-out progeny of the targeted gene. The mouse genotype was determined by polymerase chain reaction and sequence analysis. Thada -flox mice.

[0071] The gRNA target sequence is as follows:

[0072] gRNA-A1 (matching reverse strand of gene), SEQ ID NO:1:

[0073] TCCTACTCACTATCTACATTTGG;

[0074] gRNA-A2 (matching forward strand of gene), SEQ ID NO:2:

[0075] ACACGGATAGATCTTCTGGCCGG.

[0076] Further, the above Thada -flox mouse and hepatocyte-specific promoters Albumin Driven Cre mice ( Alb -Cre) mating, obtaining offspring through successive generations of breeding. Thada -flox homozygous, simultaneously carrying Alb -Cre mice, that is Thada Hepatocyte-specific knockout (LKO) mice are those whose littermates do not carry the virus. Alb - Cre mice were used as controls. The construction strategy was as follows: Figure 1 As shown, this construction strategy can achieve THADA-specific loss and inactivation in mouse hepatocytes.

[0077] 2. Induction of hyperlipidemia

[0078] The above Thada Liver knockout (LKO) and littermate control (WT) mice were fed a high-fat, high-cholesterol diet (containing 40 kcal% fat and 1.25% cholesterol, Research Diet) for four weeks starting at 8 weeks of age. This high-cholesterol diet resulted in mice exhibiting significant elevated blood lipid levels, hepatic lipid accumulation, and hepatic steatosis, demonstrating metabolic damage phenotypes, and is a commonly used mouse model of hyperlipidemia. Figure 2 As shown, compared with mice on a normal diet, mice induced by a high-cholesterol diet showed significantly higher serum total cholesterol levels, confirming the successful induction of the hyperlipidemia model.

[0079] 3. Collection, processing, and testing of mouse blood samples

[0080] Mice were divided into four groups: control (WT) mice fed a normal diet, ... Thada Liver knockout (LKO) mice on a normal diet, and control (WT) mice on a high-fat, high-cholesterol diet. Thada Liver knockout (LKO) mice were fed a high-fat, high-cholesterol diet. After dietary modeling induction, blood was collected from each group of mice after a 6-hour fast. Serum was collected by centrifugation at 3000 rpm for 15 minutes at 4°C.

[0081] (1) Measurement of total cholesterol levels in mouse serum

[0082] The total cholesterol levels of the above four groups of mouse serum were determined according to the instructions of the liquid sample total cholesterol enzymatic assay kit.

[0083] Take 190 µL of working solution. Add 10 µL of blank control solution, standard, and mouse serum sample to each working solution, respectively, for a total reaction volume of 200 µL. Incubate at 37℃ for 20 min; the color stabilizes within 60 min after reaction equilibrium. Measure the OD value of each well using a microplate reader. Plot a standard curve and calculate the total cholesterol content in serum by comparing the results with the standard curve.

[0084] The results are as follows Figure 2 As shown, under normal dietary conditions, Thada The serum total cholesterol level in liver knockout (LKO) mice was significantly lower than that in the control group. Furthermore, THADA deficiency further reduced the serum total cholesterol level in hyperlipidemic mice after induction with a high-fat, high-cholesterol diet.

[0085] (2) Measurement of serum low-density lipoprotein cholesterol (LDL-C) levels in mice

[0086] The LDL-C levels in the serum of the four groups of mice were determined according to the instructions of the blood low-density lipoprotein cholesterol enzymatic assay kit.

[0087] LDL cholesterol separation: Take 50 μL of serum, add an equal volume of 50 μL of LDL capture agent, vortex to mix, and incubate at room temperature for 10 min. Centrifuge at 2000 g for 20 min; the precipitate contains LDL cholesterol. Carefully remove the supernatant, centrifuge again at 2000 g for 10 min, and discard the supernatant. Add 100 μL of PBS, vortex to resuspend the precipitate.

[0088] LDL cholesterol assay: Prepare the working solution by adding 190 µL to the wells of the microplate. Add 10 µL of the supernatant prepared after the LDL cholesterol separation step above, and add 10 µL of standard to the standard tubes. The total reaction volume is 200 µL. Incubate at 37℃ for 20 min. Measure the OD value of each tube using a microplate reader. Plot a standard curve and calculate the LDL-C concentration of each group of samples.

[0089] The results are as follows Figure 3 As shown, under normal dietary conditions, Thada The serum LDL-C level in liver knockout (LKO) mice was significantly lower than that in the control group. Furthermore, after a high-fat, high-cholesterol diet induced an increase in LDL-C levels in mice, THADA deficiency further significantly reduced serum LDL-C levels in hyperlipidemic mice.

[0090] (3) Measurement of high-density lipoprotein cholesterol (HDL-C) levels in mouse serum

[0091] The HDL-C levels in the serum of the four groups of mice were measured according to the instructions of the blood high-density lipoprotein cholesterol enzymatic assay kit.

[0092] HDL cholesterol separation: Take 50 μL of serum, add an equal volume of 50 μL of HDL capture agent, vortex to mix, and incubate at room temperature for 10 minutes. Centrifuge at 2000 g for 20 minutes, and the supernatant contains HDL cholesterol.

[0093] HDL cholesterol assay: Prepare the working solution by adding 190 µL to the wells of the microplate. Add 10 µL of the supernatant prepared after the HDL cholesterol separation step above, and add 10 µL of standard to the standard tubes. The total reaction volume is 200 µL. Incubate at 37℃ for 20 min. Measure the OD value of each tube using a microplate reader. Plot a standard curve and calculate the LDL-C concentration of each group of samples.

[0094] The results are as follows Figure 4 As shown, regardless of whether one is on a normal diet or a high-cholesterol diet, Thada Compared with control mice, liver knockout (LKO) mice showed no significant change in serum HDL-C, indicating that THADA deficiency does not affect serum HDL-C levels.

[0095] (4) Measurement of serum triglyceride levels in mice:

[0096] The triglyceride levels in the serum of the four groups of mice were determined according to the instructions of the enzymatic assay kit for liquid sample triglyceride content.

[0097] Dilute the standard accordingly to prepare the working solution. Add 10 μL of the standard or mouse serum sample to a microplate, along with 190 µL of the prepared working solution. Incubate at 37℃ for 15 min. Measure the OD value of each tube using a microplate reader. Plot a standard curve and calculate the triglyceride concentration of each group of samples.

[0098] The results are as follows Figure 5 As shown, under normal dietary conditions, Thada The serum triglyceride levels in liver knockout (LKO) mice were significantly lower than those in the control group. Furthermore, after a high-fat, high-cholesterol diet induced a significant increase in serum triglycerides in mice, THADA deficiency further significantly reduced serum triglyceride levels in hyperlipidemic mice.

[0099] The experimental results show that, regardless of whether hyperlipidemia was induced by a normal diet or a high-fat, high-cholesterol diet, specific inactivation of hepatic THADA function significantly reduced serum total cholesterol, low-density lipoprotein cholesterol, and triglyceride levels in mice, without affecting high-density lipoprotein cholesterol levels, demonstrating a significant beneficial effect on improving the lipid profile. These results indicate that THADA can serve as a novel drug target for the prevention and treatment of dyslipidemia, hypercholesterolemia, and other lipid disorders, without significant adverse effects.

[0100] Example 2: THADA deficiency improves fatty liver disease in mice

[0101] The control (WT) mice constructed in Example 1 and Thada Liver knockout (LKO) mice were fed a high-fat, high-cholesterol diet (containing 40 kcal% fat and 1.25% cholesterol, Research Diet) starting at 8 weeks of age. The high-fat, high-cholesterol diet, containing 40% fat, induced fatty liver disease in the mice. This was used to further evaluate the effect of liver-specific THADA inactivation on metabolic dysfunction-related fatty liver disease in mice.

[0102] (1) Liver histology Oil Red O staining

[0103] Oil Red O staining (ORO): After dietary induction, equal volumes of liver tissue were collected from mice in each group, embedded in OCT scans, and then frozen sections were prepared. After thawing, the sections were fixed in 4% paraformaldehyde fixative for 20 min. After washing with distilled water, the sections were stained with 60% isopropanol for 2 min, then directly stained in Oil Red O staining solution in the dark for 20 min. After washing with distilled water, the sections were stained with hematoxylin for 2 min, washed with distilled water, and mounted with glycerol gelatin. Images were acquired under a microscope and photographed for analysis.

[0104] (2) Liver triglyceride detection

[0105] After dietary induction, the mice were fasted for 6 hours before liver tissue samples were collected and flash-frozen in liquid nitrogen. The frozen liver tissue samples were then lysed with lysis buffer, centrifuged at 12000 g for 10 min at 4°C, and the supernatant was collected. The triglyceride content in the supernatant was measured according to the instructions of the enzymatic assay kit for triglyceride content in tissue cells. The absorbance was measured using a microplate reader, and the absolute triglyceride value was calculated using a standard curve. The protein content in the lysate supernatant was measured using the BCA protein quantification kit (purchased from Thermo Fisher Scientific). The triglyceride content of each sample was corrected for protein content.

[0106] The above experimental data are as follows Figure 6 As shown, in control mice with diet-induced fatty liver disease, Oil Red O staining of liver tissue revealed significant lipid accumulation, increased lipid droplets, and vacuolar degeneration, indicating successful induction of the fatty liver disease model. In LKO mice with lost THADA function, the lipid staining area in hepatocytes was significantly reduced, lipid droplet vacuolation was significantly decreased, and no adverse inflammatory changes were observed histologically. Furthermore, triglyceride content assays showed a significant decrease in triglyceride levels and lipid accumulation in the livers of LKO mice.

[0107] The experimental data from the above embodiments demonstrate that THADA inactivation can effectively improve liver lipid levels, reverse and treat hepatic steatosis in animal models of fatty liver disease, providing sufficient in vivo biological evidence for the application of THADA in fatty liver disease.

[0108] Example 3: THADA small interfering nucleic acid drug significantly alleviates atherosclerotic cardiovascular disease in mice.

[0109] (1) Construction of animal models of cardiovascular disease with atherosclerosis

[0110] A high-cholesterol diet can establish an atherosclerosis model in mice. To investigate the therapeutic effect of THADA in atherosclerosis, mice were fed a high-cholesterol diet (containing 40 kcal% fat and 1.25% cholesterol, Research Diet) starting at 8 weeks of age and continued for 12 weeks to induce hyperlipidemia, atherosclerotic pathological changes, and plaque formation.

[0111] (2) THADA knockdown treatment was performed on atherosclerotic mice using LNP-siRNA.

[0112] Targeted Thada We designed a small interfering nucleic acid sequence and chemically modified it to improve its stability. The target sequence for siRNA is as follows:

[0113] siRNA- Thada -1 (Chain of Justice), SEQ ID NO:3: GAGCAAGUGUGGUUAAUCUTT;

[0114] siRNA- Thada -2 (antisense chain), SEQ ID NO:4: AGAUUAACCACACUUGCUCTT.

[0115] The above-mentioned THADA-targeting siRNA-lipid nanoparticle (LNP) complex was prepared using microfluidic mixing technology. The LNP components included ionizable lipids, auxiliary lipids, and a buffer system. Further encapsulation and ultrafiltration purification of the siRNA were performed. Encapsulation efficiency was confirmed for quality control. The LNP suspension was diluted with physiological saline to obtain LNP-siRNA- Thada Nucleic acid drugs.

[0116] Mice from group (1) that successfully underwent atherosclerosis induction were randomly divided into two groups: the experimental group (LNP-si) and the control group (LNP-si). Thada 200 μL of LNP-siRNA-Thada nucleic acid drug was injected into the tail vein of mice, while the control group (Saline) mice were injected with an equal volume of physiological saline solution. The injections were administered twice a week for four weeks to assess the treatment effect.

[0117] (3) Detection of blood lipids in atherosclerotic mice

[0118] Blood was collected from the mice after a 6-hour fast. The serum was collected by centrifugation at 3000 rpm for 15 minutes at 4°C. The serum was then diluted with physiological saline, and the levels of total cholesterol, low-density lipoprotein cholesterol, and triglycerides were measured according to the kit instructions.

[0119] Analysis of the above experimental data showed that the control group of atherosclerotic mice exhibited significantly elevated serum cholesterol levels, demonstrating marked hypercholesterolemia. Compared with this control model mouse, knockdown of THADA with small interfering nucleic acid significantly reduced serum total cholesterol levels. Figure 7 Compared with control mice with hyperlipidemia and atherosclerosis, mice treated with THADA small interfering nucleic acid knockdown also showed a significant decrease in serum LDL-C levels. Figure 8 ), and accompanied by a significant decrease in serum triglyceride levels ( Figure 9 ), without affecting high-density lipoprotein cholesterol levels ( Figure 10 These data indicate that small interfering nucleic acid drugs targeting THADA can significantly improve the lipid profile in atherosclerotic mice.

[0120] (4) Liver histomorphological staining

[0121] HE staining (HE): Liver tissues from mice in the control and treatment groups were fixed in 4% paraformaldehyde fixative for at least 24 hours, dehydrated, embedded, and then 5 μm tissue sections were cut. Sections were routinely dewaxed to distilled water. Hematoxylin staining was performed for 2 min, followed by rinsing with tap water to achieve blue reversion, washing with distilled water, and then eosin staining for 1 min. The sections were dehydrated using a graded alcohol series and mounted with neutral resin. Images were acquired under a microscope.

[0122] Oil Red O staining (ORO): After dietary induction, equal volumes of liver tissue were collected from mice in each group, embedded in OCT scans, and then frozen sections were prepared. After thawing, the sections were fixed in 4% paraformaldehyde fixative for 20 min. After washing with distilled water, the sections were stained with 60% isopropanol for 2 min, then directly stained in Oil Red O staining solution in the dark for 20 min. After washing with distilled water, the sections were stained with hematoxylin for 2 min, washed with distilled water, and mounted with glycerol gelatin. Images were acquired under a microscope and photographed for analysis.

[0123] Depend on Figure 11 As can be seen, liver histological HE staining results showed that LNP-siRNA knockdown significantly reduced lipid droplet vacuoles in hepatocytes after THADA treatment, without any other adverse effects on hepatocyte morphology. Furthermore, liver Oil Red O staining showed a significant reduction in lipid levels in hepatocytes after LNP small interfering nucleic acid treatment, indicating that THADA small interfering nucleic acid treatment can effectively reverse fatty liver disease.

[0124] (5) Aortic dissection and collection in atherosclerotic mice

[0125] The mice were anesthetized and fixed, and then perfused systemically with pre-cooled saline after a cardiac incision. After the blood was drained, the aortic arch and abdominal aorta were separated, and the surrounding fat was removed. The entire aorta was then fixed in 4% paraformaldehyde fixative.

[0126] (6) Assessment of Oil Red O staining plaques in the aorta of atherosclerotic mice

[0127] The fully fixed aorta was removed from the fixative solution and washed with PBS to remove any remaining fixative. Under a stereomicroscope, the adipose tissue in the adventitia was further removed using fine forceps. The entire aorta was then longitudinally dissected distally along the greater curvature of the aortic arch. The dissected aorta was spread out with the intima facing upwards and fixed to a black dish with a small needle. Prepared Oil Red O staining solution was added for incubation and staining. After discarding the Oil Red stain, the aorta was differentiated with ethanol and washed, followed by microscopic imaging. ImageJ software was used to measure the plaque area and the total intima area. The relative percentage of the plaque was calculated by dividing the total plaque area by the total intima area. This was used to assess the severity of atherosclerotic plaque formation.

[0128] like Figure 12 As shown, multiple lipid plaques were observed in the aorta of the control atherosclerosis model mice stained with Oil Red O, indicating successful atherosclerosis modeling. Compared with this control group, the aorta of mice treated with THADA small interfering nucleic acid showed a significant reduction in Oil Red O staining lipids, and the plaques were significantly alleviated. Quantitative analysis of plaque area also showed that the total aortic plaque area of ​​mice treated with THADA small interfering nucleic acid was significantly reduced compared with the control group.

[0129] The experimental data from the above embodiments confirm that small interfering nucleic acid knockdown therapy targeting THADA can effectively reduce serum total cholesterol, low-density lipoprotein cholesterol, and triglyceride levels in atherosclerotic mice, improve hyperlipidemia and hepatic steatosis, and effectively alleviate the severity of atherosclerotic plaque lesions. These results provide sufficient in vivo biological evidence for the application of THADA in atherosclerotic cardiovascular diseases, further confirming that drugs targeting THADA can be used for the prevention and treatment of cardiovascular metabolic diseases such as hyperlipidemia and fatty liver disease.

[0130] The above studies, by constructing various animal models targeting THADA to simulate the pathogenesis of hyperlipidemia, fatty liver disease, and atherosclerotic cardiovascular diseases in humans, revealed the effective therapeutic effects of THADA inactivation in significantly improving lipid metabolism, reducing hyperlipidemia, improving fatty liver disease, and treating cardiovascular metabolic diseases such as atherosclerosis, without significant toxic side effects. This indicates that drugs targeting THADA inactivation or functional inhibition could serve as novel preventative and therapeutic agents for the aforementioned hyperlipidemia and atherosclerotic cardiovascular metabolic diseases.

[0131] Example 4: THADA overexpression induces hyperlipidemia and fatty liver disease in mice.

[0132] 1. Thada Construction of liver-specific overexpression mice

[0133] Constructed using adenovirus Thada A mouse model of THADA overexpression was constructed using a full-length gene overexpression vector via tail vein injection. Eight-week-old wild-type mice of the same weight were randomly divided into experimental and control groups. Mice in the experimental group were injected via tail vein with a solution of physiological saline. Thada Gene overexpression of adenoviruses can be effectively induced by the hepatotropic properties of adenoviruses. Control mice were given the same dose of physiological saline via tail vein injection.

[0134] 2. Sample collection and metabolic index detection of model mice

[0135] The THADA-overexpressing and control mice were administered the above-mentioned treatment via tail vein injection and fed a normal diet for two weeks before tissue collection. Serum levels of total cholesterol, LDL cholesterol, and triglycerides were measured using the method described in Example 1. Liver samples were fixed and stained with Oil Red O to detect triglyceride accumulation using the method described in Example 2.

[0136] Experimental data showed that, compared with control mice, THADA-overexpressing mice had significantly higher serum total cholesterol and LDL cholesterol levels. Figure 13 , 14 ), while serum triglyceride levels increased significantly ( Figure 15 This indicates that high expression of THADA can induce hypercholesterolemia and hyperlipidemia. Compared with control mice, mice in the THADA overexpression group showed obvious Oil Red O lipid droplets in their hepatocytes. Figure 16 The results indicate lipid accumulation in hepatocytes and manifestations of fatty liver disease. These findings collectively demonstrate that THADA overexpression can lead to hyperlipidemia and fatty liver disease, suggesting that THADA can serve as a molecular marker for the prediction, screening, or diagnosis of these diseases.

[0137] The above description is merely an embodiment of this application and is not intended to limit the scope of this application. Various modifications and variations can be made to this application by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should be included within the scope of the claims of this application.

Claims

1. The application of THADA in drug screening, characterized in that, The diseases treated by the drug are: hyperlipidemia, fatty liver disease, and atherosclerotic cardiovascular disease; The application involves using THADA as a drug target, wherein the drug inhibits or disrupts at least one of the following: THADA gene expression level; The function or activity of THADA protein; The drug is used to treat mammals or mammalian cells; The application involves constructing in vitro cell, organoid, or animal models that target the THADA gene, and using these models to screen for THADA inhibitors.

2. The application according to claim 1, characterized in that, The expression level of the THADA gene is either mRNA or protein expression level.

3. The application according to claim 1, characterized in that, The active ingredients of the drug include at least one of the following: nucleic acid, polypeptide, protein, natural extract, synthetic compound, and carrier that degrades THADA protein.

4. The application according to claim 3, characterized in that, The active ingredient in the drug is an enzyme.

5. The application according to claim 1, characterized in that, The active ingredient of the drug contains nucleic acids and / or vectors that knock out or reduce the THADA gene or interfere with the THADA gene via RNA.

6. The application according to claim 3 or 5, characterized in that, The vector is selected from at least one of the following: lentivirus, adenovirus, adeno-associated virus and plasmids for constructing viruses, GalNac conjugation modification, lipid delivery system, nanomaterial delivery system, polymer delivery system and external vesicles; The nucleic acid is selected from at least one of the following: double-stranded RNA, guide RNA, a complex formed by guide RNA and Cas9 protein, antisense oligonucleotides, and ribozymes.

7. The application according to claim 6, characterized in that, The double-stranded RNA is either siRNA or shRNA.

8. The application of THADA detection reagents in the preparation of reagents for disease prediction, screening, or diagnosis in test subjects, characterized in that, The disease in question is hyperlipidemia or fatty liver disease; High expression of the THADA gene can lead to disease, and the applications include using at least one of the following as biomarkers to prepare reagents for disease prediction, screening, or diagnosis: mRNA expressed by the THADA gene; and, Proteins expressed by the THADA gene; The test subject is a mammal or a mammalian cell.

9. The application according to claim 8, characterized in that, The reagent is used to detect the expression level of THADA gene mRNA or protein.

10. The application according to claim 8, characterized in that, The reagents are used for detection by gene sequencing, PCR, FISH, immunohistochemistry, ELISA, Western blot, or flow cytometry.

Images