GRNA for STRA8 gene knockout and method for preparing embryonic stem cells by using gRNA

Abstract

The invention provides gRNA for STRA8 gene knockout and a method for preparing embryonic stem cells by adopting the gRNA. Wherein the nucleotide sequence of the gRNA is as shown in SEQ ID NO: 1. The preparation method of the human embryonic stem cell comprises the following steps: knocking out a cytosine base at the 131 site of a No.1 exon of the STRA8 gene of the human embryonic stem cell. The human embryonic stem cell prepared by the invention has the capability of blocking gametes but not influencing organ differentiation and development, so that ethical impact possibly caused by heterogeneous organ reconstruction is eliminated by utilizing a biotechnological means, and a new tool and thought are provided for researching an initial action mechanism of meiosis participated by the STRA8 gene.

Description

Technical Field

[0001] The present invention belongs to the field of gene engineering technology, and specifically relates to a gRNA for STRA8 gene knockout and a method for preparing embryonic stem cells using the gRNA. The present invention also relates to a recombinant plasmid for STRA8 gene knockout and a method for preparing embryonic stem cells using the gRNA. Background Art

[0002] On the one hand, the development of xenogeneic organ regeneration technology has provided a new idea for solving the problem of organ shortage. Xenogeneic organ regeneration research based on stem cells has found that human stem cells have chimerism in the animal reproductive system, which will bring serious ethical issues. The human embryonic stem cell line that screens gamete blockage but does not affect the ability of organ differentiation and development is expected to eliminate the ethical impact caused by xenogeneic organ regeneration.

[0003] On the other hand, with the development of society and changes in lifestyle, reproductive health issues have gradually become the focus of global attention. Infertility problems caused by germ cell differentiation disorders affect millions of families. At present, there are limited methods for treating germ cell differentiation disorders, and traditional assisted reproductive technologies (such as IVF) cannot solve all problems, especially for some cases that cannot be solved by existing technologies. Human embryonic stem cells have the ability to differentiate into multiple cell types, including germ cells, providing new possibilities for the treatment of germ cell differentiation disorders. In recent years, stem cell differentiation technology has made significant progress, especially in inducing stem cells to differentiate into germ cells, providing a technical basis for the development of new treatments. The in-depth basic research provides a knowledge reserve for understanding the molecular mechanism of germ cell differentiation and promotes the development of related treatment methods.

[0004] Today's society has an urgent need to resolve ethical issues in xenotransplantation and improve reproductive health. Policy support from many countries and regions has also provided a good development environment for stem cell research.

[0005] Genome editing refers to the technology of modifying and changing the genome at a specific point. Its essence is to cut DNA through sequence-specific nucleases to cause DNA double-strand breaks (DSBs), and then induce DNA damage repair, thereby causing base changes, deletions, insertions and substitutions. Currently established gene editing technologies include zinc finger nucleases (ZFN), transcription activator like effector nucleases (TALEN) and CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) / Cas9 systems. Among them, the emergence of CRISPR / Cas9 technology has greatly improved the efficiency of gene targeting. It has been applied in many species and was rated as one of the top ten scientific advances of the year by Science. Since then, gene editing has entered a golden period of rapid development. Various gene-targeted animals produced using CRISPR / Cas9 technology provide important animal disease models for studying gene functions, explaining the genetic evolution of organisms, analyzing the molecular mechanisms of human disease, and screening and evaluating therapeutic drugs, making great contributions to the fields of life sciences and biomedical research.

[0006] The STRA8 gene is a marker gene for spermatogonia differentiation and meiosis initiation, and is expressed by germ cells in response to retinoic acid. Studies have found that mice with STRA8 knockout cannot produce mature gametes, but their growth and development are not affected, which makes the STRA8 gene a promising important gene target for eliminating ethical shocks.

[0007] However, the mechanism of action of the STRA8 gene has only been studied in detail in mice. In large animals such as Meishan pigs and Bama pigs, it has only been found that the STRA8 gene may act as a transcription factor to initiate meiosis in adult pigs, and most of the research remains in the in vitro experimental stage, and there are no in-depth research reports. In addition, there are currently no reports on human stem cells with STRA8 gene knockout and in vivo chimera experiments. Summary of the invention

[0008] Based on the above research status, the main purpose of the present invention is to provide a method for preparing human embryonic stem cells. The prepared human embryonic stem cells contain a mutated STRA8 gene, which has the ability to cause gamete blockage without affecting organ differentiation and development, thereby eliminating the ethical impact that may be caused by xenogeneic organ reconstruction by biotechnology means.

[0009] The objective of the present invention is achieved through the following technical solutions:

[0010] In a first aspect, the present invention provides a gRNA for STRA8 gene knockout, the nucleotide sequence of which is shown in SEQ ID NO: 1.

[0011] SEQ ID NO: 1: gttgttgaagagtgctgccaggg.

[0012] According to the present invention, the gRNA shown in SEQ ID NO: 1 can cause the deletion of the cytosine (C) base at position 131 of the first exon of the STRA8 gene, resulting in premature termination of protein translation.

[0013] In a second aspect, the present invention provides a Cas9-gRNA expression vector for STRA8 gene knockout, which comprises the gRNA according to the first aspect of the present invention; preferably, the Cas9 is Streptococcus pyogenes Cas9.

[0014] In a third aspect, the present invention provides a mutant human STRA8 gene, wherein the C base at position 131 of exon 1 of the mutant human STRA8 gene is knocked out.

[0015] Preferably, the nucleotide sequence of the mutated human STRA8 gene is as shown in SEQ ID NO: 2.

[0016] SEQ ID NO: 2:

[0017]

[0018] In a fourth aspect, the present invention further provides a method for preparing human embryonic stem cells, the method comprising the following steps:

[0019] The C base at position 131 of exon 1 of the STRA8 gene of human embryonic stem cells was knocked out.

[0020] Preferably, the preparation method comprises:

[0021] The C base at position 131 of exon 1 of the STRA8 gene of human embryonic stem cells is knocked out using the gRNA according to the first aspect of the present invention or the Cas9-gRNA expression vector according to the second aspect of the present invention.

[0022] Preferably, the nucleotide sequence of the knocked-out STRA8 gene is as shown in SEQ ID NO: 2.

[0023] According to the present invention, the prepared human embryonic stem cells can be used for pluripotency induction or genetic enhancement, and the human embryonic stem cells can also be used in heterologous chimera experiments to observe their differentiation in chimeras.

[0024] Preferably, the preparation method further comprises the following steps:

[0025] The DNA of the prepared human embryonic stem cells was extracted and sequenced to determine whether there was a C base deletion mutation at position 131 of exon 1 of the STRA8 gene.

[0026] In some embodiments of the present invention, the sequencing comprises the following steps:

[0027] Using DNA as a template, PCR was performed using specific primers of the STRA8 gene to obtain an amplified product, and the amplified product was sequenced; wherein the nucleotide sequence of the forward primer of the specific primer is shown in SEQ ID NO: 3, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO: 4.

[0028] SEQ ID NO: 3:

[0029] Gaggggcattcttgaggtag.

[0030] SEQ ID NO: 4:

[0031] Tgggcttgttcgtagggtg.

[0032] In a fifth aspect, the present invention further provides a method for preparing a heterologous chimera, which comprises chimerizing human embryonic stem cells prepared by the preparation method according to the fourth aspect of the present invention with a heterologous animal embryo.

[0033] According to some embodiments of the present invention, before using the human embryonic stem cells prepared by the fourth aspect of the present invention to construct a heterologous chimera, the human embryonic stem cells can be transformed to enhance their chimerism ability with heterologous embryos so as to eliminate their ability to differentiate into germ cells in heterologous chimeric embryos.

[0034] The human embryonic stem cells prepared according to the present invention can be applied to xenogeneic organ transplantation, xenogeneic organ reconstruction or the mechanism research of the STRA8 gene participating in the initiation of meiosis.

[0035] The human embryonic stem cell line with STRA8 gene knockout obtained by the present invention using CRISPR / Cas9 system has the ability to block gametogenesis but does not affect organ differentiation and development, thereby eliminating the ethical impact that may be caused by xenogeneic organ reconstruction by biotechnology. In addition, the preparation method of the human embryonic stem cell line provided by the present invention also provides new tools and ideas for studying the mechanism of the STRA8 gene's involvement in the initiation of meiosis, and lays a foundation for exploring the biological function of the STRA8 gene in stem cell differentiation. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] The embodiments of the present invention are described in detail below with reference to the accompanying drawings, wherein:

[0037] Figure 1 The plasmid map of the PX458 plasmid used in Example 1 of the present invention;

[0038] Figure 2 This is an agarose gel electrophoresis diagram of human embryonic stem cells that have been gene-edited with STRA8 identified in Example 3 of the present invention; wherein, M represents DNA Marker (Jinple, G06Q5000), WT represents human embryonic stem cells that have not been gene-edited, and “#42”, “#43” and “#116” are the 42nd, 43rd and 116th monoclonal human embryonic stem cell lines obtained by screening, respectively;

[0039] Figure 3 This is a Sanger sequencing diagram of human embryonic stem cells that have been edited with the STRA8 gene identified in Example 3 of the present invention;

[0040] Figure 4 This is a graph for detecting the pluripotency of human embryonic stem cells edited with STRA8 in Example 4 of the present invention; wherein AP is alkaline phosphatase staining, SSEA4, SOX2, OCT4, and NANOG are all pluripotency genes, and DAPI is a cell nucleus marker;

[0041] Figure 5 This is a diagram showing the immunofluorescence results of identifying transformed human embryonic stem cells in Example 5 of the present invention;

[0042] Figure 6 This is a result diagram of the chimerism rate and chimerism efficiency of human embryonic stem cells after transformation identified in Example 5 of the present invention; wherein, HNA is a human nucleus-specific gene, SOX2 is an inner cell mass-specific gene, GATA3 is a trophoblast cell-specific gene, DAPI is a cell nucleus marker, hcell is a human cell, and pcell is a porcine cell. DETAILED DESCRIPTION

[0043] The present invention is described in further detail below in conjunction with specific embodiments, and the present invention can be better understood according to the following examples. However, it should be readily understood by those skilled in the art that the following examples are merely illustrative and are not intended to limit the present invention to these specific embodiments. It should be appreciated by those skilled in the art that the present invention will encompass all improvements, alternatives and equivalents included within the scope of the claims.

[0044] Example 1 Construction of a recombinant plasmid for STRA8 gene knockout

[0045] A restriction site (BbsI enzyme) was introduced at the 5' end of the gRNA sequence (see Table 1 below), and the single-stranded forward and reverse sequences were synthesized at Sangon Biotech Co., Ltd. The forward and reverse sequences were annealed to synthesize double-stranded oligonucleotide sequences, which were then combined with the linear PX458 plasmid (from Addgene, model 48138, as Figure 1 The ligation product was added to 50 μl DH5α E. coli competent cells (Takara, 9057) for transformation, plating, picking, and shaking. PCR identification was performed using the U6 promoter universal primer, and the positive colonies were sequenced and analyzed at Sangon Biotech Co., Ltd. The correctly connected sgRNA-PX458 plasmid was expanded and cultured, and the plasmid was extracted using a large extraction plasmid kit (TIANGEN, model DP117).

[0046] Table 1 gRNA sequences

[0047] name Sequence 5'-3' serial number STRA8-gRNA gttgttgaagagtgctgccaggg SEQ ID NO: 1

[0048] Example 2 Construction of human embryonic stem cells containing a mutated STRA8 gene

[0049] Cell culture and transfection: Human embryonic stem cells (hESC) were maintained in TeSR-E8 (STEMCELL, 05990) medium at 37°C and 5% CO2. 4 μg of the recombinant plasmid for gRNA targeting obtained in Example 1 was mixed with electroporation solution (Lonza) to prepare a mixed electroporation solution. hESC in the logarithmic growth phase (cell density of 70%-80%) was used for transfection. The cells were digested into single cells using Acuutase and centrifuged at 1200 rpm for 3 min in a centrifuge. After the centrifugation, the supernatant was removed using a suction pump, and 100 μL of the electroporation solution was used to resuspend 5×10 5 Cells were transferred to an electroporation cup. Transfection was performed using the A-023 program of the Nuclear Electroporator (Lonza). The transfected cell suspension was transferred to a 12-well plate and cultured in TeSR-E8 medium supplemented with 10 μM Y27632 (Selleck, S1049) for 24 h before being replaced with normal TeSR-E8 medium.

[0050] Fluorescence activated cell sorting (FACS): 72 hours after transfection, GFP-positive cells were enriched by flow cytometry (BD). Positive cells were diluted at a density of 200 cells / ml and seeded in a 6-well plate with pre-coated Matrigel. After culturing in TeSR-E8 medium supplemented with 10 μM Y27632 (Selleck, S1049) for 24 hours, the medium was changed to normal TeSR-E8 medium.

[0051] Example 3 Identification of human embryonic stem cells containing a mutated STRA8 gene

[0052] 1. Amplification

[0053] After the GFP-positive cells obtained in Example 2 were expanded, part of the cells were collected and placed in a centrifuge for centrifugation at 1200 rpm for 3 min, and the supernatant was removed. DNA was extracted using a micro-sample genomic DNA extraction kit (TIANGEN, model DP316). After the extraction was completed, the DNA concentration was measured using a nucleic acid analyzer, and then a high-fidelity enzyme (VAZYME, P520) was used for PCR amplification (specific primer sequences are shown in Table 2, and the amplification system is shown in Table 3). After the amplification was completed, it was sent to the company (Tsingke) for second-generation sequencing.

[0054] Table 2 Primer sequences for STRA8 gene amplification

[0055] Primer name Sequence 5'-3' serial number STRA8-F gagggggcattcttgaggtag SEQ ID NO: 3 STRA8-R tgggcttgttcgtagggtg SEQ ID NO: 4

[0056] Table 3 PCR amplification system

[0057] Ingredient name Dosage / μL 2×Taq Mix 12.5 Sterilized water 9.5 Upstream primer (10 μM) 1 Downstream primer (10 μM) 1 Genomic DNA (100 ng / μL) 1 Total volume 25

[0058] The PCR products were pre-denatured at 94°C for 3 min, followed by 30 cycles of denaturation at 94°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 1 min. Finally, the PCR products were incubated at 72°C for 10 min. The PCR products were electrophoresed on 1.5% agarose gel electrophoresis (e.g. Figure 2 The primer dimers were removed using a PCR product purification kit and the next step of sequencing was performed.

[0059] 2. Sequencing

[0060] The PCR products were sequenced using the Sanger method ( Figure 3 The sequencing results showed that the sequence of the PCR product was consistent with the mutant sequence.

[0061] Example 4 Detection of pluripotency of human embryonic stem cells containing mutated STRA8 gene

[0062] The obtained STRA8 gene knockout human embryonic stem cell line was expanded and cultured, and its pluripotency-related genes were immunofluorescently stained to determine whether the STRA8 gene knockout human embryonic stem cell line was still pluripotent. The results are as follows Figure 4 As shown. Figure 4 It can be seen that human embryonic stem cells with STRA8 gene knockout have alkaline phosphatase activity and express pluripotency genes such as SSEA4, SOX2, OCT4, and NANOG, indicating that human embryonic stem cells with STRA8 gene knockout are still pluripotent, that is, the knockout of STRA8 gene does not affect the pluripotency of human embryonic stem cells.

[0063] Example 5 Heterogeneous chimerism experiment of human embryonic stem cells containing mutated STRA8 gene

[0064] The human embryonic stem cells were transformed and induced and cultured using RSeT feeder-free medium (STEMCELL, 05975) according to the instructions. After three consecutive generations, a stable Naïve cell line, nWIBR3, was obtained. Its specific genes were detected by immunofluorescence experiment to determine whether it expressed the Naïve-specific genes KLF2 and KLF4. The results are as follows: Figure 5 As shown. Figure 5 It can be seen that Naïve cells express KLF2 and KLF4 genes, indicating that the induced human embryonic stem cells have the characteristics of Naïve cells.

[0065] Studies have shown that human embryonic stem cells have primed pluripotency and do not have the ability to form heterologous chimeras, that is, they cannot proliferate and differentiate in heterologous chimeric embryos. In comparison, induced naïve cells have the ability to form heterologous chimeras and can proliferate and differentiate in heterologous chimeric embryos. Primed cells refer to cells that have not been induced to become naive. Ordinary human embryonic stem cells are primed cells. At the condition of 5-7 cells / embryo, Primed stem cells (WIBR3) and Naïve stem cells (nWIBR3) were injected into pig parthenogenetic embryos that had developed in vitro for 4 days, and the chimerism rate and chimerism efficiency of human embryonic stem cells in pig embryos were detected during the blastocyst period. The comparison results are as follows: Figure 6 As shown by Figure 6 It can be seen that compared with primed cells, the chimerism rate of Naïve human embryonic stem cells in pig embryos is 100%, that is, human cells exist in all chimeric embryos; in addition, the number of Naïve cells in pig embryos also increased significantly, from 5-7 at the beginning of injection to about 22; the chimerism efficiency of Naïve cells, that is, the proportion of human cells in all cells in pig embryos, also increased significantly to about 31.4%.

[0066] In summary, the above transformation experiments show that the chimerism ability of the human stem cells prepared by the present invention with heterologous embryos is enhanced, and the ability of the human stem cells to differentiate into germ cells in heterologous chimeric embryos is eliminated.

[0067] Although various aspects and embodiments of the present invention are disclosed herein, other aspects and embodiments will be apparent to those skilled in the art. The various aspects and embodiments disclosed herein are for illustrative purposes only and not for limiting purposes. The scope and spirit of the present invention are determined solely by the appended claims.

Claims

1. A gRNA for STRA8 gene knockout, the nucleotide sequence of which is shown in SEQ ID NO:

1.

2. A Cas9-gRNA expression vector for STRA8 gene knockout, comprising the gRNA according to claim 1; preferably, the Cas9 is Streptococcus pyogenes Cas9.

3. A mutant human STRA8 gene, wherein the cytosine base at position 131 of exon 1 is knocked out; Preferably, the nucleotide sequence of the mutated human STRA8 gene is as shown in SEQ ID NO:

2.

4. A method for preparing human embryonic stem cells, the method comprising the following steps: The cytosine base at position 131 in exon 1 of the STRA8 gene of human embryonic stem cells was knocked out.

5. The preparation method according to claim 4, comprising: Using the gRNA according to claim 1 or the Cas9-gRNA expression vector according to claim 2 to knock out the cytosine base at position 131 of exon 1 of the STRA8 gene of human embryonic stem cells; Preferably, the nucleotide sequence of the knocked-out STRA8 gene is as shown in SEQ ID NO:

2.

6. The preparation method according to claim 4 or 5, further comprising the following steps: DNA of the prepared human embryonic stem cells was extracted and sequenced to determine whether there was a cytosine base deletion mutation at position 131 of exon 1 of the STRA8 gene.

7. The method according to claim 6, wherein the sequencing comprises the following steps: Using DNA as a template, PCR was performed using specific primers of the STRA8 gene to obtain an amplified product, and the amplified product was sequenced; wherein, The nucleotide sequence of the forward primer of the specific primer is shown in SEQ ID NO: 3, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO:

4.

8. A method for preparing a heterologous chimera, comprising chimerizing human embryonic stem cells prepared by the method according to any one of claims 4 to 7 with a heterologous animal embryo.

Images