Pleurotus eryngii strain and application thereof

Abstract

The invention discloses a pleurotus eryngii strain and application thereof. In the invention, aiming at bottle-type cultivation breeding and pleurotus eryngii strains, according to genome sequencing data, a Kmer subtraction assembly technology is adopted to compare whole genome sequencing data of 'Pleurotus eryngii 217' and parent 'Daiaoji No.1' pairwise to obtain specific difference fragment sequences (SV), difference fragments (SV) are obtained, four SV sequences are randomly selected to design four pairs of specific primers, and the specific primers are used for screening the whole genome sequencing data of the 'Pleurotus eryngii 217' and the parent 'Daiaoji No.1', so that the Pleurotus eryngii 217 'is obtained. Pleurotus eryngii strains' Fu Pleurotus eryngii 217 'are obtained through selfing hybridization breeding by taking pleurotus eryngii' Fu Pleurotus eryngii 'Fu Pleurotus eryngii' Fu Pleurotus eryngii 'Fu Pleurotus eryngii' Fu Pleurotus eryngii 'Fu Pleurotus eryngii' Fu Pleurotus eryngii 'Fu Pleurotus eryngii' Fu Pleurotus eryngii 'Fu Pleurotus eryngii' Fu Pleurotus eryngii 'Fu Pleurotus eryngii' Fu Pleurotus eryngii 'Fu Pleurotus eryngii' Fu Pleurotus eryngii 'Fu Pleurotus eryngii' Fu Pleurotus eryngii 'Fu Pleurotus The Pleurotus eryngii Fu 217 is spherical in pileus and light gray, the stipe color is white, the cultivation period is short, the yield is high, the Pleurotus eryngii Fu 217 can be stored and transported for a long time, and the Pleurotus eryngii Fu 217 has good development and application prospects.

Description

Technical Field

[0001] The invention belongs to the technical field of Pleurotus eryngii cultivation, and specifically relates to a Pleurotus eryngii strain and application thereof. Background Art

[0002] Pleurotus eryngii is the trade name of the Pleurotus eryngii, also known as dried scallop mushroom, snow mushroom, almond abalone mushroom, grassland boletus, etc. It belongs to the Basidiomycetes, Basidiomycetes, Hymecomycetes, Agaricales, Pleurotaceae, and Pleurotus in taxonomy. Pleurotus eryngii is very nutritious, containing rich vitamins, calcium, copper, zinc, iron and other minerals, and its plant protein content is as high as 25%. Pleurotus eryngii is also known as the "King of Oyster Mushrooms" and "Dried Scallop Mushroom" because of its thick flesh and crisp taste, especially the firm, dense, tender and milky white tissue of the stem, which can be eaten in its entirety. Pleurotus eryngii is an excellent and precious edible fungus with good health care functions. Regular consumption of Pleurotus eryngii can not only improve the body's own immune function, but also has anti-cancer, blood pressure lowering, blood lipid lowering, and good gastrointestinal digestion and absorption functions, and is deeply loved by the public. Pleurotus eryngii is native to southern Europe and was successfully cultivated in 1977. In the 1990s, the research on factory-based year-round cultivation technology and the breeding of new varieties were introduced and carried out. After decades of development, Pleurotus eryngii has become one of the most widely cultivated edible fungi in my country.

[0003] However, the varieties cultivated in my country are mainly introduced from Japan. "Riyin No. 1" is a variety of Pleurotus eryngii introduced from Japan by Zhangzhou Agricultural Science Research Institute after systematic selection and breeding. It passed the Fujian Province non-major crop variety certification in 2010 and has become the main cultivated variety of Pleurotus eryngii in my country. This variety has the characteristics of high yield, firm mushroom body, and good consistency of mushroom production. However, the cap of this variety is concave and dark in color, which can easily make consumers mistake it for deformed mushrooms and not fresh. At the same time, there are two types of cultivation methods in the current factory cultivation of Pleurotus eryngii, one is bottle cultivation (less material loading, shorter cultivation cycle); the other is bag cultivation (more material loading, longer cultivation cycle).

[0004] Therefore, it is necessary to improve it to adapt to the consumer market of Pleurotus eryngii. Summary of the invention

[0005] The purpose of the present invention is to provide a Pleurotus eryngii strain and its application in order to solve the above-mentioned problems.

[0006] The technical solution adopted by the present invention is as follows: a Pleurotus eryngii strain 'Fuxingbao 217', which is bred for bottle cultivation and classified as Pleurotus eryngii Fuxingbao 217. It was deposited in the China Center for Type Culture Collection on November 7, 2024, with a collection number of CCTCC M 20242462, and a collection address of No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province.

[0007] In a preferred embodiment, the Pleurotus eryngii strain (Pleurotus eryngii) Fuxingbao 217 is bred by self-pollination and hybridization with Pleurotus eryngii 'Riyin No. 1' as the parent. 'Riyin No. 1' has the characteristics of high yield, firm mushroom body, and good consistency of mushroom production. It is a variety widely used in factory cultivation of Pleurotus eryngii in my country. However, this variety has a darker cap color, and some consumers mistakenly believe that it is not fresh. According to cultivation tests, 'Fuxingbao 217' showed high and stable yield, with a spherical, light gray cap and a white stipe. Its yield is significantly better than that of 'Riyin No. 1', and the problem of the darker cap color of 'Riyin No. 1' has been improved. In addition, the cap of 'Fuxingbao 217' is spherical, while the cap of 'Riyin No. 1' is concave, and there are obvious differences in morphology ( Figure 1 ). After the pilot cultivar comparison test, the fruiting body of 'Fuxingbao 217' is straight, the cap is spherical and light gray, the stipe is white, the cultivation cycle is short, the yield is high, and it is resistant to storage and transportation. The average yield of 6 batches of 'Fuxingbao 217' is 253.0 grams per bottle, which is 13.87% higher than the control variety 'Riyin No. 1', and the increase in yield has reached a very significant level.

[0008] In a preferred embodiment, the Pleurotus eryngii strain of the present invention uses Kmer subtractive assembly technology to compare the whole genome sequencing data of 'Fuxingbao 217' and the parent 'Riyin No. 1' in pairs according to the genome sequencing data to obtain specific differential fragment sequences (SVs), obtain differential fragments (SVs), randomly select 4 SV sequences to design 4 pairs of specific primers (Chr1dP, Chr9dP, ChrXdP, ChrYdP), and amplify the Pleurotus eryngii base 'Fuxingbao 217' and the parent 'Riyin No. 1'. The PCR amplification results of each specific fragment are as follows: Figure 3 As shown: Chr1P and Chr9P are common to 'Riyin 1' and 'Fuxingbao 217', and Chr1dP and Chr9dP are unique to 'Riyin 1'. From the results, it can be concluded that the DNA fingerprints of the parent 'Riyin 1' of Pleurotus eryngii 'Fuxingbao 217' are significantly different, and they are definitely different varieties.

[0009] In summary, due to the adoption of the above technical solution, the beneficial effects of the present invention are:

[0010] In the present invention, the Pleurotus eryngii strain 'Fuxingbao 217' of the present invention is selected for bottle cultivation, and is obtained by self-crossing and hybridization with Pleurotus eryngii 'Riyin No. 1' as a parent, and has been deposited in the China Center for Type Culture Collection on November 7, 2024, with a deposit number of CCTCC M 20242462, and a deposit address of No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province. 'Fuxingbao 217' has a spherical cap and light gray, a white stipe, a short cultivation cycle, high yield, storage resistance, and transportation resistance, and has a good development and application prospect. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] Figure 1 : Fruiting bodies of Pleurotus eryngii strain 'Fuxingbao 217' and its parent 'Riyin 1', where the left side of the picture shows 'Fuxingbao 217' and the right side shows the fruiting body of its parent 'Riyin 1';

[0012] Figure 2 : The overall fruiting of Pleurotus eryngii strains 'Fuxingbao 217' and 'Riyin 1';

[0013] Figure 3 : The overall fruiting of Pleurotus eryngii strain 'Fuxingbao 217';

[0014] Figure 4 : PCR electrophoresis of specific fragments of Pleurotus eryngii strain 'Fuxingbao 217' and its parent 'Riyin 1', where 1 is Riyin 1; 2 is Fuxingbao 217. DETAILED DESCRIPTION

[0015] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0016] Reference Figure 1-4 , a strain of Pleurotus eryngii and its application The Pleurotus eryngii strain 'Riyin No. 1' is currently the main cultivated variety of Pleurotus eryngii. It was bred for bottle cultivation and preserved in the Fungus Research Center of Fujian Agriculture and Forestry University.

[0017] In the following examples, the mother culture medium is PDA medium, and the formula is: 200 g potato, 20 g glucose, 20 g agar, and 1000 mL water.

[0018] In the following embodiments, the culture medium used for the substitute planting is formulated as follows: 30% sawdust, 30% bagasse, 18% corn cobs, 10% wheat bran, 5% corn flour, 5% soybean meal, 1% gypsum, 1% lime, 66% ± 2% moisture content, 1180 ml cultivation bottles, each bottle containing 210 g (dry) culture medium.

[0019] Example 1: Breeding of Pleurotus eryngii 'Fuxingbao 217'

[0020] The breeding of Pleurotus eryngii 'Fuxingbao 217' includes the following steps:

[0021] (1) Creation of breeding materials: The parent 'Riyin No. 1' was cultivated and produced at Fujian Jiatian Agricultural Development Co., Ltd., and mature fruiting bodies were selected for spore collection. The spore print was taken into sterile water to prepare a spore suspension, which was fully mixed. After serial dilution, 100 μL of spore liquid was taken and spread on a 90 mm PDA plate culture medium, and placed in a 25°C incubator in the dark. On the second day of cultivation, spore germination was observed under a microscope. A single germinated spore was picked and inoculated to the slope of a PDA test tube and cultured at 25°C. When the hyphae germinated to a certain extent, a lock-like union was observed. The absence of a lock-like union was a monospore strain. By observing the lock-like union, 50 monospore strains of 'Riyin No. 1' were obtained.

[0022] (2) Single pairing: Select 20 monosporic strains with good growth potential and pair them in pairs, for a total of 190 combinations. Place them in a 25°C incubator for culture. After the mycelia of the two monosporic strains have been in contact for 5 days, take the mycelial blocks at the contact point and place them in a new PDA culture medium. After the new mycelia grow out, observe whether they have a lock-like union. If there is a lock-like union, it is a hybrid.

[0023] (3) Screening of hybrids: 80 hybrids with lock-like union were examined under a microscope. Based on the mycelial growth rate and growth potential, 20 hybrids with abnormal growth were eliminated. The remaining 60 hybrids with strong growth were screened for fruiting tests at Fujian Jiatian Agricultural Development Co., Ltd. Two hybrid strains (XB212 and XB217) with better yield and quality traits than the control variety 'Riyin No. 1' were selected for re-screening tests.

[0024] (4) The rescreening experiment was carried out in a bottle cultivation mode. The two hybrid strains XB212 and XB217 had good mushroom production characteristics, and the average single bottle yield was greater than 220 grams. Among them, XB217 had the highest yield, averaging 235.5 grams, with a light-colored, rounded cap, a white and dense stem, and good commercial properties; XB212 had a yield of 228.8 grams, a thicker stem, but some of the caps were uneven and thin. Therefore, the hybrid strain XB217 was retained and named Fuxingbao 217.

[0025] The Pleurotus eryngii strain 'Fuxingbao 217' was classified and named Pleurotus eryngii Fuxingbao 217. It was deposited in the China Center for Type Culture Collection on November 7, 2024, with the collection number CCTCC M 20242462, and the collection address is No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province.

[0026] Example 2: Effects of different temperatures on mycelial growth of Pleurotus eryngii 'Fuxingbao 217'

[0027] The hybrid strain of Pleurotus eryngii, Fuxingbao 217, was inoculated on PDA culture medium and cultured at constant temperatures of 5°C, 10°C, 15°C, 20°C, 25°C, 30°C and 35°C. As can be seen from Table 1, the mycelium growth temperature range of Fuxingbao 217 is between 10°C and 30°C, and the optimum growth temperature is between 25°C and 30°C.

[0028] Table 1 Mycelium growth rate test results (unit: cm / day)

[0029]

[0030] Example 3: Batch planting of Pleurotus eryngii strain 'Fuxingbao 217'

[0031] The main cultivar of Pleurotus eryngii, 'Riyin No. 1', was used as a control. The cultivars of 'Fuxingbao 217' and 'Riyin No. 1' were activated and liquid cultivars were prepared. Then, the production was carried out in bags. The planting site was Fujian Jiatian Agricultural Development Co., Ltd. The mushroom production management was carried out in accordance with the company's production method of Pleurotus eryngii. Six batches were planted continuously, of which 1200 bags were planted for each variety in the first five batches, and 2400 bags were planted for each variety in the sixth batch. It took 44 days from inoculation to harvest for 'Fuxingbao 217', while it took 45 days from inoculation to harvest for 'Riyin No. 1'. The yield, cap diameter, cap thickness, stipe diameter, and stipe length were measured at the time of harvest for each batch. The measurement data of 6 batches of 'Fuxingbao 217' and the control variety 'Riyin No. 1' were summarized and analyzed for significant differences. The results are listed in Table 2.

[0032] Table 2 Results of multiple batches of cultivation experiments

[0033]

[0034]

[0035] Note: 1. '**' means P < 0.01, the difference is extremely significant; 2. '-' means no difference.

[0036] After 6 batches of cultivation trials, the total average yield of 'Fuxingbao 217' was 253 grams per bottle, the average cap diameter was 43.7 mm, the thickness was 21.2 mm, the average stem diameter was 28.6 mm, and the length was 7.0 cm. The total average yield of the control variety 'Riyin No. 1' was 222.2 grams per bottle, the average cap diameter was 39.8 mm, the thickness was 19.0 mm, the average stem diameter was 27.2 mm, and the length was 6.9 cm. The total average yield of 'Fuxingbao 217' was 13.87% higher than that of the control variety 'Riyin No. 1' (the difference reached an extremely significant level).

[0037] Example 4: DNA fingerprints of Pleurotus eryngii 'Fuxingbao 217' and its parent 'Riyin 1'

[0038] The DNA samples were sent to Beijing Novogene Bioinformatics Technology Co., Ltd. for whole genome sequencing. After obtaining the sequencing data, the Kmer subtractive assembly technology was used to compare the whole genome sequencing data of 'Fuxingbao 217' and its parent 'Riyin No. 1' to obtain specific differential fragment sequences (SVs). Four SV sequences were randomly selected to design four pairs of specific primers (Chr1dP, Chr9dP, ChrXdP, ChrYdP) for amplification of Pleurotus eryngii 'Fuxingbao 217' and its parent 'Riyin No. 1'.

[0039] The PCR amplification results of each specific fragment are shown in Figure 3 As shown: Chr1P and Chr9P are common to 'Riyin No. 1' and 'Fuxingbao 217', and Chr1dP and Chr9dP are 'Riyin No. 1 unique fragments'. From the results, it can be concluded that the DNA fingerprints of the parent of Pleurotus eryngii 'Fuxingbao 217', 'Riyin No. 1', are significantly different, and are determined to be different varieties. The primer sequence of SV is shown in the table below:

[0040] Table 3 SV primer sequences

[0041]

[0042]

[0043] The DNA sequences of each specific fragment are:

[0044] Chr1P (960bp)

[0045] AAAGACGGGTTGATGGCTTTAACGGATATTGTGACATGGCTCACCTTCCTCCCACGTTACACATCGGC

[0046] GCGGAGGCTGCGATGCCAGCGATCTGCCGACTTACGATGAGTGTAGCGGCGTTCTTAGCCAATGGTCC

[0047] AGGCAGAGTGAAGATGAAATAGAGGAAGAAGCTAACGCAATACATCGGCGTTCTTCCAACTACCTCC

[0048] GAGAGAGGGGCAAAGAAAAGCGGCTGCAAACTTCGATGAGCGACGTACTTCCGAAGAAGATATCGG

[0049] ATTGAACCTACACCGACGCCAAACCCAATAACGAAGCAGGTAACGCTGAGGTTGATGATTTCTTGTGT

[0050] GGTATGTAAGTCTTCAACAGGGCCCGCCATGCTGTAGACAATTCAGTCAACCTTGTCGAGGCGCAAA

[0051] GCATTAGATCGGCGTACTCTCCAGTGACAATCGAGCTACCCAGCGCTACAGCAAGACACAAGAACGA

[0052] GGCCGCCATAGTAACGAACCTTAATATTTTTAAATTAGATCTATCAACCGAAGGGCACGGGTAAAGGC

[0053] GCATAAGCGAGAACTTGGGCACTCACCACTTCCTAGCGGAAGACCATTCACGAGGGTCTTCGCCAGT

[0054] ACCTTTCTCAAACGTCACGAAAGTGTAATCGCGTTGCGACGACGCGACTTCCACGTCCTTCTCGAGA

[0055] GTTTTGTCGATCGCTAATGCCATAACGATATCGGGGGAAGGATCGAAGGCTTCGTCCTTGCCATCTTCA

[0056] AAGGCAGTCTGTAACGAAGCTCGATGGGATGGAGAGGGCGTCGTAAATGAAGAAGACATAGCCGAA

[0057] AGAAGAGGAAGGGAGGAGGCAAGGAATTCTTAGCGAATCTCGGGCACATTATATAGGTTCAAGAGCA

[0058] GGCCGTTCGCCGCGACCGGGCGACCCCATCGGGTGCAAGAATGTAGCACTACACAGGTGTTATTTTG

[0059] AGGGCGAAAGTTATTCCG

[0060] Chr1dP(706bp)

[0061] CGATTCACCTTGTCTGCTCGCAGCAAAAAGGCAGCTGACGCCTGCTTGCGGCCTTGAGGCAGTGCT

[0062] CTCTTGCTAGTGACGCGCTTGGTGTGCCAGCAGCAGGGCCCAGTGAAGGCGAGGGGGGTGGTGAGA

[0063] ATCCCGATTTGGCCACTGAGGAGGTGCTGAACGTTGCGGAAGGGGAGGACGAGAAGGAGGAAATGG

[0064] AGGAGGAGGAGGAGGAGGAGCAGAGGAGGAGGAGAGATGGATTATGATGAGGAGGGATCAGATGATCGAGG

[0065] AGGATGAGGATGTGGAAGGTCATTGGACTAGCACAAGCGAAGGGCGAAGACCCGGTACAGATTCCC

[0066] TTGGATTCCACTCTATGGGTGGTGCTTCCAGCGACTACTCCCCTAGCAATTGCGAAGACGCAGCCGGC

[0067] AACGACGACTTTGAGTCCGGGCCGGGTCGTAATCTGCCCAAGCGACGAAAGTTCAAGCAACACACTA

[0068] GCGCCTTCTCCTCCTCCGTGCTAGATGCTTTCCATGAATTCATCTACGCATTCTTCAGTGAGTATGAATC

[0069] TGATACTGGACCCGAGGACGTCGTAAACCCTGTCGTCAAGTTCAATCACCCGCTAGAATGTTACTATG

[0070] CTCTCCGTGCGCTTCGTAGGGACGGGACTTTCCGACCTGGTTAGTCTCATTACCCAGCTCTTTGCCCAA

[0071] GCCAAGTACATATGCAGATGTGTCGCTTGGTACG

[0072] Chr9P(833bp)

[0073] TACATTTTCGAGCGTGTGGTCGGCGGCGTAACCGAGAAGTACCTTGTCGATCGCGACTTCCCTACGTC

[0074] CAACCTGCATTGCCCACTCCAAGGTTGTGAGCTTTCATTCCCAAGCACAAAGCAGCTTCGAGGGCAT

[0075] CTTGCGAAGCAGAATGAGGGAGGACAACTGCTGACAGGTCATGAAAATCAGCTTGCTGAGCCTGGAT

[0076] TCGGGTTCCATCCACGACCAACGTCCTCACGGCCGACTTTCCCCTGCACTTCAGAGAATCCTGATGCC

[0077] CGCAGGCTGCCCAGTGTAGGCTTGCCGTCGAGCCCTAGGCAGCTTGACTCATCTTTCCTCCCCGACTC

[0078] ATCACTCCTCCCCAAGCCTTCTTGCTCCACTGCCGATGCCGACGAGCTCTGTCATACTAGGTCACCCA

[0079] GACCGCCATCAAGAGCATCATCATTACAACTCACCAGCGATTCCCATGACACCCCTCAACTTCATTCC

[0080] ACTCCTTCTCCAGCCGCTGCTCCTGCACGACCATCACCAAGCCCGCAATTGCAAGACACCGATAACCG

[0081] TCACGGTGTGATGGACCCTACTTCTGCTGCCTCGCGTACGGGCTCAGCGGAGCTTCCCAACAATGGCG

[0082] CAGCAAGTTCTTCATCAGGCTGGCCTGTCCATGATCTTGCATCCGTTGACTTTCTGAGTTCTACCCCCG

[0083] AGCGTCCATCCTCCATCCCAGTACCTCCTTTGCCACTCCTTGCGCCATATTCTTGCACTCTACAGGATG

[0084] TTGAAGATTTGGCTGCTCAGACCTTCTGCCCTCTACCGCAGGAGCCTCTTCCAACTGGCATGGCTTCA

[0085] TTGCTGGATACCCTCCT

[0086] Chr9dP(728bp)

[0087] GTTGTTAATCTCGACGCGCTCTGCAGGACAAGCATGATAGCATCGACTCGTGCCCCTTCGCAACCGAC

[0088] ATCCTGAAGATTGCAGACTGCAGACGTCTCAAAACACTGCAATGGTGGTCCCTTCGGGCTCGCAGGG

[0089] GGTGGATCACCGCCGTGCATGGTGAACAAGGATAGTTCGCGTCAGAATGTAGGGTGTGGGACGGAGC

[0090] GATTGTGATTACCGTGTTGGTCTGGTCCGTCTCCATTGGGCACCGGTGCCGGTCAGCCTCCACGTTGC

[0091] GCTCCACGTGAACCTTGCTGACTTGCTTGTAGATACGATTTATGATGCGTCGATTATCATGTTCATCACC

[0092] ACTGTCGTCTGCGATTGCTCTGTCTGTGACAAGGCGTTTAGCTGTTGTGCGCTGCGACTTCACAATGT

[0093] CAAACTCCCCTTATCACAAACACCACGCCCACAGCCCCCGGTTCACCCTGGGCACCAAGTCACCCAT

[0094] CCATCGACAAAAGCGACGGCTGCACTCTATCTGCACAAGCTTTCATTCAGGCCCATACCTCTCACCTC

[0095] GTTGCCCAGCGTTCACAAGCAACCGATCCACACCGTTATTCAGGTCCACCGGCACACGACACGAACA

[0096] AACACAGAGTACACGAATGAGGGACTGACTGAGTAGGCAAGAAAGGGGGGCTGGGGACGAGAGAG

[0097] AGAGGGTGAACAGGAATAGAGATAGAGACGAAACGAGACGAAAAGCATGGAGG

[0098] ChrXdP(985bp)

[0099] TTGCTATCCCTGCCACTCAATCTTCTACAGATGTACCAACTAATCTTCACATCACCATCTTCATCACGTG

[0100] GGGCCACCGACAACATTGAGAACAATGAACTGTTACAAACCCCAGATGATGGCCAAGACAAGAAGG

[0101] CATCAAAGAAGTGTGTTGCGCAGTCATTAGGCATGTCAAGTGTCACTGCCCAGAGTATTGCCTATGCT

[0102] GCAGTCATGGTAAGTTTTCATGTCATCAATTCTTCAACTCAAGCTCACCTTTAATATTATCGCAGCTTCA

[0103] TTTCAACCTTAGCAACACATCACATTGGATACTCACACACAATAGCTTTAACTATGAGGCTTTCTACAA

[0104] ATCAATCGTCAACTATCTTGAAGACCCAGGTGACGAAGATGGCACCAAGGCCATTAAGGACTTGTTCG

[0105] AGTGGTGGAACTGGTACATCTTCTAATTCTGCCATGATCTTCAACTGCACCATTGTCATCTTCCATGTTA

[0106] CAGACATGTTTTTCCCAATGTGGCATTTTCTGAAAACTCAATGAAAACAGCAAACGACTTCAGGACCA

[0107] GGATCAACGAACAACAAGCCCTCCAGCACAATACCTGAGTCCACTGTTGATTTTCAGTATCAGTTCAG

[0108] CTATGATAGATTAGTAAATACATTGAATAAACCTTTTTCAATCTGTCAGTTATTCAATGATCCTTTAAACT

[0109] TCATGCATTATTGGTTTCAGTGGAATTAATCACCAACAATGATTGAGCATGACACTTACCTACATAGATT

[0110] GCGTATGTTGACTATATCATGCTATTATTTAGCAGTATGTGTATGACACCTGAAGAATGGATACACGCAG

[0111] ACATGTCTTCCAGGACTTGGCATACATTGCCTCCATACTCAATCATGGCGCAAAACCACCATGTACCTC

[0112] CCATACAAGTTGTGCTCTCGCATAGTAGATATTATTGATGGAGAGGCTAATATCCAAACATAAATTCGAC

[0113] ATGATGGAACCAGCCTCA

[0114] ChrYdP(1195bp)

[0115] CTCACATCTGCCTTCTTCGCGGCTTCCGACTTGACGCCTGCACCGCGAACTGGGGATGTTTTCGAAAG

[0116] GCCACGGTTATTCGTCGGCGATGCGCTATTGTCAACGCGAAACTCCTCGTGAGTCGTGATGACTCGTT

[0117] CTTCAACAGTCTCGGCAATCTTCTGCCGCTTCTTCTCCGGTTTCACTTCCACCGTCTCAACCACGTCGT

[0118] CGTCCTGCTGCTTCCGCTTCCGCTTCACATCTGATCGTCCTGCAGCGCGCGTCGATTTACTAGTTTCAG

[0119] ATTCCTCGACTGCGACGTTCTTCTTCGCTTGATACTTGGCTATTGCTTGGTCAAACCAGTCCGTGTGTT

[0120] CTGTATATCTGCCGCGCCACGATTGCCATGTGTGTCGCCGACTCCAACTCCATCGCTGATCCTCCTGTA

[0121] CGTAGAAGCATGAGACGAAGCGCGAGGGTGAAGACCCAGAACGTACGTTTGCTACCAGCTTTCTGTA

[0122] CAGCGCGTTTCCGCTTCTTCCATAGCGCCCCGGGTTGTGAAATGCGATATACTTCGCGAGGAGAATGT

[0123] CATCTTCGTGCGTGAAGGGATTTCTGGCCCTGGCAAAATGACCTTGGTATGAGTTCAGTGCTTGAAGT

[0124] CGGCTACTTACCCACTAGATTTGGACATTGTAAACAGTCGGGACCACAAGTAATATCTCAATCTTGGCA

[0125] GCTGCGTCGGGGACCACTGTAAGGAAATTACGTGACTTATGTGACCAAGTCGTGACTCGCGTTCATGA

[0126] CGATCACGTGATATACACGTTCTAACTATCAGGGACAACAACCTACAGCAGCTTTATATGAACTTGTCG

[0127] ACTTAACTTGCCGAGAATTCTAATCATGTTCAATTTCCAGGTCTCAGTGGGCAGGATTTGAGAAAGCA

[0128] TGAACTGTGGCGACCAGCAAGTGTACCAAGCCTCCTACGTCGTCTTTTTATCATAGGAAGATTTGCCATA

[0129] CCCGGCAAGTATAAGGGTGCGCCTCTCAAATCTATGATTCAAGCTAGGCTGATAAACCAGCCTCTCCT

[0130] CGAGAGTATGACGGTCGATGCTCTTAGAAGATTCAAGCCTGCCCACCATCAAATTTAACGTCACCCCT

[0131] TGCAGACTACGCAATCGATGATCGTTCTCCCAATGGACAGGAAATGTTCATACACTGTCGCACTCCAT

[0132] CCTACTCCACCTGAATAGGTCACTGGGCTGCTT

[0133] From the above, it can be known that in the present invention, the Pleurotus eryngii strain 'Fuxingbao 217' of the present invention is obtained by self-crossing and hybridization with Pleurotus eryngii 'Riyin No. 1' as the parent, and has been deposited in the China Center for Type Culture Collection on November 7, 2024, with a deposit number of CCTCC M 20242462, and a deposit address of No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province. 'Fuxingbao 217' has a spherical cap and light gray, a white stipe, a short cultivation cycle, high yield, storage resistance, and transportation resistance, and has a good development and application prospect.

[0134] It should be noted that, in this article, relational terms such as first and second, etc. are only used to distinguish one entity or operation from another entity or operation, and do not necessarily require or imply any such actual relationship or order between these entities or operations. Moreover, the term "comprise" or any other variant thereof is intended to cover non-exclusive inclusion, so that a process, method, article or device including a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements inherent to such process, method, article or device. In the absence of further restrictions, the elements defined by the sentence "comprise a ..." do not exclude the existence of other identical elements in the process, method, article or device including the elements.

[0135] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that the technical solutions described in the aforementioned embodiments may still be modified, or some of the technical features may be replaced by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A Pleurotus eryngii strain, characterized in that: The strain is classified and named as Abalone 217, and was deposited in the China Center for Type Culture Collection on November 7, 2024, with the collection number CCTCC M 20242462, and the collection address is No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province.

2. A Pleurotus eryngii strain as claimed in claim 1, characterized in that: The strain is obtained by self-crossing and breeding with Pleurotus eryngii 'Riyin No. 1' as a parent.

3. The protoplast of a Pleurotus eryngii strain as claimed in claim 1.

4. The fruiting body produced by the Pleurotus eryngii strain as claimed in claim 1.

5. Mycelium produced by the Pleurotus eryngii strain as claimed in claim 1.

6. A mushroom log produced by the Pleurotus eryngii strain as claimed in claim 1.

7. The use of a Pleurotus eryngii strain as claimed in claim 1, characterized in that: The application includes cultivating Pleurotus eryngii using the Pleurotus eryngii strain.

8. The use of a Pleurotus eryngii strain as claimed in claim 7, characterized in that: The breeding of Pleurotus eryngii 'Fuxingbao 217' comprises the following steps: (1) Creation of breeding materials: The parent 'Riyin No. 1' was cultivated and produced at Fujian Jiatian Agricultural Development Co., Ltd., and mature fruiting bodies were selected for spore collection; spore prints were taken into sterile water to prepare a spore suspension, which was fully mixed. After serial dilution, 100 μL of spore liquid was taken and spread on a 90 mm PDA plate culture medium, and placed in a 25°C incubator in the dark for incubation; on the second day of incubation, spore germination was observed under a microscope, and a single germinated spore was picked and inoculated onto the slope of a PDA test tube, and incubated at 25°C. When the hyphae germinated to a certain extent, a lock-like union was observed, and a single spore strain was obtained without a lock-like union; by observing the lock-like union, 50 single spore strains of 'Riyin No. 1' were obtained; (2) Single-spored pairing: 20 monospored strains with good growth were selected for pairing, with a total of 190 combinations. They were cultured in a 25°C incubator. After the mycelia of the two monospored strains had been in contact for 5 days, the mycelia blocks at the contact point were taken and placed in a new PDA medium. After the new mycelia grew out, the lock-like union was observed. The lock-like union was a hybrid. (3) Screening of hybrids: 80 hybrids with lock-like union were examined under a microscope. Based on the mycelial growth rate and growth potential, 20 hybrids with abnormal growth were eliminated. The remaining 60 hybrids with robust growth were screened for fruiting tests at Fujian Jiatian Agricultural Development Co., Ltd. Two hybrid strains (XB212 and XB217) with better yield and quality traits than the control variety 'Riyin No. 1' were selected and entered the re-screening test; (4) The re-screening experiment was carried out under the bottle cultivation mode. The two hybrid strains XB212 and XB217 had good mushroom production characteristics, and the average single-bottle yield was greater than 220 grams. Among them, XB217 had the highest yield, averaging 235.5 grams, with a light-colored, round cap, a white and dense stipe, and good commercial properties. XB212 had a yield of 228.8 grams, a thick stipe, but some parts of the cap were uneven and thin. Therefore, the hybrid strain XB217 was retained and named Fuxingbao 217.

9. The use of a Pleurotus eryngii strain as claimed in claim 8, characterized in that: In the step 1, the mother culture medium is PDA medium, and the formula is: 200g potato, 20g glucose, 20g agar, and 1000mL water.

10. The use of a Pleurotus eryngii strain as claimed in claim 8, characterized in that: In the step 1, the formula of the culture medium used for the substitute planting is: 30% sawdust, 30% bagasse, 18% corn cobs, 10% wheat bran, 5% corn flour, 5% soybean meal, 1% gypsum, 1% lime, water content 66%±2%, 1180 ml cultivation bottle, each bottle containing 210g of culture medium.

Images