Saccharomyces cerevisiae engineering bacterium with high yield of dammadienol as well as construction method and application of saccharomyces cerevisiae engineering bacterium

Abstract

The invention discloses a saccharomyces cerevisiae engineering bacterium with high yield of dammadienol as well as a construction method and application of the saccharomyces cerevisiae engineering bacterium. According to the research, the dammadienol engineering strain is constructed for the first time, efficient synthesis of dammadienol is realized, the problem that natural sources of rare ginsenoside are insufficient is solved, 'green synthesis' and sustainable utilization of the rare ginsenoside are promoted, and a foundation is laid for subsequent construction of rare ginsenoside cell factories. And moreover, heterologous synthesis of a multi-double-bond rare ginsenoside skeleton-dammadienol in the saccharomyces cerevisiae is realized, and a solid foundation is laid for subsequent biosynthesis of the dammadienol type rare ginsenoside. And a foundation is laid for improving the yield of the rare ginsenoside, realizing the purpose of obtaining the rare ginsenoside without planting and promoting the sustainable development of traditional Chinese medicine resources.

Description

Technical Field

[0001] The invention relates to the field of fermentation engineering, and in particular to an engineering strain of Saccharomyces cerevisiae with high damadienol production, and a construction method and application thereof. Background Art

[0002] Saccharomyces cerevisiae has clear genetic information, simple operation, low culture requirements, and the characteristics of both microorganisms and eukaryotes, showing significant advantages in the synthesis of terpenoids. In addition to its inherent robustness, Saccharomyces cerevisiae is closer to the main natural source of terpenoids, namely plants, in terms of intracellular environment, organelles and other subcellular structures, and post-translational modification mechanisms compared with prokaryotes such as Escherichia coli. At the same time, because Saccharomyces cerevisiae can produce a large number of terpenoids, it is a good new natural product production system. In yeast for winemaking, the synthesis of many terpenes has made significant progress. Other important terpenes such as coumaric acid and limonin can also be synthesized by Saccharomyces cerevisiae and obtain good application effects. Therefore, the use of Saccharomyces cerevisiae for heterologous synthesis of this substance has great application prospects. At present, the understanding of its synthesis regulation mechanism is not very thorough, and these issues will become one of the key directions for future development. The MVA pathway provides a direct source of precursors for terpenoids. Many important secondary metabolites such as flavonoids and phenolic acids can be obtained through this pathway. In recent years, terpenes and some heterologous natural substances produced through the downstream pathway of MVA, such as alkaloids, have been increasingly identified as being located on the endoplasmic reticulum and combined with endoplasmic reticulum engineering to show high yields. However, existing engineered bacteria still have problems such as long fermentation cycles and low product yields.

[0003] Ginsenosides, as the main active ingredients in ginseng, have important application value. However, their production and preparation are currently faced with problems such as long cycle, high cost, and difficult quality control. The use of synthetic biology methods to construct microbial cell factories has been proven to be one of the most promising methods for the synthesis of natural products, and extensive studies have preliminarily demonstrated the potential of this method for large-scale production of ginsenosides. The existing study successfully constructed the biosynthetic pathway of protopanaxadiol in Saccharomyces cerevisiae for the first time, increasing the yield of protopanaxadiol by 262 times. Then, through the optimization of the two-phase fermentation process, the yield of protopanaxadiol was finally increased to 1g / L. The researchers first cloned and identified the key UGT and P450 reductase PgCPR1 required for the synthesis of rare ginsenosides CK, Rh2, Rg3, Rh1 and F1 from ginseng. On this basis, through the construction and optimization of cell factories, the process of producing rare ginsenosides CK, Rh2, Rg3, Rh1 and F1 by monosaccharide fermentation was realized, and the current yield exceeded 2g / L.

[0004] However, unlike conventional damadienol-type ginsenosides, the biosynthetic pathways of the rare ginsenoside skeletons damadienol and ginsenoside Rk1 have not yet been elucidated, and the construction methods of related engineered strains have not been reported. Summary of the invention

[0005] The purpose of the present invention is to overcome the shortcomings and deficiencies of the prior art and provide an engineered yeast strain of saccharomyces cerevisiae with high yield of damadienol.

[0006] Another object of the present invention is to provide a method for constructing the above-mentioned high-yield damadienol Saccharomyces cerevisiae engineered bacteria.

[0007] The purpose of the present invention is achieved through the following technical solutions:

[0008] An engineered strain of Saccharomyces cerevisiae that produces high levels of damadienol has the following characteristics:

[0009] The yeast Saccharomyces cerevisiae was used as the starting strain, tHMGR, ERG12, IDI, ERG13, ERG10, ERG19, and ERG8 genes were overexpressed, AtSQS2, AtSQE2, SmFPS genes were transferred, and the damadienol synthase gene was transferred.

[0010] An engineered strain of Saccharomyces cerevisiae that produces high levels of squalene has the following characteristics:

[0011] The yeast Saccharomyces cerevisiae was used as the starting strain, tHMGR, ERG12, IDI, ERG13, ERG10, ERG19, and ERG8 genes were overexpressed, and AtSQS2, AtSQE2, and SmFPS genes were introduced to obtain the product.

[0012] The overexpression of tHMGR, ERG12, IDI, ERG13, ERG10, ERG19, and ERG8 genes is achieved by integrating the tHMGR, ERG12, IDI, ERG13, ERG10, ERG19, and ERG8 genes into the Gal7 site and Gal10-Gal1 site of the Saccharomyces cerevisiae chromosome.

[0013] The tHMGR gene is a tHMGR gene expression cassette, further comprising a promoter P PGK1 and terminator T ADH1 .

[0014] The ERG12 gene is an ERG12 gene expression cassette, further comprising a promoter P PDC1 and terminator T ADH2 .

[0015] The IDI gene is an IDI gene expression cassette, further comprising a promoter P ENO2and terminator T PDC1 .

[0016] The ERG13 gene is an ERG13 gene expression cassette, further comprising a promoter P FBA1 and terminator T TDH2 .

[0017] The ERG10 gene is an ERG10 gene expression cassette, further comprising a promoter P TEF1 and terminator T CYC1 .

[0018] The ERG19 gene is an ERG19 gene expression cassette, further comprising a promoter P PYK1 and terminator T PGI1 .

[0019] The ERG8 gene is an ERG8 gene expression cassette, further comprising a promoter P TDH3 and terminator T TPI1 .

[0020] The said transfer of AtSQS2, AtSQE2 and SmFPS genes is to integrate AtSQS2, AtSQE2 and SmFPS genes into the His3 site of the chromosome of Saccharomyces cerevisiae.

[0021] The AtSQS2 gene is an AtSQS2 gene expression cassette, further comprising a promoter P PGK1 and terminator T ADH1 .

[0022] The AtSQE2 gene is an AtSQE2 gene expression cassette, further comprising a promoter P TDH3 and terminator T TPI1 .

[0023] The SmFPS gene is a SmFPS gene expression cassette, which also contains a promoter P TEF1 and terminator T CYC1 .

[0024] The damadienol synthase gene is a gene of an enzyme that can synthesize damadienol using squalene as a substrate; preferably, it is at least one of OSC20433, SynOSC20433 and a SynOSC20433 mutant.

[0025] The damadienol synthase gene is introduced by a shuttle vector or homologous recombination method.

[0026] The shuttle vector is pESC-Ura; preferably, pESC-Ura is double-digested with BamHI and XohI endonucleases, and then the damadienol synthase gene is connected and transferred.

[0027] The homologous recombination is to integrate the damadienol synthase gene into the Saccharomyces cerevisiae chromosome; preferably, it is integrated into the Saccharomyces cerevisiae chromosome together with the AtSQE2 gene; more preferably, it is integrated into the Saccharomyces cerevisiae chromosome with the promoter P PGK1 and terminator T ADH1 The damadienol synthase gene and the promoter P TDH3 , terminator T TPI1 The expression cassette of the SynAtSQE2 gene was integrated into the chromosome of Saccharomyces cerevisiae.

[0028] The high-yield damadienol-producing Saccharomyces cerevisiae engineered strain also replaces the natural promoter of the endogenous gene ERG7 with a weak promoter P HXT1 .

[0029] The natural promoter of the endogenous gene ERG7 is replaced by the weak promoter P HXT1 This is achieved through CRISPR / Cas9 gene editing technology.

[0030] The brewer's yeast is brewer's yeast CEN.PK2-1D.

[0031] A method for constructing an engineered strain of Saccharomyces cerevisiae that produces high levels of damadienol comprises the following steps:

[0032] (1) Amplify Gal7-Up, Loxp-Ura-loxp, P containing homologous fragments PGK1 -tHMGR-T ADH1 , P PDC1 -ERG12-T ADH2 , P ENO2 -IDI-T PDC1 , P FBA1 -ERG13-T TDH2 , P TEF1 -ERG10-T CYC1 , P PYK1 -ERG19-T PGI1 , P TDH3 -ERG8-T TPI1 , Gal7-Down, and transformed into Saccharomyces cerevisiae, and strain GQ01 was obtained by screening;

[0033] (2) Amplify Gal10-Up, Loxp-Ura-loxp, P containing homologous fragments PGK1 -tHMGR-T ADH1 , P PDC1 -ERG12-T ADH2 , P ENO2 -IDI-T PDC1 , P FBA1 -ERG13-TTDH2 , P TEF1 -ERG10-T CYC1 , P PYK1 -ERG19-T PGI1 , P TDH3 -ERG8-T TPI1 , Gal1-Down, and transferred into strain GQ01 together, and strain GQ02 was obtained by screening;

[0034] (3) Amplification of His3-Up, Loxp-Ura-loxp, P containing homologous fragments PGK1 -AtSQS2-T ADH1 , P TDH3 -AtSQE2-T TPI1 , P TEF1 -SmFPS-T CYC1 , His3-Down, and transferred into strain GQ02 together, and strain GQ03 was obtained by screening;

[0035] (4) amplifying the damadienol synthase gene, connecting it to the vector backbone obtained by digesting the vector plasmid pESC-Ura with restriction enzymes BamHI and XohI, and transferring it into strain GQ03 to screen for an engineered Saccharomyces cerevisiae strain with high damadienol production;

[0036] Alternatively, amplify pcfb2988-Up, P TDH3 -SynAtSQE2-T TPI1 , damadienol synthase gene, and pcfb2988-Down were transferred into strain GQ03 to screen out an engineered Saccharomyces cerevisiae strain with high damadienol production.

[0037] The Gal7-Up and Gal7-Down are fragments located at the Gal7 site of the Saccharomyces cerevisiae genome, wherein the nucleotide sequence of Gal7-Up is shown in SEQ ID NO.3, and the nucleotide sequence of Gal7-Down is shown in SEQ ID NO.4.

[0038] The Gal10-Up and Gal1-Down are fragments located at the Gal10-Gal1 site of the Saccharomyces cerevisiae genome, wherein the nucleotide sequence of Gal10-Up is shown in SEQ ID NO.5, and the nucleotide sequence of Gal1-Down is shown in SEQ ID NO.6.

[0039] The His3-Up and His3-Down are fragments located at the His3 site of the Saccharomyces cerevisiae genome, wherein the nucleotide sequence of His3-Up is shown in SEQ ID NO.7, and the nucleotide sequence of His3-Down is shown in SEQ ID NO.8.

[0040] The pcfb2988-Up is an upstream fragment located at the Ty1cons2 site of the Saccharomyces cerevisiae genome, and the pcfb2988-Down is a downstream fragment carrying the selection marker gene Trp and located at the Ty1cons2 site of the Saccharomyces cerevisiae genome, wherein the nucleotide sequence of pcfb2988-Up is shown in SEQ ID NO.9, and the nucleotide sequence of pcfb2988-Down is shown in SEQ ID NO.10.

[0041] The Loxp-Ura-loxp is a fragment containing the screening marker gene Ura.

[0042] The P PGK1 -tHMGR-T ADH1 is a tHMGR gene expression cassette, further comprising a promoter P PGK1 and terminator T ADH1 .

[0043] The P PDC1 -ERG12-T ADH2 is an ERG12 gene expression cassette, further comprising a promoter P PDC1 and terminator T ADH2 .

[0044] The P ENO2 -IDI-T PDC1 is an IDI gene expression cassette, further comprising a promoter P ENO2 and terminator T PDC1 .

[0045] The P FBA1 -ERG13-T TDH2 is an ERG13 gene expression cassette, further comprising a promoter P FBA1 and terminator T TDH2 .

[0046] The P TEF1 -ERG10-T CYC1 is an ERG10 gene expression cassette, further comprising a promoter P TEF1 and terminator T CYC1 .

[0047] The P PYK1 -ERG19-T PGI1 is an ERG19 gene expression cassette, further comprising a promoter PPYK1 and terminator T PGI1 .

[0048] The P TDH3 -ERG8-T TPI1 is an ERG8 gene expression cassette, further comprising a promoter P TDH3 and terminator T TPI1 .

[0049] The P PGK1 -AtSQS2-T ADH1 is an AtSQS2 gene expression cassette, further comprising a promoter P PGK1 and terminator T ADH1 .

[0050] The P TDH3 -AtSQE2-T TPI1 is an AtSQE2 gene expression cassette, further comprising a promoter P TDH3 and terminator T TPI1 .

[0051] The P TEF1 -SmFPS-T CYC1 is a SmFPS gene expression cassette, which also contains a promoter P TEF1 and terminator T CYC1 .

[0052] The P TDH3 -SynAtSQE2-T TPI1 is a SynAtSQE2 gene expression cassette, further comprising a promoter P TDH3 and terminator T TPI1 .

[0053] The nucleotide sequence of the tHMGR gene is shown in the NCBI database sequence accession number NM_001182434.1.

[0054] The nucleotide sequence of the ERG12 gene is shown in the NCBI database sequence accession number NM_001182715.1.

[0055] The nucleotide sequence of the IDI gene is shown in the NCBI database sequence accession number NM_001183931.1.

[0056] The nucleotide sequence of the ERG13 gene is shown in the NCBI database sequence accession number NM_001182489.1.

[0057] The nucleotide sequence of the ERG10 gene is shown in the NCBI database sequence accession number NM_001183842.1.

[0058] The nucleotide sequence of the ERG19 gene is shown in the NCBI database sequence accession number NM_001183220.1.

[0059] The nucleotide sequence of the ERG8 gene is shown in the NCBI database sequence accession number NM_001182727.1.

[0060] The nucleotide sequence of the AtSQS2 gene is shown in the NCBI database sequence accession number NM_119631.3.

[0061] The nucleotide sequence of the AtSQE2 gene is shown in the NCBI database sequence accession number NM_127848.4.

[0062] The nucleotide sequence of the SmFPS gene is shown in the NCBI database sequence accession number HQ687768.1.

[0063] The nucleotide sequence of the SynAtSQE2 gene is shown in SEQ ID NO.11.

[0064] The nucleotide sequence of the selection marker gene Trp is shown in the NCBI database sequence accession number NP_010290.3.

[0065] The nucleotide sequence of the screening marker gene Ura is shown in NCBI database sequence accession number 856692.

[0066] The promoter P PGK1 The nucleotide sequence is shown in the NCBI database sequence accession number CP135951.1 from position 124102 to position 124853.

[0067] The promoter P PDC1 The nucleotide sequence is shown in the NCBI database sequence accession number CP135955.1 from position 216126 to position 216925.

[0068] The promoter P ENO2 The nucleotide sequence is shown in the NCBI database sequence accession number CP029160.1 from position 10603930 to position 10604929.

[0069] The promoter P FBA1 The nucleotide sequence is shown in NCBI database sequence accession number CP029160.1 from position 5910688 to position 5911509.

[0070] The promoter P TEF1The nucleotide sequence is shown in the NCBI database sequence accession number CP029160.1 from position 707052 to position 707481.

[0071] The promoter P PYK1 The nucleotide sequence is shown in the NCBI database sequence accession number CP029160.1 from position 6308912 to position 6309911.

[0072] The promoter P TDH3 The nucleotide sequence is shown in the NCBI database sequence accession number CP029160.1 from position 9954286 to position 9955085.

[0073] The promoter P HXT1 The nucleotide sequence is shown in the NCBI database sequence accession number CP036477.1 from position 292634 to position 293756.

[0074] The terminator T ADH1 The nucleotide sequence is shown in the NCBI database sequence accession number CP029160.1 from position 4671969 to position 4672126.

[0075] The terminator T ADH2 The nucleotide sequence is shown in NCBI database sequence accession number CP029160.1 from position 3398555 to position 3398954.

[0076] The terminator T PDC1 The nucleotide sequence is shown in NCBI database sequence accession number CP029160.1 from position 3660519 to position 3660915.

[0077] The terminator T TDH2 The nucleotide sequence is shown in the NCBI database sequence accession number CP029160.1 from position 11545244 to position 11545644.

[0078] The terminator T CYC1 The nucleotide sequence is shown in NCBI database sequence accession number KC879308.1 from position 1301 to position 1607.

[0079] The terminator T PGI1 The nucleotide sequence is shown in the NCBI database sequence accession number CP029160.1 from position 8108691 to position 8109092.

[0080] The terminator T TPI1The nucleotide sequence is shown in the NCBI database sequence accession number CP134412.1 from position 529841 to position 530242.

[0081] The damadienol synthase gene is a gene of an enzyme that can synthesize damadienol using squalene as a substrate; preferably at least one of OSC20433, SynOSC20433 and a SynOSC20433 mutant.

[0082] The nucleotide sequence of OSC20433 is shown in SEQ ID NO.1.

[0083] The nucleotide sequence of SynOSC20433 is shown in SEQ ID NO.2.

[0084] The mutant of SynOSC20433 is a nucleotide sequence obtained by mutation based on the nucleotide sequence shown in SEQ ID NO.4, and is one of the following: positions 7 to 9 are mutated to AGG, positions 256 to 258 are mutated to GAC, positions 271 to 273 are mutated to ACT, positions 436 to 438 are mutated to ACA, positions 502 to 504 are mutated to TCT, positions 820 to 822 are mutated to AGA, positions 862 to 864 are mutated to GAA, positions 1045 to 1047 are mutated to AGA, positions 1297 to 1299 are mutated to GAT, and positions 1318 to 1320 are mutated to AGA , positions 1528-1530 mutated to ACT, positions 1597-1599 mutated to GTG, positions 1630-1632 mutated to GAG, positions 1690-1692 mutated to TGC, positions 1762-1764 mutated to GAT, positions 1960-1962 mutated to GAT, positions 2110-2112 mutated to AGA, positions 2185-2187 mutated to TGC, positions 2194-2196 mutated to TCT, positions 2206-2208 mutated to TAT, and positions 2212-2214 mutated to ACA.

[0085] A method for producing damadienol comprises the following steps:

[0086] (1) inoculating an engineered strain of Saccharomyces cerevisiae that produces high levels of damadienol into a culture medium for culturing;

[0087] (2) The culture medium after cultivation is cracked and extracted to obtain damadienol.

[0088] The culture described in step (1) is carried out in a deficient SD-Trp liquid culture medium at 28 to 32° C. for 2 to 3 days.

[0089] The extraction in step (2) is to use an organic solvent to extract after lysing the bacteria; preferably, n-hexane is used for extraction.

[0090] The dammadienoic acid alcohol is Dammara-20,24-dien-3β-ol.

[0091] Compared with the prior art, the present invention has the following advantages and effects:

[0092] This study is the first to construct a damadienol engineered strain, achieving efficient synthesis of damadienol, solving the problem of insufficient natural sources of rare ginsenosides, promoting the "green synthesis" and sustainable utilization of rare ginsenosides, and laying the foundation for the subsequent construction of rare ginsenoside cell factories. In addition, the heterologous synthesis of damadienol, a multi-double-bond rare ginsenoside skeleton, in Saccharomyces cerevisiae was achieved, laying a solid foundation for the subsequent biosynthesis of damadienol-type rare ginsenosides. It has laid the foundation for increasing the yield of rare ginsenosides, achieving the "harvest without planting" of rare ginsenosides, and promoting the sustainable development of Chinese medicine resources. BRIEF DESCRIPTION OF THE DRAWINGS

[0093] Figure 1 This is a comparison chart between the wild strain CEN.PK2-1D and the strain GQ01.

[0094] Figure 2 This is a comparison chart of strain GQ01 and strain GQ02.

[0095] Figure 3 This is a comparison chart of strain GQ03 and strain GQ02.

[0096] Figure 4 This is a map of the pESC-Ura-OSC20433 expression vector and the gel electrophoresis verification results.

[0097] Figure 5 This is the GC-MS detection result of pESC-Ura-OSC20433 product.

[0098] Figure 6 This is the GC-MS test result of the target product peak of OSC20433 after preparation and purification.

[0099] Figure 7 This is the structural identification result diagram of the target product P1 of OSC20433.

[0100] Figure 8 This is a comparison chart of strain AE2001 and strain GQ03.

[0101] Fig. 9 This is a comparison chart of strain AE2001 and strain AE2002.

[0102] Fig.10 The figure is the relative yield result of OSC20433 mutant and wild-type control.

[0103] Fig.11 This is a comparison chart of strain AE2002 and strain AE2003.

[0104] Fig.12 This is a comparison chart of strain AE2003 and strain AE2004.

[0105] Fig.13 This is the test result of strain AE2004 2L fermenter. DETAILED DESCRIPTION

[0106] The present invention is further described in detail below in conjunction with embodiments and drawings, but the embodiments of the present invention are not limited thereto.

[0107] If no specific experimental conditions are specified in the following embodiments, conventional experimental conditions or experimental conditions recommended by the reagent company are generally followed. The materials and reagents used, unless otherwise specified, are all reagents and materials obtained from commercial sources.

[0108] The plasmid pLB-P used in the present invention PGK1 -tHMGR-T ADH1 , pLB-P PDC1 -ERG12-T ADH2 , pLB-P ENO2 -IDI-T PDC1 , pLB-P FBA1 -ERG13-T TDH2 , pLB-P TEF1 -ERG10-T CYC1 、pUC19-P PYK1 -ERG19-T PGI1 、pUC19-P TDH3 -ERG8-T TPI1, pESC-Ura-AtSQS2, pESC-Ura-AtSQE2, and pESC-Ura-SmFPS are all stored in the laboratory of Guangzhou University of Chinese Medicine. The pLB plasmid was constructed by sequentially constructing the promoter, gene, and terminator into the pLB plasmid using the pLB zero background rapid cloning kit without a multiple cloning site. pcfb2988-Trp is the pcfb2988 plasmid including the Trp selection marker. The same is true for pUC19 and pESC-Ura plasmids. Unless otherwise specified, the expression cassette is located between the restriction sites EcoRI and Hind III. The plasmid construction method is an existing common technical means, which can be referred to in literature such as "Lin Tingting, Wang Dong, Dai Zhubo, et al. Creation of Saccharomyces cerevisiae cell factory for fermentation production of lupeol [J]. China Journal of Traditional Chinese Medicine, 2016, 41(6): 8. DOI: 10.4268 / cjcmm20160606."

[0109] Example 1 Construction of a high-yield squalene-producing Saccharomyces cerevisiae chassis strain

[0110] 1.1 Construction of yeast strain GQ01

[0111] (1) Using plasmid pLB-P PGK1 -tHMGR-T ADH1 As template, use primer P with homology arm in Table 1 PGK1 -F and T ADH1 -R was cloned and fragment P was amplified PGK1 -tHMGR-T ADH1 ; plasmid pLB-P PDC1 -ERG12-T ADH2 As template, use primer P with homology arm in Table 1 PDC1 -F and T ADH2 -R was cloned and fragment P was amplified PDC1 -ERG12-T ADH2 ; plasmid pLB-P ENO2 -IDI-T PDC1 As template, use primer P with homology arm in Table 1 ENO2 -F and T PDC1 -R was cloned and fragment P was amplified ENO2 -IDI-T PDC1 ; plasmid pLB-P FBA1 -ERG13-T TDH2 As template, use primer P with homology arm in Table 1 FBA1 -F and T TDH2 -R was cloned and fragment P was amplified FBA1 -ERG13-T TDH2 ; plasmid pLB-P TEF1 -ERG10-TCYC1 As template, use primer P with homology arm in Table 1 TEF1 -F and T CYC1 -R was cloned and fragment P was amplified TEF1 -ERG10-T CYC1 ; plasmid pUC19-P PYK1 -ERG19-T PGI1 As template, use primer P with homology arm in Table 1 PYK1 -F and T PGI1 -R was cloned and fragment P was amplified PYK1 -ERG19-T PGI1 ; plasmid pUC19-P TDH3 -ERG8-T TPI1 As template, use primer P with homology arm in Table 1 TDH3 -F and T TPI1 -R was cloned and fragment P was amplified TDH3 -ERG8-T TPI1 ; Using the genome of the wild-type strain CEN.PK2-1D as a template, use the primers Gal7-up-F and Gal7-up-R in Table 1 to clone the fragment Gal7-Up, and use Gal7-down-F and Gal7-down-R to clone the fragment Gal7-Down. Using the plasmid pESC-Ura-loxp as a template, use the primers Loxp-Ura-loxp-F and Loxp-Ura-loxp-R in Table 1 to clone the fragment Loxp-Ura-loxp. After the PCR amplification is completed, the 10 cloned fragments are detected by gel electrophoresis. If the correct positive band appears, the kit can be used for column recovery and purification. After the recovery is completed, the above 10 fragments can be concentrated to 30 μL.

[0112] Table 1 Primers for constructing the MVA upstream expression module

[0113]

[0114] (2) The 10 purified fragments Gal7-Up, Loxp-Ura-loxp, P PGK1 -tHMGR-T ADH1 , P PDC1 -ERG12-T ADH2 , P ENO2 -IDI-T PDC1 , P FBA1 -ERG13-T TDH2 , P TEF1 -ERG10-T CYC1 , P PYK1 -ERG19-T PGI1 , PTDH3 -ERG8-T TPI1 , Gal7-Down was transferred into the wild-type strain CEN.PK2-1D through the lithium acetate yeast transformation method, spread on the solid culture medium of SD-Ura, and waited for 2-3 days. After a single clone grows out, pick the positive monoclonal colony, expand it and induce expression (defective SD-Ura culture medium, glucose induced expression, 30°C). After 2-3 days of expression, the extracted bacteria were crushed and extracted with n-hexane, and the squalene production was detected by GC-MS. After GC-MS detection, the squalene production of strain GQ01 was significantly improved to 277.14±16.42 mg / L, which is nearly 34 times higher than that of the wild type. Figure 1 As shown in B.

[0115] 1.2 Construction of yeast strain GQ02

[0116] (1) Using the genome of the wild-type strain CEN.PK2-1D as a template, use the primers Gal10-up-F and Gal10-up-R in Table 2 to clone the fragment Gal10-Up, and use Gal1-down-F and Gal1-down-R to clone the fragment Gal1-Down. Using the plasmid pESC-Ura-loxp as a template, use the primers Gal10-Loxp-Ura-F in Table 2 and the primers Loxp-Ura-loxp-R in Table 1 to clone the fragment Loxp-Ura-loxp. The remaining MVA upstream pathway genes were amplified according to the method in 1.1. After the PCR amplification was completed, the above 10 fragments were concentrated to 30 μL after detection, purification, and recovery.

[0117] Table 2 Primers for constructing the upstream expression module of the MVA pathway overexpressed at the Gal1-Gal10 locus

[0118]

[0119] (2) The 10 fragments Gal10-Up, Loxp-Ura-loxp, P PGK1 -tHMGR-T ADH1 , P PDC1 -ERG12-T ADH2 , P ENO2 -IDI-T PDC1 , P FBA1 -ERG13-T TDH2 , P TEF1 -ERG10-T CYC1 , P PYK1 -ERG19-T PGI1 , P TDH3 -ERG8-T TPI1, Gal1-Down was transferred into strain GQ01 by lithium acetate yeast transformation method, and then spread on SD-Ura solid medium and waited for 2-3 days. After a single clone grew out, it was expanded and induced to express using the method described in 1.1. After 2-3 days of expression, extraction test was performed to detect the squalene content in the bacteria. After GC-MS detection, the squalene production of strain GQ02 was slightly increased to 334.20±14.40mg / L, as shown in Figure 2. Figure 2 As shown in B.

[0120] 1.3 Construction of yeast strain GQ03

[0121] (1) Using plasmid pLB-P PGK1 -tHMGR-T ADH1 As template, use the primers FXPCR-P in Table 3 PGK1 -R and FXPCR-T ADH1 -F was cloned and the vector fragment pLB-P was amplified PGK1 -T ADH1 ; Using plasmid pESC-Ura-AtSQS2 as template, primers AtSQS2-F and AtSQS2-R with homology arms in Table 3 were used for cloning to amplify the gene fragment AtSQS2. PGK1 -T ADH1 The homologous recombination was carried out with the gene fragment AtSQS2, and the homologous products were transformed into E. coli DH5α competent cells. After the long plate was grown, the E. coli colony PCR was performed, and the positive single clone was selected for sequencing. After the sequencing was correct, the plasmid was extracted to obtain the plasmid pLB-P PGK1 -AtSQS2-T ADH1 .

[0122] (2) Using plasmid pUC19-P TDH3 -ERG8-T TPI1 As template, use the primers FXPCR-P in Table 3 TDH3 -R and FXPCR-T TPI1 -F was cloned and the vector fragment pUC19-P was amplified TDH3 -T TPI1 ; Using plasmid pESC-Ura-AtSQE2 as template, primers AtSQE2-F and AtSQE2-R with homology arms in Table 3 were used for cloning to amplify the gene fragment AtSQE2. TDH3 -T TPI1 After homologous recombination, transformation, screening, and sequencing verification with the gene fragment AtSQE2, plasmid was extracted to obtain plasmid pUC19-P TDH3 -AtSQE2-T TPI1 .

[0123] (3) Using plasmid pLB-P TEF1 -ERG10-T CYC1 As template, use the primers FXPCR-P in Table 3 TEF1 -R and FXPCR-T CYC1 -F was cloned and the vector fragment pLB-P was amplified TEF1 -T CYC1 ; Using plasmid pESC-Ura-SmFPS as template, primers SmFPS-F and SmFPS-R with homology arms in Table 3 were used for cloning to amplify the gene fragment SmFPS. TEF1 -T CYC1 After homologous recombination, transformation, screening, and sequencing verification with the gene fragment SmFPS, plasmid was extracted to obtain plasmid pLB-P TEF1 -SmFPS-T CYC1 .

[0124] (4) The plasmid pLB-P obtained in step (1) PGK1 -AtSQS2-T ADH1 As template, use primer P with homology arm in Table 3 PGK1 -F and T ADH1 -R1 was cloned and fragment P was amplified PGK1 -AtSQS2-T ADH1 ; The plasmid pUC19-P obtained in step (2) TDH3 -AtSQE2-T TPI1 As template, use primer P with homology arm in Table 3 TDH3 -F1 and T ADH1 -R was cloned and fragment P was amplified TDH3 -AtSQE2-T TPI1 ; The plasmid pLB-P obtained in step (3) TEF1 -SmFPS-T CYC1 As template, use primer P with homology arm in Table 3 TEF1 -F and T CYC1 -R1 was cloned and fragment P was amplified TEF1 -SmFPS-T CYC1; Using the wild-type CEN.PK2-1D genome as a template, the primers His3-up-F and His3-up-R in Table 3 were used to clone the fragment His3-Up, and the fragment His3-down was cloned using His3-down-F and His3-down-R. Using the plasmid Loxp-Ura-loxp as a template, the primers Loxp-Ura-loxp-F1 and Loxp-Ura-loxp-R in Table 1 were used to clone the fragment Loxp-Ura-loxp. After the PCR amplification was completed, the above 6 fragments were concentrated to 30 μL after detection, purification, and recovery.

[0125] Table 3 Primers for constructing the downstream expression module of the MVA pathway by overexpression of the His3 site

[0126]

[0127]

[0128] (5) The six fragments His3-Up, Loxp-Ura-loxp, P PGK1 -AtSQS2-T ADH1 , P TDH3 -AtSQE2-T TPI1 , P TEF1 -SmFPS-T CYC1 , His3-Down was transferred into strain GQ02 by lithium acetate yeast transformation method, and then spread on SD-Ura solid medium and waited for 2-3 days. After a single clone was grown, it was expanded and induced for expression according to the method in 1.1. After 2-3 days of expression, extraction test was performed to detect the squalene production in the bacteria. After GC-MS detection, the squalene production of strain GQ03 increased to 421.58±33.89mg / L, which was 50 times higher than that of the wild-type strain. Figure 3 As shown in B.

[0129] Example 2 Identification of OSC20433 metabolites and construction of yeast engineering strains

[0130] 2.1 Biochemical function identification of OSC20433

[0131] 2.1.1 Construction of pESC-Ura-OSC20433 expression vector

[0132] The inventors discovered a protein for the biosynthesis of damadienol from Artemisia argyi H.Lév.&Vaniot of the Asteraceae family, named OSC20433, and the corresponding nucleotide sequence is shown in SEQ ID NO.2. A commercial company was commissioned to synthesize a gene-containing vector based on the sequence of the gene OSC20433, and the primers OSC20433-F and OSC20433-R in Table 4 were used for cloning to amplify the target gene fragment OSC20433. The vector plasmid pESC-Ura was cut open using restriction enzymes BamHI and XohI. The target gene fragment and the enzyme-cut vector plasmid were homologously ligated and transformed into Escherichia coli competent cells. Escherichia coli colony PCR verification was performed using primers F1-F and F1-R in Table 4, and the positive single clone transformants were sent for sequencing detection. After the sequencing was correct, the plasmid was extracted to obtain the plasmid pESC-Ura-OSC20433. The plasmid map is shown in the figure. Figure 4 As shown in A.

[0133] Table 4 Primers for constructing OSC20433 expression vector plasmid

[0134]

[0135] 2.1.2 Characterization of OSC20433 yeast heterologous function

[0136] The successfully constructed yeast expression vector pESC-Ura-OSC20433 was transferred into the high-yield squalene chassis strain GQ03 by lithium acetate transformation method and coated on the solid medium of SD-Ura. After the plate grows a single clone, the yeast colony PCR verification is performed and the positive single clone is selected. High-density fermentation is carried out in a 5L fermenter, and YNB defective medium is selected for fermentation, and galactose is fed for induction expression. The fermentation can be completed after 5-7 days. The fermentation bacteria and the fermentation supernatant are extracted with n-hexane, and then separated and purified by reverse chromatographic column, using methanol-water gradient elution, collecting 52-62 parts of the fractions and merging them for forward silica gel column purification, using 35:1 petroleum ether-ethyl acetate as the mobile phase for elution, taking fraction 21 and using 78% isopropanol-water as the mobile phase for purification, spin drying, and obtaining the target product sample P1.

[0137] The purified sample P1 was 1 H-NMR, 13 C-NMR nuclear magnetic spectrum detection and analysis, the measured data was imported into the database for query, the queried data was compared with the processed data, and the product peak P1 was determined to be Dammara-20,24-dien-3β-ol, proving that the OSC20433 gene is dammaradienol synthase. The nuclear magnetic data is as follows Figure 7 shown.

[0138] 2.1.3 Construction of yeast strain AE2001

[0139] (1) Using plasmid pESC-Ura-OSC20433 as template, use primers P with homology arms in Table 5. PGK1 -OSC20433-F and OSC20433-T ADH1 -R was used for cloning and the target gene fragment OSC20433 was amplified; the plasmid pLB-P PGK1 -tHMGR-T ADH1 As template, use primers FXPCR-P in Table 5 PGK1 -R and FXPCR-T ADH1 -F was cloned and the vector fragment pLB-P was amplified PGK1 -T ADH1 . Insert the vector fragment pLB-P PGK1 -T ADH1 After homologous recombination, transformation, screening, and sequencing verification with gene fragment OSC20433, plasmid was extracted to obtain plasmid pLB-P PGK1 -OSC20433-T ADH1 .

[0140] (2) Using plasmid pUC19-P TDH3 -AtSQE2-T TPI1 As template, primer pcfb2988-P with homology arms in Table 5 was used. TDH3 -F and pcfb2988-P PGK1 -R was cloned and fragment P was amplified TDH3 -AtSQE2-T TPI1 ; The plasmid pLB-P prepared in step (1) PGK1 -OSC20433-T ADH1 As template, primer pcfb2988-P with homology arms in Table 5 was used. PGK1 -F and pcfb2988-T ADH1 -R was cloned and fragment P was amplified PGK1 -OSC20433-T ADH1 Using plasmid pcfb2988-Trp as template, primers pcfb2988-up-P with homology arms in Table 5 were used. TDH3 -F and pcfb2988-up-R to clone the fragment pcfb2988-Up, and pcfb2988-T with homology arms in Table 5 ADH1 -down-F and pcfb2988-down-R were used to clone the fragment pcfb2988-Down with Trp marker. After PCR amplification, the above four fragments were concentrated to 30 μL after detection, purification and recovery.

[0141] Table 5 Primers for cloning module of overexpression OSC20433 gene

[0142]

[0143] (3) The four fragments pcfb2988-Up, P TDH3 -AtSQE2-T TPI1 , P PGK1 -OSC20433-T ADH1 pcfb2988-Down was transformed into strain GQ03 by lithium acetate yeast transformation method, and then spread on SD-Trp solid medium and waited for 2-3 days. After a single clone was grown, yeast colony PCR was performed to verify the positive single clone colony, and the strain AE2001 was named.

[0144] (4) Select positive monoclonal colonies and culture them in 3 ml SD-Trp deficient medium for 8-12 h, then transfer them to 50 ml shake flasks at a ratio of 2% for glucose induction expression for 3 days, and sample them every 12 h to detect the colony density (OD 600 After the expression, the cells were lysed to detect the production of squalene and damadienol in the cells. The GC-MS test results are shown in Figure 8 As shown, there is still a large amount of precursor squalene remaining, the catalytic efficiency of OSC20433 cyclase is low, and the conversion rate is not high, so that its damadienol production is only 31.58±1.65mg / L. In order to further increase the yield of damadienol in strain AE2001, we sent the two genes AtSQE2 and OSC20433 integrated in this step to General Biotechnology (Anhui) Co., Ltd. for codon optimization to improve its catalytic efficiency and obtain a higher yield of damadienol.

[0145] 2.1.4 Construction of yeast strain AE2002

[0146] (1) Using the codon-optimized plasmid pUC57-SynOSC20433 as a template, the primers SynOSC20433-F and SynOSC20433-R with homology arms in Table 6 were used for cloning to amplify the target gene fragment SynOSC20433 (SEQ ID NO. 4); using the plasmid pLB-P PGK1 -tHMGR-T ADH1 As template, use primers FXPCR-P in Table 6 PGK1 -R and FXPCR-T ADH1 -F was cloned and the vector fragment pLB-P was amplified PGK1 -T ADH1 . Insert the vector fragment pLB-P PGK1 -TADH1 After homologous recombination, transformation, screening, and sequencing verification with the gene fragment SynOSC20433, plasmids were extracted to obtain plasmid pLB-P PGK1 -SynOSC20433-T ADH1 .

[0147] (2) Using the codon-optimized plasmid pUC57-SynAtSQE2 as a template, the primers SynAtSQE2-F and SynAtSQE2-R with homology arms in Table 6 were used for cloning to amplify the target gene fragment SynAtSQE2; the primers FXPCR-P in Table 6 were used to TDH3 -R and FXPCR-T TPI1 -F was cloned and the vector fragment pUC19-P was amplified TDH3 -T TPI1 ; Put the vector fragment pUC19-P TDH3 -T TPI1 After homologous recombination, transformation, screening, and sequencing verification with the gene fragment SynAtSQE2, plasmid was extracted to obtain plasmid pUC19-P TDH3 -SynAtSQE2-T TPI1 .

[0148] (3) The plasmid pUC19-P obtained in step (2) TDH3 -SynAtSQE2-T TPI1 As template, primer pcfb2988-P with homology arms in Table 5 was used. TDH3 -F and pcfb2988-P PGK1 -R was cloned and fragment P was amplified TDH3 -SynAtSQE2-T TPI1 ; The plasmid pLB-P obtained in step (1) PGK1 -SynOSC20433-T ADH1 As template, primer pcfb2988-P with homology arms in Table 5 was used. PGK1 -F and pcfb2988-T ADH1 -R was cloned and fragment P was amplified PGK1 -SynOSC20433-T ADH1 Using plasmid pcfb2988-Trp as template, primers pcfb2988-up-P with homology arms in Table 5 were used. TDH3 -F and pcfb2988-up-R to clone the fragment pcfb2988-Up, and pcfb2988-T with homology arms in Table 5 ADH1-down-F and pcfb2988-down-R were used to clone the fragment pcfb2988-Down with Trp marker. After PCR amplification, the above four fragments were concentrated to 30 μL after detection, purification and recovery.

[0149] Table 6 Primers for overexpression of SynOSC20433 gene cloning module

[0150]

[0151] (4) The four fragments pcfb2988-Up, P TDH3 -SynAtSQE2-T TPI1 , P PGK1 -SynOSC20433-T ADH1 pcfb2988-Down was transformed into strain GQ03 by lithium acetate yeast transformation method, and then spread on SD-Trp solid medium and waited for 2-3 days. After a single clone was grown, yeast colony PCR was performed to verify the result. Fig. 9 As shown, the positive monoclonal colony was named strain AE2002.

[0152] (5) Cultivate according to the method in 2.1.3, take samples every 12 hours to detect the colony density, and lyse the cells after the expression to detect the production of damadienol in the cells. The GC-MS test results are as follows: Fig. 9 As shown, the experimental results showed that the catalytic efficiency of gene OSC20433 was improved after codon optimization, and the damadienol production was 59.21±3.36 mg / L.

[0153] Example 3 Site-directed mutagenesis of OSC20433 gene

[0154] 3.1 Construction of mutants

[0155] (1) Select the mutation position close to the front end or the end for whole plasmid mutation, such as K3R, E86D, N91T, F168S, M729C, C732S, F736Y, E738T. Use the plasmid pESC-Ura-OSC20433 as a template and use the corresponding primers in Table 7 for whole plasmid cloning. After amplification, perform gel electrophoresis verification. If the correct positive band appears, take 5 μL of the PCR reaction sample, add the digestion enzyme DnpI to digest for 40-50 minutes, and inactivate at 80℃ for 5 minutes. After the reaction is completed, the inactivated sample is transformed into Escherichia coli DH5α competent cells, and after the long plate is grown, the Escherichia coli colony PCR is performed, and the positive single clone is selected for sequencing detection. After the sequencing is correct, the plasmid is extracted to obtain the mutant plasmid pESC-Ura-OSC20433. K3R、pESC-Ura-OSC20433 E86D 、pESC-Ura-OSC20433 N91T 、pESC-Ura-OSC20433 F168S 、pESC-Ura-OSC20433 M729C 、pESC-Ura-OSC20433 C732S 、pESC-Ura-OSC20433 F736Y 、pESC-Ura-OSC20433 E738T .

[0156] (2) The remaining mutant plasmids located in the middle can be constructed using overlapping PCR cloning. Using plasmid pESC-Ura-OSC20433 as a template, primer OSC20433-F and related mutant primer R in Table 7 are used to amplify the 5′ end of the mutant plasmid; the 3′ end of the mutant plasmid is amplified using the related mutant primers F and OSC20433-R in Table 7. After the amplification is completed, gel electrophoresis is used to verify whether the band is correct. If the amplified band is correct, the next round of overlapping PCR cloning can be performed. Using the gene fragments at the 5′ and 3′ ends of the amplified mutant plasmid as templates, primers OSC20433-F and OSC20433-R in Table 7 are used for amplification to amplify the full-length fragment with the mutation position OSC20433. After amplification, homologous recombination was performed with the enzyme-cut vector pESC-Ura, and the homologous products were transformed into E. coli DH5α competent cells. After long plates, E. coli colony PCR was performed, and positive single clones were selected for sequencing. After sequencing was correct, plasmid extraction was performed to obtain the mutant plasmid pESC-Ura-OSC20433 Q288E 、pESC-Ura-OSC20433 E433D 、pESC-Ura-OSC20433 Q544E 、pESC-Ura-OSC20433 K349R 、pESC-Ura-OSC20433 N510T 、pESC-Ura-OSC20433 K440R 、pESC-Ura-OSC20433 K274R 、pESC-Ura-OSC20433 E588D 、pESC-Ura-OSC20433 E654D 、pESC-Ura-OSC20433 K146T 、pESC-Ura-OSC20433 K704R 、pESC-Ura-OSC20433 I533V 、pESC-Ura-OSC20433 F168S .

[0157] Table 7 OSC20433 mutation primers

[0158]

[0159]

[0160] 3.2 Analysis of mutation results

[0161] We transferred the successfully mutated plasmid into the high-yield squalene brewer's yeast strain GQ03 by lithium acetate transformation method for induced expression to verify the function of the mutant. Referring to the method of 2.1.2, the mutant plasmid prepared in 3.1 was transferred into the high-yield squalene chassis strain GQ03 for verification. After induced expression, the yield of damadienol in the bacteria was extracted and detected. The peak area of ​​damadienol of the wild-type control pESC-Ura-OSC20433 was used as the standard to quantitatively analyze the yield of the control and the mutant. The results are shown in Fig.10 As shown, the output of F168S, P564C and C732S decreased seriously, while the output of E86D, K146T, E433D and E654D increased significantly, among which the output of E654D increased most significantly.

[0162] Example 4 Construction of strain AE2003 overexpressing SynOSC20433 mutant E654D

[0163] 4.1 Construction of yeast strain AE2003

[0164] (1) Using plasmid pLB-P PGK1 -SynOSC20433-T ADH1 As template, use the primer SynOSC20433 in Table 5-1 E654D -F and SynOSC20433 E654D -R was used for full plasmid cloning, and the full-length fragment of SynOSC20433 with mutation site E654D was amplified. After transformation, screening, and sequencing verification, the plasmid was extracted to obtain the plasmid pLB-P PGK1 -SynOSC20433 E654D -T ADH1 .

[0165] (2) The plasmid pLB-P obtained in step (1) PGK1 -SynOSC20433 E654D -T ADH1 As template, primer pcfb2798-P with homology arms in Table 8 was used. PGK1 -F and T ADH1 -R2 was cloned and fragment P was amplified PGK1-SynOSC20433 E654D -T ADH1 ; plasmid pUC19-P TDH3 -SynAtSQE2-T TPI1 As template, use primer P with homology arm in Table 8 TDH3 -F2 and T TPI1 -down-R was used for cloning and fragment P was amplified TDH3 -SynAtSQE2-T TPI1 Using plasmid pcfb2798-Leu as template, primers pcfb2798-up-F and pcfb2798-up-P with homology arms in Table 8 were used. PGK1 -R clone the fragment pcfb2798-Up and use the primer pcfb2798-T with homology arms in Table 8 TPI1 -down-F and pcfb2798-down-R were used to clone the Leu-labeled fragment pcfb2798-Down. After PCR amplification, the above four fragments were concentrated to 30 μL after detection, purification and recovery.

[0166] Table 8 Overexpression of SynOSC20433 E654D Gene cloning module primers

[0167]

[0168] (3) The above four fragments pcfb2798-Up, P TDH3 -SynAtSQE2-T TPI1 , P PGK1 -SynOSC20433 E654D -T ADH1 pcfb2798-Down was transformed into strain AE2002 by lithium acetate yeast transformation method, and then plated on solid medium of SD-Trp-Leu and waited for 2-3 days. After a single clone was grown, the positive single clone colony was named strain AE2003.

[0169] 4.2 Shake flask fermentation and detection of yeast strain AE2003

[0170] Cultivate according to the method in 2.1.3, and take samples every 12 hours to test the colony density (OD 600 ), after the expression, the cells were lysed to detect the damadienol production in the cells. The GC-MS test results are as follows Fig.11 As shown, the production of damadienol in strain AE2003 transformed with the SynOSC20433 mutant E654D was increased to 101.85±5.73 mg / L.

[0171] Example 5 Using PHXT1 Construction of strain AE2004 that down-regulates ERG7 gene expression

[0172] 5.1 Construction of yeast strain AE2004

[0173] (1) In order to further increase the yield, the natural promoter of the endogenous gene ERG7 was replaced with a weak promoter P HXT1 Using the genome of the wild-type strain CEN.PK2-1D as a template, the primers in Table 9 were used for cloning to amplify the target fragments ERG7-Up, ERG7-Down and ERG7-P, respectively. HXT1 After amplification, the three cloned fragments are tested by gel electrophoresis. If the correct positive band appears, the kit can be used for column recovery and purification. After recovery, the three fragments can be concentrated to 30 μL.

[0174] Table 9P HXT1 Primers for down-regulating ERG7 gene expression module

[0175]

[0176] The above three fragments ERG7-Up, ERG7-Down and ERG7-P HXT1 and CRISPR / Cas9 plasmid pCRCT-GTR-URA2-△P ERG7 (The preparation method of this vector can refer to Zhang, Y., Wang, J., Wang, Z. et al. A gRNA-tRNA array for CRISPR-Cas9 based rapid multiplexed genome editing in Saccharomyces cerevisiae. Nat Commun 10, 1053 (2019). https: / / doi.org / 10.1038 / s41467-019-09005-3, the gRNA sequence used is gtgggcgacgattattggta) and then transferred into strain AE2003 by lithium acetate yeast transformation method, spread on SD-Trp-Leu-Ura solid medium, and wait for 2-3 days. After a single clone grows out, yeast colony PCR verification is performed, and the positive single clone colony is named strain AE2004.

[0177] 5.2 Shake flask fermentation and detection of yeast strain AE2004

[0178] Cultivate according to the method in 2.1.3, and take samples every 12 hours to test the colony density (OD 600After the expression, the cells were lysed to detect the damadienol production in the cells. The GC-MS test results are shown in Fig.12 As shown, the damadienol production of strain AE2004 was 145.67±8.06 mg / L.

[0179] 5.3 Fermentation of yeast strain AE2004 in 2L fermenter

[0180] Pick the positive monoclonal colony on the plate of strain AE2004 and place it in 3mL of SD-Trp-Leu-Ura defective liquid medium, and culture it overnight in a yeast shaker at 30℃ and 200rpm for 12h; transfer it to 30mL of defective liquid medium in a new 250mL triangular shake flask at a ratio of 5%, and culture it in a yeast shaker at 30℃ and 200rpm for 12h; transfer it to 30mL of defective liquid medium in a new 250mL triangular shake flask at a ratio of 5%, and culture it in a yeast shaker at 30℃ and 200rpm for 12h; transfer it to 100mL of defective liquid medium in a new 500mL triangular shake flask at a ratio of 5%, and culture it in a yeast shaker at 30℃ and 200rpm for 12h to obtain fermentation seed liquid. The seed liquid was inoculated into 800mL of YPD liquid medium in a sterilized 2L fermenter, and the corresponding initial sugar, trace elements and vitamins were added. During the fermentation process, the temperature is maintained at 30°C, and ammonia water is automatically added to maintain the pH at around 5.5. The dissolved oxygen is linked to the rotation speed. The initial rotation speed is 300rpm, so that the dissolved oxygen is maintained at around 40% fluctuations, the air flow rate is 2L / min, and the defoaming is linked to the fermentation tank. When the dissolved oxygen drops from 100% to around 40%, turn on the feed switch and connect it to the dissolved oxygen. When the dissolved oxygen increases sharply and is greater than 55%, feed can be carried out. (Corresponding trace elements and vitamins can be added to the feed sugar) Samples are taken every 24 hours to measure the cell density OD 600 After 7 days of fermentation, the cell weight was measured to be 144 g, and the final dammaradienol production was 1.037 g / L. Fig.13 shown.

[0181] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. An engineered strain of Saccharomyces cerevisiae that produces high levels of damadienol, characterized in that: The yeast Saccharomyces cerevisiae was used as the starting strain, tHMGR, ERG12, IDI, ERG13, ERG10, ERG19, and ERG8 genes were overexpressed, AtSQS2, AtSQE2, SmFPS genes were transferred, and the damadienol synthase gene was transferred.

2. The brewer's yeast engineering bacterium according to claim 1, characterized in that: The overexpression of tHMGR, ERG12, IDI, ERG13, ERG10, ERG19, and ERG8 genes is achieved by integrating the tHMGR, ERG12, IDI, ERG13, ERG10, ERG19, and ERG8 genes into the Gal7 site and the Gal10-Gal1 site of the Saccharomyces cerevisiae chromosome; The transfer of AtSQS2, AtSQE2, and SmFPS genes is to integrate AtSQS2, AtSQE2, and SmFPS genes into the His3 site of the Saccharomyces cerevisiae chromosome; The damadienol synthase gene is a gene of an enzyme that can synthesize damadienol using squalene as a substrate.

3. The engineered yeast of claim 2, characterized in that: The damadienol synthase gene is at least one of OSC20433, SynOSC20433 and a SynOSC20433 mutant; The damadienol synthase gene is introduced by shuttle vector or homologous recombination; The shuttle vector is pESC-Ura; The homologous recombination is to combine the promoter P PGK1 and terminator T ADH1 The damadienol synthase gene expression cassette and the promoter P TDH3 and terminator T TPI1 The SynAtSQE2 gene expression cassette was integrated into the Ty1cons2 site of the Saccharomyces cerevisiae chromosome.

4. The engineered yeast of claim 3, characterized in that: The tHMGR gene is a tHMGR gene expression cassette, further comprising a promoter P PGK1 and terminator T ADH1 ; The ERG12 gene is an ERG12 gene expression cassette, further comprising a promoter P PDC1 and terminator T ADH2 ; The IDI gene is an IDI gene expression cassette, further comprising a promoter P ENO2 and terminator T PDC1 ; The ERG13 gene is an ERG13 gene expression cassette, further comprising a promoter P FBA1 and terminator T TDH2 ; The ERG10 gene is an ERG10 gene expression cassette, further comprising a promoter P TEF1 and terminator T CYC1 ; The ERG19 gene is an ERG19 gene expression cassette, further comprising a promoter P PYK1 and terminator T PGI1 ; The ERG8 gene is an ERG8 gene expression cassette, further comprising a promoter P TDH3 and terminator T TPI1 ; The AtSQS2 gene is an AtSQS2 gene expression cassette, further comprising a promoter P PGK1 and terminator T ADH1 ; The AtSQE2 gene is an AtSQE2 gene expression cassette, further comprising a promoter P TDH3 and terminator T TPI1 ; The SmFPS gene is a SmFPS gene expression cassette, which also contains a promoter P TEF1 and terminator T CYC1 .

5. The engineered yeast of claim 1, characterized in that: The high-yield damadienol-producing Saccharomyces cerevisiae engineered strain also replaces the natural promoter of the endogenous gene ERG7 with a weak promoter P HXT1 ; The natural promoter of the endogenous gene ERG7 is replaced by the weak promoter P HXT1 This is achieved through CRISPR / Cas9 gene editing technology.

6. A method for constructing an engineered strain of Saccharomyces cerevisiae that produces high levels of damadienol, characterized in that The steps include: (1) Amplify Gal7-Up, Loxp-Ura-loxp, P containing homologous fragments PGK1 -tHMGR-T ADH1 , P PDC1 -ERG12-T ADH2 , P ENO2 -IDI-T PDC1 , P FBA1 -ERG13-T TDH2 , P TEF1 -ERG10-T CYC1 , P PYK1 -ERG19-T PGI1 , P TDH3 -ERG8-T TPI1 , Gal7-Down, and transformed into Saccharomyces cerevisiae, and strain GQ01 was obtained by screening; (2) Amplify Gal10-Up, Loxp-Ura-loxp, P containing homologous fragments PGK1 -tHMGR-T ADH1 , P PDC1 -ERG12-T ADH2 , P ENO2 -IDI-T PDC1 , P FBA1 -ERG13-T TDH2 , P TEF1 -ERG10-T CYC1 , P PYK1 -ERG19-T PGI1 , P TDH3 -ERG8-T TPI1 , Gal1-Down, and transferred into strain GQ01 together, and strain GQ02 was obtained by screening; (3) Amplification of His3-Up, Loxp-Ura-loxp, P containing homologous fragments PGK1 -AtSQS2-T ADH1 , P TDH3 -AtSQE2-T TPI1 , P TEF1 -SmFPS-T CYC1 , His3-Down, and were transferred into strain GQ02 together, and strain GQ03 was obtained by screening; (4) amplifying the damadienol synthase gene, connecting it to the vector backbone obtained by digesting the vector plasmid pESC-Ura with restriction enzymes BamHI and XohI, and transferring it into strain GQ03 to screen for an engineered Saccharomyces cerevisiae strain with high damadienol production; Alternatively, amplify pcfb2988-Up, P TDH3 -SynAtSQE2-T TPI1 , damadienol synthase gene, and pcfb2988-Down were transferred into strain GQ03 to screen out an engineered Saccharomyces cerevisiae strain with high damadienol production.

7. The construction method according to claim 6, characterized in that: The damadienol synthase gene is a gene of an enzyme that can synthesize damadienol using squalene as a substrate; preferably at least one of OSC20433, SynOSC20433 and a mutant of SynOSC20433; The Gal7-Up and Gal7-Down are fragments located at the Gal7 site of the Saccharomyces cerevisiae genome, wherein the nucleotide sequence of Gal7-Up is shown in SEQ ID NO.3, and the nucleotide sequence of Gal7-Down is shown in SEQ ID NO.4; The Gal10-Up and Gal1-Down are fragments located at the Gal10-Gal1 site of the Saccharomyces cerevisiae genome, wherein the nucleotide sequence of Gal10-Up is shown in SEQ ID NO.5, and the nucleotide sequence of Gal1-Down is shown in SEQ ID NO.6; The His3-Up and His3-Down are fragments located at the His3 site of the Saccharomyces cerevisiae genome, wherein the nucleotide sequence of His3-Up is shown in SEQ ID NO.7, and the nucleotide sequence of His3-Down is shown in SEQ ID NO.8; The pcfb2988-Up is an upstream fragment located at the Ty1cons2 site of the Saccharomyces cerevisiae genome, and the pcfb2988-Down is a downstream fragment carrying the selection marker gene Trp and located at the Ty1cons2 site of the Saccharomyces cerevisiae genome, wherein the nucleotide sequence of pcfb2988-Up is shown in SEQ ID NO.9, and the nucleotide sequence of pcfb2988-Down is shown in SEQ ID NO.10; The Loxp-Ura-loxp is a fragment containing the selection marker gene Ura; The P PGK1 -tHMGR-T ADH1 is a tHMGR gene expression cassette, further comprising a promoter P PGK1 and terminator T ADH1 ; The P PDC1 -ERG12-T ADH2 is an ERG12 gene expression cassette, further comprising a promoter P PDC1 and terminator T ADH2 ; The P ENO2 -IDI-T PDC1 is an IDI gene expression cassette, which also contains a promoter P ENO2 and terminator T PDC1 ; The P FBA1 -ERG13-T TDH2 is an ERG13 gene expression cassette, further comprising a promoter P FBA1 and terminator T TDH2 ; The P TEF1 -ERG10-T CYC1 is an ERG10 gene expression cassette, further comprising a promoter P TEF1 and terminator T CYC1 ; The P PYK1 -ERG19-T PGI1 is an ERG19 gene expression cassette, further comprising a promoter P PYK1 and terminator T PGI1 ; The P TDH3 -ERG8-T TPI1 is an ERG8 gene expression cassette, further comprising a promoter P TDH3 and terminator T TPI1 ; The P PGK1 -AtSQS2-T ADH1 is an AtSQS2 gene expression cassette, further comprising a promoter P PGK1 and terminator T ADH1 ; The P TDH3 -AtSQE2-T TPI1 is an AtSQE2 gene expression cassette, further comprising a promoter P TDH3 and terminator T TPI1 ; The P TEF1 -SmFPS-T CYC1 is a SmFPS gene expression cassette, further comprising a promoter P TEF1 and terminator T CYC1 ; The P TDH3 -SynAtSQE2-T TPI1 is a SynAtSQE2 gene expression cassette, further comprising a promoter P TDH3 and terminator T TPI1 .

8. The engineered yeast of any one of claims 3 to 4 or the construction method of claim 7, characterized in that: The nucleotide sequence of OSC20433 is shown in SEQ ID NO.1; The nucleotide sequence of SynOSC20433 is shown in SEQ ID NO.2; The mutant of SynOSC20433 is a nucleotide sequence obtained by mutation based on the nucleotide sequence shown in SEQ ID NO.4, and is one of the following: positions 7 to 9 are mutated to AGG, positions 256 to 258 are mutated to GAC, positions 271 to 273 are mutated to ACT, positions 436 to 438 are mutated to ACA, positions 502 to 504 are mutated to TCT, positions 820 to 822 are mutated to AGA, positions 862 to 864 are mutated to GAA, positions 1045 to 1047 are mutated to AGA, positions 1297 to 1299 are mutated to GAT, and positions 1318 to 1320 are mutated to AGA , positions 1528-1530 mutated to ACT, positions 1597-1599 mutated to GTG, positions 1630-1632 mutated to GAG, positions 1690-1692 mutated to TGC, positions 1762-1764 mutated to GAT, positions 1960-1962 mutated to GAT, positions 2110-2112 mutated to AGA, positions 2185-2187 mutated to TGC, positions 2194-2196 mutated to TCT, positions 2206-2208 mutated to TAT, and positions 2212-2214 mutated to ACA.

9. The engineered yeast of claim 4 or the construction method of claim 7, characterized in that: The nucleotide sequence of the tHMGR gene is shown in the NCBI database sequence accession number NM_001182434.1; The nucleotide sequence of the ERG12 gene is shown in the NCBI database sequence accession number NM_001182715.1; The nucleotide sequence of the IDI gene is shown in the NCBI database sequence accession number NM_001183931.1; The nucleotide sequence of the ERG13 gene is shown in the NCBI database sequence accession number NM_001182489.1; The nucleotide sequence of the ERG10 gene is shown in the NCBI database sequence accession number NM_001183842.1; The nucleotide sequence of the ERG19 gene is shown in the NCBI database sequence accession number NM_001183220.1; The nucleotide sequence of the ERG8 gene is shown in the NCBI database sequence accession number NM_001182727.1; The nucleotide sequence of the AtSQS2 gene is shown in the NCBI database sequence accession number NM_119631.3; The nucleotide sequence of the AtSQE2 gene is shown in the NCBI database sequence accession number NM_127848.4; The nucleotide sequence of the SmFPS gene is shown in the NCBI database sequence accession number HQ687768.1; The nucleotide sequence of the SynAtSQE2 gene is shown in SEQ ID NO.11; The promoter P PGK1 The nucleotide sequence is shown in NCBI database sequence accession number CP135951.1 from position 124102 to position 124853; The promoter P PDC1 The nucleotide sequence is shown in NCBI database sequence accession number CP135955.1 from position 216126 to position 216925; The promoter P ENO2 The nucleotide sequence is shown in NCBI database sequence accession number CP029160.1 from position 10603930 to position 10604929; The promoter P FBA1 The nucleotide sequence is shown in NCBI database sequence accession number CP029160.1 from position 5910688 to position 5911509; The promoter P TEF1 The nucleotide sequence is shown in NCBI database sequence accession number CP029160.1 from position 707052 to position 707481; The promoter P PYK1 The nucleotide sequence is shown in NCBI database sequence accession number CP029160.1 from position 6308912 to position 6309911; The promoter P TDH3 The nucleotide sequence is shown in NCBI database sequence accession number CP029160.1 from position 9954286 to position 9955085; The promoter P HXT1 The nucleotide sequence is shown in NCBI database sequence accession number CP036477.1 from position 292634 to position 293756; The terminator T ADH1 The nucleotide sequence is shown in NCBI database sequence accession number CP029160.1 from position 4671969 to position 4672126; The terminator T ADH2 The nucleotide sequence is shown in NCBI database sequence accession number CP029160.1 from position 3398555 to position 3398954; The terminator T PDC1 The nucleotide sequence is shown in NCBI database sequence accession number CP029160.1 from position 3660519 to position 3660915; The terminator T TDH2 The nucleotide sequence is shown in NCBI database sequence accession number CP029160.1 from position 11545244 to position 11545644; The terminator T CYC1 The nucleotide sequence is shown in NCBI database sequence accession number KC879308.1 from position 1301 to 1607; The terminator T PGI1 The nucleotide sequence is shown in NCBI database sequence accession number CP029160.1 from position 8108691 to position 8109092; The terminator T TPI1 The nucleotide sequence is shown in the NCBI database sequence accession number CP134412.1 from position 529841 to position 530242.

10. A method for producing damadienol, characterized in that The steps include: (1) inoculating an engineered strain of Saccharomyces cerevisiae that produces high levels of damadienol into a culture medium for culturing; (2) the culture fluid after the culture is cracked and extracted to obtain damadienol; The culturing in step (1) is culturing in a deficient SD-Trp liquid medium at 28-32° C. for 2-3 days; The extraction described in step (2) is to use an organic solvent to extract after lysing the bacteria.

Images