Male sterility mouse model constructed by mutated NAMPT protein and construction method of male sterility mouse model

Abstract

The invention relates to a male sterility mouse model constructed by mutating NAMPT protein and a construction method of the male sterility mouse model, and discloses a method for constructing asthenospermia by mutating NAMPT protein 39-site cysteine (Cys) into serine (Ser) (NAMPT C39S) so as to cause the male sterility mouse model. The invention solves the technical problem that the research on asthenospermia and mouse sterility is influenced by poor drug induction stability, low time efficiency, simultaneous change of other reproductive phenotypes or physiological functions caused by disturbance of some genes and the like. The animal model disclosed by the invention is possibly failed in fertilization through IVF (in-vitro fertilization) as compared with infertility caused by sperm motility reduction clinically, but the result of successful fertilization through ICSI is consistent, so that the usability of the model is improved, a reliable asthenospermia and infertility mouse model is provided for reproductive medicine research scholars, and the clinical application prospect is broad. A new thought is provided for clinically exploring the action mechanism and the drug target of the mouse sterility.

Description

Technical Field

[0001] The present invention relates to the technical field of animal model construction, and in particular to a male infertility mouse model constructed by mutating NAMPT protein and a construction method thereof. Background Art

[0002] Infertility has become a major problem worldwide, affecting about 12% of couples of childbearing age. Male factors account for about 50% of infertility factors. In male infertility, the most common cause is spermatogenesis and dysfunction. According to the standards of the "WHO Human Semen Examination and Processing Laboratory Manual Fifth Edition", total sperm motility below 40% or forward motility below 32% is called asthenozoospermia (AZS). AZS and asthenozoospermia are important factors causing male fertility disorders.

[0003] The asthenozoospermia mouse model is one of the models for studying mouse infertility. At present, the asthenozoospermia model, especially the male mouse infertility model, mainly includes drug-induced methods, including D-galactose, cottonphenol, estradiol, cyclophosphamide induction, etc. However, the asthenozoospermia model established by D-galactose can lead to various organ aging symptoms in mice, including mouse testicles; cottonphenol-induced asthenozoospermia can not only lead to reduced sperm motility, but also lead to sperm deformity and increased sperm death; the method of constructing an azoospermia model by subcutaneous injection of estradiol is slow to implement and the model is unstable; the oligoasthenozoospermia model constructed by cyclophosphamide will also interfere with other physiological functions of mice; in addition, genetic methods including gene mutation, gene knockout, gene knockin, etc. may also lead to phenotypic changes including but not limited to reduced sperm motility, such as knockout of Prrc2a can lead to reduced testicular volume and spermatogenesis disorders; the inactivated gene produced by removing the Kif18a gene from the genome or inserting an exogenous gene into the Kif18a gene can lead to atrophy of the seminiferous tubules and loss of spermatogenic cells in the mouse testis. Therefore, none of these current methods can provide an ideal mouse infertility model caused by asthenozoospermia, which brings a lot of inconvenience and trouble to the study of male infertility caused by decreased sperm motility.

[0004] In view of this, the purpose of the present invention is to provide a stable and easily repeatable animal model with no obvious abnormalities in organ development and physiological functions except for the infertility phenotype, so as to provide a reliable research tool for clinical exploration of the mechanism of action and drug targets of male infertility. Summary of the invention

[0005] In view of the shortcomings of the prior art, the purpose of the present invention is to provide a male infertility mouse model constructed by mutating NAMPT protein and a construction method thereof.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions: A first aspect of the present invention provides a gRNA for specifically targeting the NAMPT gene through the CRISPR-Cas9 system, wherein the sequence of the gRNA is: UGAAAGUUACGGCACUUU.

[0007] Furthermore, the guide RNA (gRNA), also known as single guide RNA (sgRNA), is a small non-coding RNA that can pair with pre-mRNA and insert some uracil (U) into it to produce mRNA with function. The RNA molecule edited by the guide RNA is about 60 to 80 nucleotides in length, transcribed from a single gene, with a 3' oligo U tail, a sequence in the middle that is precisely complementary to the edited mRNA, and an anchor sequence at the 5' end that is complementary to the non-edited mRNA sequence.

[0008] The second aspect of the present invention provides a CRISPR-Cas9 gene targeting system for constructing a cell or animal model of NAMPT gene mutation, wherein the CRISPR-Cas9 gene targeting system comprises the gRNA specifically targeting the NAMPT gene described in the first aspect of the present invention, Cas9 mRNA, and a donor DNA sequence containing a NAMPT mutation site.

[0009] Furthermore, the cells include eukaryotic cells and prokaryotic cells.

[0010] Furthermore, the NAMPT gene mutation is a gene mutation that causes the 39th amino acid of the NAMPT protein to mutate from cysteine ​​to serine.

[0011] Furthermore, the target sequence of the gRNA specifically targeting the NAMPT gene is TTTCACGGCATTCAAAGTAGG, which includes the PAM sequence at the end.

[0012] Furthermore, the PAM sequence is AGG.

[0013] Further, the donor DNA sequence containing the NAMPT mutation site is TAGGTTACTCACTATAAACAATACCCACCCAACACAAGCAAAGTTTATTCCTACTTTGAATGCCGTGAAAAGAAGACAGAAAACTCCAAAGTAAGG.

[0014] The third aspect of the present invention provides the use of the gRNA specifically targeting the NAMPT gene described in the first aspect of the present invention and / or the CRISPR-Cas9 gene targeting system described in the second aspect of the present invention in preparing a cell / animal model of NAMPT gene mutation or a male infertility animal model.

[0015] The fourth aspect of the present invention provides a method for constructing a male infertility animal model, wherein the animal model expresses a homozygous point mutant protein of the NAMPT gene, wherein the homozygous point mutant protein has a mutation of the 39th amino acid from cysteine ​​to serine.

[0016] The fifth aspect of the present invention provides a method for constructing a male infertility animal model, the method comprising using the gRNA specifically targeting the NAMPT gene described in the first aspect of the present invention and / or the CRISPR / Cas9 gene targeting system described in the second aspect of the present invention.

[0017] Furthermore, the method comprises: microinjecting the CRISPR / Cas9 gene targeting system described in the second aspect of the present invention to obtain mutant DNA, transferring the fertilized eggs containing the mutant DNA into female animals, performing genotyping on the newborn animals, and obtaining the F0 generation of chimeric animals.

[0018] Further, the mutant DNA sequence is TAGGTTACTCACTATAAACAATACCCACCAAATACAAGCAAAGTTTATTCATATTTTGAATCCCGTGAAAAGAAGACAGAAAACTCCAAAGTAAGG.

[0019] Furthermore, the steps also include: hybridizing the chimera animal F0 generation with the wild-type animal to obtain the heterozygous animal F1 generation, backcrossing the F1 generation with the wild-type animal to obtain the heterozygous animal F2 generation, and selfing the F2 generation to obtain the homozygous animal F3 generation, i.e., the male sterile animal model.

[0020] In some embodiments, the animal model is a rodent, rabbit, pig, cattle (e.g., cows, bulls, buffalo), deer, sheep, goats, chickens, cats, dogs, ferrets, primates (e.g., marmosets, macaques); preferably, a rodent (e.g., mice, rats, and the like); particularly preferably, a mouse.

[0021] Furthermore, the animals include mice, rats, guinea pigs, hamsters, rabbits, dogs, pigs, and monkeys.

[0022] Furthermore, the animal is a mouse.

[0023] The sixth aspect of the present invention provides an application of the method of the fourth aspect of the present invention or the fifth aspect of the present invention to obtain an animal model, wherein the application comprises any one of the following: 1) Application in constructing disease models related to male sterility.

[0024] 2) Application in the study of the pathogenesis of male infertility-related diseases.

[0025] 3) Application in screening candidate drugs for male infertility-related diseases.

[0026] Furthermore, the candidate drugs include protein analogs, antibodies, DNA, RNA, and small molecule compounds.

[0027] Furthermore, the source of the small molecule compound is selected from: newly synthesized or existing databases; wherein the existing databases include but are not limited to general natural product databases (COCONUT, Super Natural II, NPASS), plant natural product databases (KNApSaCK, CMAUP, TriForC, Alkamid, NPACT DB, BioPhytMol), Chinese medicine natural product databases (TCM@Taiwan, CEMTDD, CHDD, ETCM, TM-MC, TCMID, YaTCM), microbial natural product databases (StreptomeDB, NP Altas, ProCarDB, PAMDB, Lichen Database), marine natural product databases (MNPD, SWMD), natural product databases of different countries and regions (IMPPAT, NeMedPlant, MedPServer, TlPdb, AfroDB, ANPDB, BIOFACQUIM, NUBBEDB), food natural product databases (FooDB, BitterDB, Phenol-Explorer, PhytoHub, SuperSweet database), toxic natural product databases (Exposome-Explorer, T3DB, Snake Neurotoxin Database, TPPT), natural product industry catalogs (Greenpharma, AnalytiConDiscovery, InterBioScreen, Indofine Chemical Company, Pi Chemicals Systems\Specs, TargetMol), databases for deduplicating MS data (MoNA, MassBank, METLIN, HMDB, YMDB, ReSpect, GNPS), databases for deduplicating NMR data (NMRShiftDB, NAPROC-13), etc.

[0028] Furthermore, the DNA includes single-stranded DNA, double-stranded DNA, circular DNA, and linked DNA.

[0029] Furthermore, the RNA includes mRNA, tRNA, rRNA, snRNA, hRNA, antisense RNA, tCRNA, dsRNA, SCRNA, RNA with catalytic activity, and various viral RNAs.

[0030] Furthermore, the drug candidate includes various pharmaceutically acceptable salt forms.

[0031] Furthermore, the candidate drugs include drugs used alone or in combination.

[0032] Furthermore, the pharmaceutical composition refers to a combination of a candidate drug and a pharmaceutically acceptable carrier.

[0033] The term "pharmaceutically acceptable" used in the present invention is used herein to refer to compounds, materials, compositions and / or dosage forms that are suitable for use in contact with human and animal tissues without excessive toxicity, irritation, allergic reactions or other problems or complications within the scope of reasonable medical judgment, and that meet a reasonable benefit / risk ratio. Suitable carriers can be large, slowly metabolized macromolecules, such as proteins, polysaccharides, polylactic acid, polyglycolic acid, polymeric amino acids and amino acid copolymers. Such carriers are well known to those of ordinary skill in the art. The pharmaceutically acceptable carrier in the pharmaceutical composition can include fluids, such as water, saline, glycerol and ethanol. Auxiliary substances, such as wetting agents or emulsifiers, pH buffer substances, etc., can also be present in such vehicles.

[0034] Furthermore, the male infertility-related diseases include azoospermia, oligospermia, asthenozoospermia, asthenozoospermia and infertility with normal sperm count.

[0035] Furthermore, the male infertility-related disease is asthenozoospermia.

[0036] The seventh aspect of the present invention provides a method for screening candidate drugs for male infertility-related diseases, the method comprising administering a drug to the animal model described in the fifth aspect of the present invention and / or cells derived from the animal model described in the fifth aspect of the present invention; if the drug can improve symptoms related to male infertility in the animal model or cells derived from the animal model, then the drug is a candidate drug for male infertility-related diseases.

[0037] In some embodiments, the improvement refers to an enhancement of the symptoms of the animal model (such as sperm morphology, mirror count, sperm motility, etc.) or the cell phenotype derived from the animal model (such as sperm internal structure, etc.) by at least about 10%, at least about 30%, at least about 50%, at least about 80% or more compared to before drug administration.

[0038] Advantages and beneficial effects of the present invention: 1. The model is a method for constructing an asthenozoospermia and mouse infertility model by targeting the NAMPT protein for amino acid mutation. The asthenozoospermia and mouse infertility effects are stable. The percentage of total sperm activity, the percentage of sperm forward movement, and sperm-related movement parameters in the NAMPT C39S point mutation homozygous mouse model are significantly different from those of wild-type mice, and the repeatability is strong. It is an ideal asthenozoospermia and infertility mouse model.

[0039] 2. The present invention overcomes the problems of poor drug-induced stability, low efficiency, and the difficulty of studying asthenozoospermia and mouse infertility caused by changes in other reproductive phenotypes or physiological functions after certain gene perturbations. Except for the decrease in sperm motility and related movement parameters, the model mice have no obvious abnormalities in other reproductive phenotypes and organ development.

[0040] 3. The homozygous point mutation of NAMPT C39S leads to IVF failure but does not affect the results of ICSI, which is consistent with the clinical results that infertility caused by reduced sperm motility may fail to fertilize through IVF but can be successfully fertilized through ICSI, increasing the availability of this model.

[0041] The establishment of this model can provide reproductive medicine researchers with a reliable asthenozoospermia and infertility mouse model, and provide new ideas for clinical research on the mechanisms and drug targets of mouse infertility. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] Figure 1 This is a diagram showing the effect of the NAMPT C39S point mutation on the NAMPT protein in the testis and on the organ development of mice. Figure 1 A in the figure is a picture of the overall appearance of mice and a comparison of their weight; Figure 1 B in the figure is a comparison of the appearance and weight of the mouse heart. Figure 1 C in the figure is the comparison result of mouse liver appearance and liver weight. Figure 1 D in the figure is the appearance of mouse spleen and the comparison result of spleen weight. Figure 1 E in the figure is a comparison of the appearance of mouse lungs and lung weight. Figure 1 F in the figure is the comparison result of the mouse kidney appearance and kidney weight. Figure 1 G in the figure is the expression of NAMPT protein in the testis of mice at P0-P80 detected by Western blot and the quantitative graph of protein expression. Figure 1 H in the figure is the expression diagram of different polymerized forms of NAMPT in mouse testis detected by BN-PAGE. Figure 1 I in the figure is the expression of total NAMPT protein in mouse testis. Figure 1J in the figure is a quantitative diagram of the expression of NAMPT dimer protein in mouse testis. Figure 1 K in the figure is a quantitative diagram of the ratio of NAMPT dimer to NAMPT monomer protein in mouse testis expression. Figure 1 L in the figure is the quantitative diagram of the expression of NAMPT proteins of different sizes and the expression of polymers detected by Western blot and exclusion chromatography. Figure 1 The M in the figure is NAD detected by mass spectrometry + Expression profile in mouse testis.

[0043] Figure 2 The effect of NAMPT C39S point mutation on spermatogenesis and function in mice is shown in the figure. Figure 2 A is a representative image of the mouse testis and epididymis. Figure 2 B in the figure is the comparison result of mouse testis weight. Figure 2 C in the figure is the comparison result of mouse epididymis weight. Figure 2 D in the figure is the localization of NAMPT protein in mouse testis detected by immunofluorescence, Scale bar=100 μm, Figure 2 E in the figure is the histological morphology of mouse testis P0-P80 detected by HE staining, original image Scale bar=300 μm, detailed enlarged image Scale bar=900 μm, Figure 2 F in the figure is a representative picture of mouse sperm morphology and the percentage of normal sperm count detected by HE staining, observed under a 40x microscope, Scale bar=20 µm, Figure 2 The G in the figure is the internal structure of mouse sperm detected by transmission electron microscopy, Scale bar = 300 nm, Figure 2 The H in the figure is the result of manual counting method to detect the number of mouse sperm. Figure 2 I in the figure is the result of CASA detection of forward movement and total active sperm percentage of mice. Figure 2 J in the figure is the result of CASA detection of mouse sperm VAP, VSL, and VCL. Figure 2 K in the figure is the result of CASA detection of mouse sperm ALH. Figure 2 The L in the figure is the result of ELISA detection of mouse serum T. Figure 2 The M in the figure is the result of ELISA detection of mouse serum LH. Figure 2 N in the figure is the result of ELISA detection of mouse serum FSH.

[0044] Figure 3 It is a flowchart of mouse IVF and ICSI, and embryo development diagram. Figure 3 A in the figure is the IVF flow chart. Figure 3 B in the figure is the IVF embryonic development diagram of WT, HE and KI mice, Scale bar=100 μm, Figure 3 C in the figure is the IVF flow chart. Figure 3 D in the figure is the ICSI embryonic development diagram of WT, HE and KI mice, Scale bar=100 μm.

[0045] Figure 4 This figure shows the effect of NAMPT C39S point mutation on the fertility of male mice. DETAILED DESCRIPTION

[0046] In order to enable those skilled in the art to better understand the scheme of the present invention, the technical scheme in the embodiment of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiment of the present invention. Obviously, the described embodiment is only a part of the embodiment of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without making creative work are within the scope of protection of the present invention.

[0047] Example 1 Construction and verification of male infertility mouse model 1. Experimental reagents and instruments 1. Main reagents: (1) Mouse genotype identification kit (B40015, Selleck, USA); (2) HE staining kit (C0105S, Shanghai Bio-Technology Co., Ltd., China); (3) Hydrochloric acid ethanol rapid differentiation solution (C0161S, Shanghai Bio-Technology Co., Ltd., China); (4) Mouse luteinizing hormone (LH) ELISA kit (E-EL-M3053, Elabsicence, USA); (5) Mouse follicle-stimulating hormone (FSH) ELISA kit (E-EL-M0511c, Elabsicence, USA); (6) Mouse testosterone ELISA kit (E-OSEL-M0003, Elabsicence, USA); (7) PBS (G4202, Beijing Solebow Technology Co., Ltd., China); (8) PMSG (Ningbo Second Hormone Factory, China); (9) HCG (Hangzhou Animal Drug Co., Ltd., China) (10) M2 culture medium (M7167, Sigma-Aldrich, Germany); (11) KSOM culture medium (MR-106, Sigma-Aldrich, Germany); (12) Mineral oil (M8410, Sigma-Aldrich, Germany); (13) HTF sperm capacitation solution (MR-070, Sigma-Aldrich, Germany); (14) PVP (LifeGlobal, USA); (15) Hyaluronidase (M2215, Nanjing Aibei Biotechnology Co., Ltd., China); (16) HTF sperm capacitation solution (MR-070, Sigma-Aldrich, Germany); (17) PBS (G4202, Beijing Solebow Technology Co., Ltd., China).

[0048] 2. Main instruments: (1) Pipette: 2.5 μL, 10 μL, 20 μL, 200 μL, 1000 μL (Eppendorf, Germany); (2) Stereo microscope (SZX10, Olympus, Japan); (3) Inverted microscope (IX71, Olympus, Japan); (4) Piezoelectric impact driver (PIEZO PMM4G, Sutter Instrument, USA); (5) Micromanipulator (TransferMan 4r, Eppendorf, Germany); (6) CO2 incubator (BB150, Thermo, Germany); (7) Ordinary PCR amplification instrument (TP600, TaKaRa, Japan); (8) Tabletop room temperature centrifuge (Heraeus Tresco21, Thermo Corporation, USA); (9) ELISA reader (Cytation5, BioTek, USA); (10) paraffin embedding machine (HistoStar, Thermo Corporation, Germany); (11) slicer (RM2255, Leica, Germany); (12) oven (HerathermOMS60, Thermo Corporation, Germany); (13) sperm CASA motility analyzer (WLJY-9000, Beijing Weili Medical Company, China).

[0049] 3. Bioinformatics websites and computer analysis software: (1) NCBI website: http: / / www.ncbi.nlm.nih.gov / ; (2) Primer design website: https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / ; (3) Real-time fluorescence quantitative PCR result analysis software: BioRad CFX Manager; (4) Gel imaging software: Bio-Rad Image Lab Software; (5) Optical density analysis software: ImageJ software; (6) Graphics software: GraphPad Prism 8; AdobePhotoshop 2020; (7) Statistical analysis software: GraphPad Prism 8.

[0050] 2. Model Construction 1. Mouse breeding: The C57BL / 6J background NAMPT Cys39 point mutation male mice used in this experiment were donated by the Basic Medical College of Peking Union Medical College and were bred in the Experimental Animal Department of China Medical University after embryo purification. The animal level was SPF grade. Wild-type male and wild-type female mice were purchased from Beijing Weitonglihua Experimental Animal Technology Co., Ltd., and the animal level was SPF grade and bred in the Experimental Animal Department of China Medical University. The mice had free access to food and water during their growth, and the experimental environment maintained a 12-hour light-dark cycle to simulate the day-night transition in the outside world.

[0051] 2. Construction of CRISPR-mediated NAMPT Cys39 point mutation chimeric mice: Microinjection of Cas9mRNA corresponding to Nampt-C39S-gRNA (target sequence: TTTCACGGCATTCAAAGTAGG, where the PAM sequence is AGG) and the corresponding donor DNA.

[0052] Homologous recombination template (Donor plasmid) design: green background: non-target mutation (synonymous mutation); yellow background: target mutation, location of point mutation, p.39 C->S; red background: approximate location of CRISPR shearing genomic DNA; Genome: TAGGTTACTCACTATAAACAATACCCACCCAACACAAGCAAAGTTTATTCCTACTTTGAATGCCGTGAAAAGAAGACAGAAAACTCCAAAGTAAGG.

[0053] Mutant type (Donor): TAGGTTACTCACTATAAACAATACCCACCAAATACAAGCAAAGTTTATTCATATTTTGAATCCCGTGAAAAGAAGACAGAAAACTCCAAAGTAAGG.

[0054] The codon for cysteine ​​at position 39 was mutated from C to G, thereby mutating cysteine ​​to serine. The fertilized eggs were transferred into pseudo-pregnant female mice, and the PCR products amplified from the DNA derived from the tail were sequenced. The genotype of the two-week-old newborn mice was identified. CRISPR-mediated NAMPT Cys39 point mutation chimeric mice (F0 generation) were mated with wild-type C57BL / 6J mice to obtain heterozygous Nampt C39S mice (F1 generation).

[0055] 3. Mouse genotype identification: Cut the toes of mice 10 to 14 days after birth and place them in a 1.5 mL EP tube. Centrifuge for a moment to sink the mouse paws to the bottom of the tube. Add the prepared tissue digestion solution to the EP tube, place it in a 55°C metal bath for 15 minutes, terminate the digestion at 95°C for 5 minutes to inactivate the protease in the digestion solution, and centrifuge at 12,000 rpm for 5 minutes. Take the supernatant as a PCR template.

[0056] 3. Model Validation 1. Mouse mating experiment: Male WT, HE, and KI littermates were mated with female WT mice at a ratio of 1:2 for 3 months. Male mice that made one or more female mice pregnant were recorded as fertile male mice, and the average number of litters born by each female mouse was recorded.

[0057] 2. Mouse sperm count: 5g NaHCO3 and 1mL 35% (v / v) formaldehyde solution were added to 100mL pure water to prepare a fixative solution. After the mouse was anesthetized with 0.3% sodium pentobarbital (55mg / kg), the epididymal tail was removed and placed in a culture dish containing PBS preheated to 37°C. The epididymal tail was pierced with a 1mL syringe needle to allow the sperm to swim freely. The cells were incubated in a 37°C incubator for 5 minutes, and then the sperm freed in saline were diluted with the fixative solution at a ratio of 1:5 to 1:10. Sperm was counted using a hemocytometer under a 400x optical microscope according to the traditional method.

[0058] 3. Analysis of mouse sperm morphology: After anesthetizing mice with 0.3% sodium pentobarbital (55 mg / kg), the epididymal tail was removed and placed in a culture dish containing PBS preheated to 37°C. The epididymal tail was scratched with a 1 mL syringe needle to allow the sperm to swim freely. The cells were incubated in a 37°C incubator for 5 minutes, and then diluted with PBS at a ratio of 1:5 to 1:10. The liquid was dropped on a glass slide, flattened, air-dried, fixed in 95% ethanol for 20 minutes, stained with hematoxylin for 30 minutes, rinsed with tap water, stained with eosin for 5 minutes, rinsed with tap water, dried, and the number of normal and abnormal sperm was counted.

[0059] 4. HE staining of mouse testicular tissue: (1) Dewaxing: Place the testicular sections in xylene I for 15 min, xylene II for 15 min, xylene III for 15 min, anhydrous ethanol I for 5 min, anhydrous ethanol II for 5 min, 85% alcohol for 5 min, 75% alcohol for 5 min, and then wash with distilled water.

[0060] (2) Hematoxylin staining of cell nuclei: Place the slices in hematoxylin for 3-8 minutes, rinse with tap water, differentiate in 1% hydrochloric acid alcohol for a few seconds, and rinse with tap water to turn blue.

[0061] (3) Eosin staining of cytoplasm: Place the sections in eosin staining solution and stain for 1 to 3 minutes.

[0062] (4) Dehydration and sealing: Place the slices in 75% alcohol for 5 min, 85% alcohol for 5 min, anhydrous ethanol I for 5 min, anhydrous ethanol II for 5 min, and xylene I for 5 min to dehydrate and make them transparent. Take the slices out of xylene, let them dry slightly, and then seal the slices with neutral gum.

[0063] 5. Transmission electron microscopy analysis of mouse sperm: (1) After anesthetizing the mouse with 0.3% sodium pentobarbital (55 mg / kg), the epididymal cauda was removed and placed in a culture dish containing PBS preheated to 37°C. The epididymal cauda was pierced with a 1 mL syringe needle to allow the sperm to swim freely. The cauda was allowed to swim at 37°C for 30 min and centrifuged at 1000 g for 10 min. The PBS supernatant was discarded and the sperm pellet was retained.

[0064] (2) Add 1 mL of electron microscopy fixative (3% paraformaldehyde + 3% glutaraldehyde, prepared in 0.1 M cacodylate buffer) to the EP tube containing the sperm pellet and fix at 4°C for 24 h.

[0065] (3) Remove from 4°C and fix at room temperature for 1 hour.

[0066] (4) Remove the tissue from the electron microscopy fixative and wash it three times with 0.1 M cacodylate buffer, each time for 10 min.

[0067] (5) Fix with 1% osmium acid fixative at room temperature for 1 h.

[0068] (6) Alcohol gradient dehydration: 30% ethanol, 50% ethanol, 70% ethanol, 90% ethanol, 100% ethanol, each gradient for 15 min.

[0069] (7) Embed the testicular tissue with epoxy resin mixture at 60°C for 24 h.

[0070] (8) The testicular tissue is cut into slices of approximately 70 nm using an ultrathin slicer.

[0071] (9) The sections were double stained with 3% uranyl acetate and lead citrate.

[0072] (10) Transmission electron microscopy observation and filming.

[0073] 6. Mouse sperm motility analysis: After anesthetizing mice with 0.3% sodium pentobarbital (55 mg / kg), the epididymal tail was removed and placed in a culture dish containing HTF preheated to 37°C. The epididymal tail was pierced with a 1 mL syringe needle to allow the sperm to swim freely. The cells were incubated in a 37°C incubator for 10 min, and 10 µL was added to the sperm counting plate. The sperm motility of the mice was detected using Beijing Weili CASA sperm analyzer.

[0074] 7. Mouse luteinizing hormone (LH) enzyme-linked immunosorbent assay: Use the Elabscience kit (kit number: E-EL-M3053). The specific operation method is as follows: 7.1 Reagent Preparation and Liquid Preparation.

[0075] (1) Take out the test kit from the refrigerator 20 minutes in advance and equilibrate it to room temperature.

[0076] (2) Washing solution: Dilute the concentrated washing solution with double distilled water (1:24).

[0077] (3) Standard working solution: Centrifuge the standard at 10000g for 1min, add 1mL of standard and sample diluent to the freeze-dried standard, tighten the tube cap, let it stand for 10min, turn it upside down several times, and after it is fully dissolved, gently mix it to avoid foaming, and prepare a 20ng / mL standard working solution. Then make multiple dilutions as needed. Prepare the following concentrations: 20, 10, 5, 2.5, 1.25, 0.63, 0.31, 0ng / mL. Multiple dilution method: Take 7 EP tubes, add 500μL of standard & sample diluent to each tube, draw 500μL from the 20ng / mL standard working solution into the first EP tube and mix it to make a 10ng / mL standard working solution, and follow this step to draw and mix it in turn. The last tube is directly used as a blank well, and there is no need to draw liquid from the second to last tube. The multiple dilution standard working solution needs to be prepared and used immediately.

[0078] (4) Biotinylated antibody working solution: Calculate the required amount for the experiment before the experiment (calculated as 100 μL / well). When preparing the solution, prepare 100~200 μL more. 15 minutes before use, centrifuge the concentrated biotinylated antibody at 800g for 1 minute, and dilute the 100× concentrated biotinylated antibody to 1× working concentration with biotinylated antibody diluent. Prepare and use immediately.

[0079] (5) HRP enzyme conjugate working solution: HRP enzyme conjugate is HRP enzyme conjugate with avidin. Before the experiment, calculate the amount required for the experiment (calculated as 100 μL / well). When preparing, prepare 100~200 μL more. 15 minutes before use, centrifuge the concentrated HRP enzyme conjugate at 800g for 1 minute, and dilute the 100× concentrated HRP enzyme conjugate to 1× working concentration with enzyme conjugate diluent. Prepare and use immediately.

[0080] 7.2 Sample testing.

[0081] (1) Set up standard wells, blank wells, and sample wells respectively. Add 100 μL of the diluted standard to the standard wells, 100 μL of the standard & sample diluent to the blank wells, and 100 μL of the sample to be tested to the remaining wells. Coat the ELISA plate and incubate at 37°C for 90 min. Add the sample to the bottom of the ELISA plate, try not to touch the wall of the well, and gently shake to mix and avoid bubbles. The sample addition time should be controlled within 10 min.

[0082] (2) Shake off the liquid in the wells without washing. Add 100 μL of biotinylated antibody working solution to each well, cover the ELISA plate with a film, and incubate at 37°C for 1 hour.

[0083] (3) Shake off all the liquid in the wells and pat dry on clean absorbent paper. Add 350 μL of washing solution to each well, soak for 1 min, absorb or shake off the liquid in the ELISA plate, and pat dry. Repeat this washing step 3 times. After washing, proceed to the next step immediately and do not let the microplate dry.

[0084] (4) Add 100 μL of HRP conjugate working solution to each well, cover the ELISA plate with a film, and incubate at 37°C for 30 min.

[0085] (5) Shake off all liquid in the wells and wash the plate five times using the same method as step (3).

[0086] (6) Add 90 μL of substrate solution (TMB) to each well, cover the plate with a film, and incubate at 37°C in the dark for about 15 minutes. Tip: Shorten or extend the time as appropriate according to the actual color development, but do not exceed 30 minutes. When a clear gradient appears in the standard well (clear blue gradient appears in the first 4 color development wells), the assay can be terminated. Turn on the microplate reader 15 minutes in advance to preheat.

[0087] (7) Add 50 μL of stop solution to each well to terminate the reaction. The order of adding the stop solution should be as similar as that of adding the substrate solution.

[0088] (8) Immediately measure the OD value of each well using a microplate reader at a wavelength of 450 nm.

[0089] 8. Mouse follicle-stimulating hormone (FSH) enzyme-linked immunosorbent assay: Use the Elabscience kit (kit number: E-EL-M0511). The reagent preparation, liquid configuration and sample detection methods are the same as 7. Mouse luteinizing hormone (LH) enzyme-linked immunosorbent assay.

[0090] 9. Mouse testosterone enzyme-linked immunosorbent assay: Use the Elabscience kit (kit number: E-OSEL-M0003). The specific operation method is as follows: The reagent preparation and liquid configuration methods are the same as 7. Mouse luteinizing hormone (LH) enzyme-linked immunosorbent assay.

[0091] (1) Set up standard wells, blank wells, and sample wells respectively. Add 50 μL of the diluted standard to the standard wells, 50 μL of the standard & sample diluent to the blank wells, and 50 μL of the sample to be tested to the remaining wells. Immediately add 50 μL of HRP enzyme conjugate working solution to each well, cover the plate with a film, and incubate at 37°C for 60 min. Tip: When adding the sample, add the sample to the bottom of the plate, try not to touch the wall of the well, and shake gently to mix and avoid bubbles. The entire sample addition time should be controlled within 10 min.

[0092] (2) Shake off all the liquid in the wells and pat dry on clean absorbent paper. Add 350 μL of washing solution to each well, soak for 1 min, absorb or shake off the liquid in the ELISA plate, and pat dry. Repeat this washing step 5 times. After washing, proceed to the next step immediately and do not let the microplate dry.

[0093] (3) Add 90 μL of substrate solution (TMB) to each well, cover the plate with a film, and incubate at 37°C in the dark for about 15 minutes. Tip: shorten or extend the time as appropriate according to the actual color development situation, but do not exceed 30 minutes. When a clear gradient appears in the standard well (clear blue gradient appears in the first 4 color development wells), it can be terminated. Turn on the microplate reader 15 minutes in advance to preheat.

[0094] (4) Add 50 μL of stop solution to each well to terminate the reaction. Tip: The order of adding the stop solution should be the same as the order of adding the substrate solution.

[0095] (5) Immediately measure the OD value of each well using a microplate reader at a wavelength of 450 nm.

[0096] 10. Production of sterile male mice - vasectomy.

[0097] (1) Anesthesia: The mouse was weighed and anesthetized by intraperitoneal injection of anesthetic. The mouse was placed on a surgical tray with the abdomen facing upwards, sprayed with 75% alcohol for disinfection, and the abdominal hair was trimmed.

[0098] (2) Cauterization of the vas deferens: Cut the skin and make a 1.5 cm transverse incision at the horizontal line of the upper end of the lower limb. Make a transverse incision of the same size on the abdominal wall. Clamp the fat pad on one side of the testicle and pull it out through the incision. Pull out the testicle, epididymis, and vas deferens together. Use red-hot tweezers to cauterize about 1 cm of the vas deferens. Clamp the fat pad with tweezers and put the testicle back into the abdominal cavity. Repeat the same operation on the other side of the vas deferens.

[0099] (3) Suture: Suture the abdominal wall, then suture the skin, and gently wipe the suture with iodine. Place the mouse on a warming tray until it wakes up.

[0100] 11. Mouse intrafallopian tube embryo transfer: Female mice weighing 25-35g and older than 6 weeks old are mated with vasectomized male mice in advance. The day when vaginal plug appears is counted as 0.5 days of pseudopregnancy. Female mice with 0.5 days of pseudopregnancy can be used for intrafallopian tube embryo transfer.

[0101] (1) Anesthesia: Pseudo-pregnant female mice were weighed and anesthetized by intraperitoneal injection of 0.3% sodium pentobarbital (55 mg / kg). The mice were placed on a surgical tray with the abdomen facing upward.

[0102] (2) Embryo suction into the transplant tube: First, aspirate a small amount of M2 culture medium, then a small bubble, then M2 culture medium, and then a second small bubble. Use plasticine to fix the transplant tube connected to the mouth control tube to the table of the stereo microscope until the fallopian tube embryo is transplanted.

[0103] (3) Transplantation: Spray with 75% alcohol for disinfection, trim the abdominal hair, make an incision parallel or perpendicular to the spine on the back to access the fallopian tubes and ovaries on both sides, slide the skin around, observe the position of the ovaries through the body wall, clamp the body wall, cut a small hole where the ovaries are located, clamp the fat pad and pull out the ovaries, fallopian tubes and uterus. Under the microscope, find the opening of the fallopian tube and the enlarged ampulla of the fallopian tube under the ovarian sac, use tweezers to tear a small hole in the ovarian sac at the umbrella of the fallopian tube, insert the transplant tube into the opening of the fallopian tube, and blow into the ampulla of the fallopian tube. Use tweezers to pick up the fat pad and put the uterus, fallopian tube and ovary back into the body cavity.

[0104] (4) Suture: Suture the abdominal wall, then suture the skin, and gently wipe the suture with iodine. Place the mouse on a warming tray until it wakes up.

[0105] 12. Mouse in vitro fertilization experiment: (1) Superovulation: On the first day, each female mouse was injected with 10 IU of PMSG at 9 pm. On the third day, 48 hours later, 10 IU of HCG was injected, and fertilization was performed 12 to 16 hours later.

[0106] (2) Preparation of culture dishes: Prepare fertilization solution and culture dishes in the afternoon of the day before fertilization. Take 35mm embryo culture dishes as drops. Sperm capacitation dish: 200µL HTF, 1 drop; fertilization dish: 200µL HTF, 10 drops, covered with oil; culture dish: 50µL KSOM, 10 drops, covered with oil. All dishes are placed in a carbon dioxide incubator at 37℃ and 5% CO2.

[0107] (3) Sperm capacitation: Day 4: Make five 200µL drops of M2 culture medium in the embryo culture dish, cover with oil, and preheat the dish to 37°C. 12-16 hours after the female mouse is injected with HCG, the male mouse is killed, the epididymal tail is quickly cut off with ophthalmic scissors and ophthalmic forceps, and gently washed in the M2 culture medium drop, and the epididymal tail is transferred to the HTF in the capacitation dish. The epididymal tail is cut with a syringe needle, and after the sperm overflows, it is incubated in a 37°C incubator for 10 minutes, taken out and observed under a stereoscope, and after the sperm spreads, it is placed in the incubator and incubated for another 50 minutes.

[0108] (4) Egg retrieval: After sperm is obtained, the female mouse is anesthetized with 0.3% sodium pentobarbital (55 mg / kg) and then dissected. The oviduct is quickly cut with ophthalmic scissors and ophthalmic forceps and gently washed in M2 culture medium. The oviduct is placed in the mineral oil between the fertilization dish HTF. The fertilization dish with the oviduct is moved under the stereoscope, and two 1 mL syringe needles are used to cut the ampulla of the oviduct, release the cumulus, and pick it into the HTF drop. All the eggs are collected in HTF, washed, blown repeatedly, and then distributed into the clean fertilization dish HTF drops, with 2 cumulus in each drop.

[0109] (5) Fertilization: Use a pipette to draw 5 µL of sperm from the sperm capacitation dish and add it to the fertilization drop, then start timing. 6 hours after fertilization, observe and record the number of pronuclei, then use a 100 µm diameter pipette made from a 1.5 mm frosted glass tube to move the fertilized egg from the fertilization drop into the M2 culture dish drop, repeatedly blow and beat until there is basically no sperm left on the zona pellucida, then move the fertilized egg to the KSOM drop and continue to culture it in a 37°C, 5% CO2 incubator overnight. 24 hours after fertilization, observe the 2-Cell fertilized egg for transplantation or observe the culture development every 24 hours, and take photos and record.

[0110] (6) Transplantation: Follow the above transplantation steps.

[0111] 13. Mouse oocyte intracytoplasmic sperm injection experiment.

[0112] (1) Superovulation: The method is the same as the superovulation steps mentioned above.

[0113] (2) Preparation of culture dishes and solutions: Prepare culture dishes in the afternoon of the day before fertilization. Take a 35mm embryo culture dish as the drop. Culture dish: 50µL KSOM, 10 drops, cover with oil, and place the dish in a carbon dioxide incubator at 37℃ and 5% CO2; prepare MIN solution: 123.0mM / L KCl, 2.6mM / L NaCl, 7.8mM / L NaH2PO4, 1.4mM / L KH2PO4, 3mM / L EDTA; prepare PVP solution: 1.2g PVP is dissolved in 8mL normal saline, filtered with a 0.45µm filter, and then divided into aliquots and stored at -20℃.

[0114] (3) Ultrasonic sperm tail amputation: Place a beaker containing 2 mL of NIM solution in a cold bath (0-1°C) for 2 minutes. After anesthetizing the mouse with 0.3% sodium pentobarbital (55 mg / kg), dissect the mouse, remove the epididymal tail, cut the epididymis into pieces with scissors, and place the bilateral epididymal tails of the mouse in a beaker. Shake the beaker intermittently for about 5 minutes to allow the sperm to diffuse in the NIM solution. Filter the sperm suspension with tissue paper to remove epididymal tissue fragments. Place the filtered sperm suspension of about 1 mL in an ice water bath and sonicate the suspension with an ultrasonic device at 60% power for 5 seconds. More than 95% of the sperm will be tail amputated. Add 9 mL of cold NIM to the beaker for dilution, centrifuge at 1000 g for 5 minutes, and remove the supernatant. Add 10 mL of NIM and centrifuge again. Mix the sperm head suspension after centrifugation with an equal volume of NIM containing 10% glycerol, store at 0-1°C, and perform ICSI within 1 hour.

[0115] (4) Egg retrieval: Make five 200µL droplets in the embryo culture dish with M2 culture medium and cover with oil; make five 200µL droplets in the embryo culture dish with hyaluronidase solution and cover with oil. Preheat the above two dishes to 37°C. After sperm is obtained, the female mouse is killed, and the oviduct is quickly cut off with ophthalmic scissors and ophthalmic forceps and gently washed in M2 culture medium. The oviduct is placed in the mineral oil between the hyaluronidase drops in the culture dish. Move the fertilization dish with the oviduct under the stereoscope, use two 1mL syringe needles to cut the ampulla of the oviduct, release the cumulus, pick it into the hyaluronidase droplet, and blow it repeatedly (about 1~2min). After the granulosa cells are loosened, all the eggs are collected in the M2 droplet for washing, and blow it repeatedly to remove the hyaluronidase, and then the eggs are distributed into the KSOM droplet.

[0116] (5) Injection: Install the injection needle and the fixed needle, adjust the position of the needle under the low power microscope until it is clearly visible, and then slightly raise it. Determine the pulse intensity. Move the needle into the PVP droplet and observe the pulse at the interface between PVP and the operating liquid. Aspirate the heads of 10 sperm at a time, with the interval between the two heads being 100µm. Adjust the fixed needle and the injection needle to the vicinity of the egg cell, and magnify the microscope at 200 times. Push the head of the first sperm to a position 50~100µm away from the opening end, adjust the clarity of the injection needle, move the opening to contact the zona pellucida of the egg cell, control the injection needle to be in the state of re-absorption and move the injection needle toward the fixed needle, and give pulses (5~10). When the injection needle quickly passes through the zona pellucida and enters the perivitelline space, stop moving. A part of the zona pellucida in the injection needle tip is discharged into the perivitelline space. Push the sperm head to the vicinity of the needle mouth, stop moving when the moving distance reaches 95% of the egg, and give a single pulse. Through the positive pressure of the injection needle, the sperm head is driven into the cytoplasm and the needle is withdrawn smoothly. The eggs are released by the positive pressure of the fixed needle, and the above steps are repeated until the remaining eggs are processed. The eggs are transferred to the prepared KSOM dish, washed several times, and cultured in a 37°C, 5% CO2 incubator. Observe under a microscope for 5-8 hours. 2-Cell embryo transfer is performed 24 hours after fertilization, and the culture development is observed every 24 hours, and photographed and recorded.

[0117] (6) Transplantation: Follow the above transplantation steps.

[0118] 14. Extraction of total RNA from tissues: (1) Take 30 mg of testicular tissue, wrap it in tin foil and place it in liquid nitrogen for 0.5 h. Take it out and quickly beat the tissue with a hammer until it becomes a paste. Collect the tissue in a sterile centrifuge tube, add 1 mL of RNAiso Plus and grinding beads, select grinding conditions according to different tissues, and grind the tissue using a pre-cooled tissue grinder.

[0119] (2) Add 200 mL of chloroform to the centrifuge tube, vortex for 15 seconds, and let stand at room temperature for 3 minutes.

[0120] (3) Centrifuge at 4°C and 12,000 rpm for 15 min. Carefully transfer the upper transparent aqueous phase to a new centrifuge tube.

[0121] (4) Add an equal volume of isopropanol to the centrifuge tube, invert it upside down to mix, and let it stand at room temperature for 10 min.

[0122] (5) Centrifuge at 4°C and 12,000 rpm for 10 min. A white precipitate will be visible at the bottom of the tube. Discard the supernatant.

[0123] (6) Add 1 mL of ethanol prepared with 75% DEPC water to the centrifuge tube and turn it upside down to rinse thoroughly.

[0124] (7) Centrifuge at 7500 rpm at 4°C for 5 min, discard the supernatant, let stand to dry for 15 min, and add DEPC water to dissolve the precipitate according to its size.

[0125] (8) When testing the RNA sample concentration, an OD260 / OD280 ratio between 1.8 and 2.0 indicates that the RNA purity is good. The sample should be stored in a -80°C deep freezer until use.

[0126] 15. cDNA synthesis and real-time quantitative fluorescence PCR reaction: Step 1: Use PrimeSciptTMRT regent Kit with gDNA Eraser to synthesize cDNA. The reaction system is as follows: Remove genomic DNA. The reaction system is shown in Table 1.

[0127] Table 1. Reaction system for removing genomic DNA

[0128] Reaction conditions: 42℃ 2min→4℃+∞.

[0129] Step 2: Synthesis of cDNA chain. The reaction system is shown in Table 2.

[0130] Table 2. Reaction system for cDNA chain synthesis

[0131] Step 3: Use ChamQ Universal SYBR qPCR Master Mix kit to amplify cDNA by real-time quantitative fluorescence PCR. The primers required for the reaction are synthesized by Shanghai Sangon Biotechnology Co., Ltd., and the primer sequences are shown in Table 3.

[0132] Table 3. Primer sequences

[0133] Note: F and R represent upstream primer and downstream primer respectively.

[0134] Three replicate wells were set up for each group of real-time quantitative fluorescence PCR experiments, and the reaction system was shown in Table 4.

[0135] Table 4. Fluorescence quantitative PCR reaction system

[0136] Reaction conditions: pre-denaturation: 95℃ 30 s; cycle reaction: 95℃ 5 s, 60℃ 34 s, 40 cycles; melting curve temperature range: 72℃-95℃.

[0137] 16. Total protein extraction from tissues.

[0138] 16.1 Total protein extraction.

[0139] (1) Weigh 50 mg of testicular tissue, wrap it in tin foil and put it into a liquid nitrogen tank. Take it out after 0.5 h and quickly beat it with a hammer until the tissue becomes a paste. Collect the tissue into a sterile centrifuge tube, add an appropriate amount of IP protein lysis buffer containing protease inhibitors, add grinding beads, select grinding conditions according to different tissues, and grind it in a pre-cooled tissue grinder.

[0140] (2) Place on ice for 30 min, sonicate for 3 s, and repeat 3 times with 3 s interval between each step.

[0141] (3) Centrifuge at 4°C and 12,000 rpm for 20 min and collect the supernatant into a new centrifuge tube. The supernatant is the protein.

[0142] 16.2 Protein concentration determination: Follow the instructions of the Bio-Tech BCA Protein Concentration Assay Kit.

[0143] (1) Add 0, 1, 2, 4, 8, 12, 16, and 20 μL of protein standard to a 96-well plate, and add IP lysis buffer to make up to 20 μL.

[0144] (2) Take 2 μL of the protein to be tested and add it to a 96-well plate. Add IP lysis buffer to make up to 20 μL.

[0145] (3) Prepare BCA reagent (Solution A:Solution B = 50:1) and add 200 μL to each well.

[0146] (4) Incubate in a 37°C incubator for 30 min.

[0147] (5) Use an ELISA reader to measure the absorbance of the standard and sample at a wavelength of A562nm, and calculate the sample protein concentration based on the standard curve and the absorbance of the sample to be tested.

[0148] (6) Mix the protein sample with 5× loading buffer in a ratio of 4:1, boil in a 100°C metal bath for 5 min, and then store the sample in a -80°C deep freezer until use.

[0149] 17. Western blot.

[0150] (1) Prepare SDS-PAGE gel and liquid according to the instructions of the SDS-PAGE gel preparation kit provided by Bio-Time. The gel preparation method is shown in Table 5.

[0151] Table 5. SDS-PAGE gel preparation

[0152] The liquid preparation method is shown in Table 6.

[0153] Table 6. Liquid preparation

[0154] (2) Electrophoresis: Calculate the required amount of protein loading based on the protein concentration, add each sample protein and protein marker into the loading well in turn, and perform vertical electrophoresis at a constant voltage of 80 V for about 30 min until bromophenol blue migrates to the separation gel. Adjust the voltage to 120 V and continue electrophoresis for about 1 h until bromophenol blue migrates to the bottom of the gel, then terminate the electrophoresis.

[0155] (3) Transfer: Cut the PVDF membrane to the appropriate size and soak it in methanol for 5 minutes to activate the positive charge on the surface. Soak the PVDF membrane, gel and filter paper in the transfer solution for 10 minutes to balance. Place the sponge, filter paper, gel, PVDF membrane, filter paper and sponge on the cathode plate (black) in sequence, cover the anode plate (white), clamp it and put it into the transfer tank. Add ice around the transfer tank and transfer at 4°C and a constant current of 200mA for 1 hour.

[0156] (4) Blocking: Wash three times with 1× TBST, 5 min each time, place the PVDF membrane in the blocking solution, and block on a shaker at room temperature for 1 h.

[0157] (5) Primary antibody incubation: Remove the PVDF membrane, wash it three times with 1× TBST, 5 min each time, dilute the primary antibody according to the antibody instructions, put it into the PVDF membrane, and hybridize it overnight at 4°C on a shaker. The dilution ratios of the primary antibodies are: NAMPT is 1:2000; GAPDH is 1:2000.

[0158] (6) Secondary antibody incubation: Wash the membrane three times with 1× TBST (10 min each time), dilute the secondary antibody according to the ratio in the instruction manual (1:10,000), incubate on a shaker at room temperature for 1 h, and wash the membrane three times with 1× TBST (10 min each time).

[0159] (7) Color development: Prepare an appropriate amount of ECL luminescent color developing solution (liquid A: liquid B = 1:1), add the luminescent solution dropwise onto the PVDF membrane, use a chemiluminescence imaging system for exposure and photography, and use Image J software for optical density analysis.

[0160] 18. Blue-Native PAGE.

[0161] (1) Prepare the gel and liquid for Blue-Native PAGE. The gel preparation is shown in Table 7.

[0162] Table 7. Blue-Native PAGE gel preparation

[0163] The liquid preparation is shown in Table 8.

[0164] Table 8. Blue-Native PAGE liquid preparation

[0165] (2) Sample loading and electrophoresis: Connect the electrophoresis instrument, 4°C, 20mA constant current, pre-electrophoresis for 30 minutes to ensure that the pH of the entire system is consistent. Mix the protein sample with 5× loading buffer in a ratio of 4:1. Add the mixed sample and protein marker to the sample well where the pre-electrophoresis is completed, and perform electrophoresis at 4°C and 20mA constant current. Observe the position of the bands in the gel and the electrophoresis solution every 15 minutes, and stop the electrophoresis when the 70kDa marker is electrophoresed to the middle of the gel.

[0166] (3) Transfer: After the electrophoresis, remove the gel from the glass plate and place it in an electrophoresis solution containing SDS for 30 minutes at room temperature. Prepare the transfer solution according to the recipe in the WB method. Cut the PVDF membrane of appropriate size and activate it in methanol for 5 minutes. After the gel is shaken and incubated, soak the gel, PVDF membrane and filter paper in the transfer solution for balance. Lay the sponge, filter paper, PVDF membrane and gel in the order specified in the WB method. Clamp the transfer clip, insert it into the transfer rack, pour in the pre-cooled transfer solution and place ice cubes around the transfer rack. Incubate at 4°C and 300mA for 30 minutes.

[0167] (4) Blocking, primary antibody hybridization, secondary antibody hybridization, and chemiluminescent development, the method is as described in 17. Western blot.

[0168] 19. Size exclusion chromatography.

[0169] (1) Sample preparation: Weigh 30 mg of tissue into an EP tube, add 0.8 mL of PBS (1×Cocktail, 1×PMSF), and grind in a tissue grinder (the grinder temperature is maintained at 4°C). Use a contact ultrasonic disruptor to sonicate the tissue homogenate, with an ultrasonic power of 40%, a working time of 15 seconds, and a stop time of 45 seconds. Ensure that the total ultrasonic time for each tube of the same batch of samples is the same. After the solution is clarified, centrifuge at 4°C, 12,000 g for 10 minutes, and take the supernatant into a new 1.5 mL EP tube. The prepared protein solution can be filtered through a 0.22 µm filter membrane before being loaded onto the machine, and 50 µL of the sample is taken as input.

[0170] (2) Use AKTA protein purifier and GE Superdex200 liquid chromatography column to separate proteins: First, vent the system and set the alarm parameters, then connect the column. Slowly rinse the alcohol in the column with water and replace it with PBS, and balance the column with a column volume of solution. Inject 5 mL of PBS into the upper sample loop to clean the upper sample loop.

[0171] (3) Aspirate the prepared protein solution into a 1 mL syringe and inject into the sample loop (at least 600 µL), taking care not to create any bubbles.

[0172] (4) After performing the Inject operation, record the liquid flow rate at this time, and start collecting the protein solution after 11.43 mL has flowed out. Collect one tube for every 600 µL, and record the first tube of protein solution collected at this time as No. 1. A total of 11 tubes will be collected.

[0173] (5) Take out 50 µL of the collected protein solution from each tube and mix them, which is recorded as mix and used as a reference for comparing the total amount of protein between samples.

[0174] (6) Take 200 µL from each of the remaining tubes and place them in new 1.5 mL EP tubes. Add 50 µL SDS loading and boil at 100°C for 10 min.

[0175] (7) The protein sample obtained is tested for content using the method described in 17. Western blot.

[0176] 20. Immunofluorescence.

[0177] (1) Dewaxing: xylene I for 15 min, xylene II for 15 min, xylene III for 15 min, anhydrous ethanol I for 5 min, anhydrous ethanol II for 5 min, 85% alcohol for 5 min, 75% alcohol for 5 min, and washing with distilled water.

[0178] (2) Antigen retrieval: Place the sections in citrate buffer and microwave for 8 min on high heat, 20 min on medium or low heat, cool at room temperature for 1 h, and wash with PBS three times, 5 min each time.

[0179] (3) Incubate the sliced ​​tissue in PBST containing 0.05% TritonX-100 at room temperature: Incubate the sliced ​​tissue in PBST containing 0.05% TritonX-100 at room temperature for 10 minutes and then punch holes for 5 minutes each time. Draw a histochemical circle around the tissue with a histochemical pen.

[0180] (4) 1% BSA blocking: add blocking solution and block at room temperature for 1 h.

[0181] (5) Primary antibody: Gently shake off the blocking solution on the slices, add about 50 μL of the primary antibody prepared in a certain ratio with 1% BSA on the slices, and incubate the slices flat in a humidified box at 4°C overnight. The dilution ratio of NAMPT antibody is 1:500. The next day, wash with PBS three times, 5 minutes each time.

[0182] (6) Secondary antibody: Dilute the fluorescent secondary antibody with PBS containing 1% BSA and incubate with the slice tissue at room temperature for 30-50 min. Wash with PBS three times, 5 min each time.

[0183] (7) Nuclear staining: Use DAPI to stain the nucleus for 5 min at room temperature, away from light, and wash three times with PBS, each time for 5 min.

[0184] (8) Sealing: Seal the slides with antifade agent and observe under a fluorescence microscope.

[0185] 21. Targeted metabolomics mass spectrometry analysis: Weigh about 120 mg of mouse testicles and quickly freeze them in a liquid nitrogen tank; take sperm from both sides of the epididymis tail and place them in PBS preheated at 37℃ in a 37℃ incubator for 10 minutes, then centrifuge at 1000g for 10 minutes. Transport them to the company on dry ice for sample extraction and mass spectrometry detection. Non-targeted metabolomics was commissioned to Shanghai Baipu Biotechnology Co., Ltd. for detection and identification. The specific information is as follows.

[0186] (1) Metabolite extraction: After weighing each sample, add 200 μL of pre-cooled 80% methanol, add 3 medium-sized steel balls, grind in a tissue crusher, add 800 μL of pre-cooled 80% methanol, vortex mix, ultrasonicate in an ice bath for 20 minutes, let stand for 1 hour, centrifuge at 16000g and 4°C for 20 minutes, take the supernatant, add the internal standard L-Glutamate-D5, and evaporate the supernatant in a high-speed vacuum concentrator. The sample was redissolved in 50% methanol solution according to the proportion, centrifuged at 20000g and 4°C for 15 minutes, and the supernatant was taken for mass spectrometry analysis.

[0187] (2) LC-MS / MS analysis: Shimadzu Nexera X2 LC-30AD high performance liquid chromatography was used for separation. Mobile phase: Liquid A was 5% acetonitrile aqueous solution containing 20 mM ammonium acetate pH 9.45, and liquid B was 100% acetonitrile. The sample was re-dissolved in 50% methanol aqueous solution in proportion and placed in a 4℃ autosampler, column temperature 40℃, flow rate 300 μL / min, injection volume 5 μL. The relevant liquid phase gradient was as follows: 0~1min, liquid B was maintained at 95%; 1~12min, liquid B changed linearly from 95% to 55%; 12~13min, liquid B changed linearly from 55% to 40%; 13~15min, liquid B was maintained at 40%; 15~15.1 min, liquid B changed linearly from 40% to 95%; 15.1~18 min, liquid B was maintained at 95%. Mass spectrometry analysis was performed using a QTRAP5500 mass spectrometer (AB SCIEX) in positive / negative ion mode.

[0188] 22. Statistical data analysis.

[0189] All experimental data were statistically analyzed using GraphpadPrism 8 and expressed as mean ± standard error. Unpaired two-tailed Students' t test was used for the difference analysis of mouse organ weight, sperm morphology, quantity, motility, serum hormones, protein grayscale statistics, and mass spectrometry results, and Fisher's exact test was used for mouse fertility and embryonic cell culture. P value less than 0.05 was considered statistically significant.

[0190] IV. Experimental Results 1. The NAMPT C39S point mutation leads to dimer dissociation in the testis of homozygous mice, but has no obvious effect on the organ development of mice.

[0191] To explore whether the NAMPT C39S point mutation has an effect on the basic physical development of mice, the genotype of the mice was identified after birth (the homozygous point mutation of NAMPT C39S is indicated as KI, and the wild-type mice are indicated as WT). The overall appearance of the 6-month-old mice was observed, such as Figure 1 As shown in A, there was no significant difference in appearance between KI and WT mice; the mice were weighed. Figure 1 As shown in A, there was no significant difference in body weight between KI and WT mice (P>0.05). Next, the mice were dissected and their hearts, livers, spleens, lungs, and kidneys were observed. Figure 1 As shown in B, C, D, E, and F in Figure 1, there was no significant difference in the appearance of the organs of KI and WT mice; the organs of the mice were weighed, and there was no significant difference in the weight of the organs of KI and WT mice (P>0.05). The above results indicate that the NAMPTC39S point mutation has no significant effect on the organ development of homozygous mice. Western blot experiments were used to detect the expression of NAMPT protein in the first cycle of spermatogenesis in the testes of WT mice, that is, from day 1 to day 80 after birth (Post-birth: P0-P80). Figure 1 As shown in G, NAMPT was expressed in the whole spermatogenesis process in the mouse testis on the first day after birth (P0: prespermatogonia formation stage), the fourth day (P4: spermatogonial stem cell formation stage), the tenth day (P10: primary spermatocyte formation stage), the fourteenth day (P14: secondary spermatocyte formation stage), the 20th day (P20: round spermatogenesis stage), the 42nd day after birth (P42: extended and mature spermatogenesis stage), and the 80th day (P80: mature spermatogenesis stage), and there was no significant difference among the groups (P>0.05). At the same time, Western blot was used to detect the expression of total NAMPT protein in the testis of KI and WT mice. The results are shown in Figure 2. Figure 1 As shown in H and I, there was no significant difference in the total protein level of NAMPT in the testes of KI and WT mice (according to Figure 1 BN-PAGE was used to detect the polymerization changes of NAMPT protein in the testis of NAMPT C39S point mutation mice. The molecular weight of NAMPT monomer is about 52KDa, and the molecular weight of dimer is about 104KDa. Figure 1 As shown in H, J, and K, the dimer content of NAMPT protein in the testes of KI mice was significantly reduced compared with that of WT mice (according to Figure 1 At the same time, the ratio of dimer to monomer also decreased (according to Figure 1 Calculated by the lower band in the first row and the third row in H) (P<0.05); further, the exclusion chromatography method was used to screen out proteins with different molecular weights, such as Figure 1 As shown in L in the figure, we found a clear protein band at the 158KDa position, which may be due to the non-specific binding of NAMPT monomers with other proteins to form a relatively large polymer, and this non-specific binding cannot be detected by non-denaturing gel. Compared with WT, the expression of NAMPT protein at the 158KDa position in the testis of KI mice increased (P < 0.01). Mass spectrometry was used to detect the NAD after the NAMPT C39S point mutation + Expression in testis, such as Figure 1 As shown in M, NAD + The above results indicate that the NAMPT C39S point mutation leads to the disassembly of dimers and the decrease of NAD in the testis of homozygous mice. + The content was reduced, but there was no obvious abnormality in the development of mice.

[0192] 2. NAMPT C39S point mutation leads to decreased sperm motility in male mice but has no significant effect on spermatogenesis and other sperm parameters.

[0193] To investigate the effects of the NAMPT C39S point mutation on spermatogenesis and function in mice, 12-week-old mice were selected and their testicles and epididymis were first observed and weighed. Figure 2 As shown in Figures AC, we found that the testicles and epididymis of WT and KI mice were smooth, non-congested, and free of other foreign bodies. They looked normal. There was no significant difference in the weight of the testicles, epididymis, and seminal vesicles between KI and WT mice (P>0.05). Immunofluorescence assay was used to detect the localization of NAMPT protein in the testis. Figure 2As shown in D, NAMPT protein is expressed in germ cells of all stages in the seminiferous tubules of KI and WT mice, including spermatogonia, spermatocytes, round spermatids, and elongated spermatids. It is expressed in myoid cells, supporting cells, and interstitial cells in the testicular interstitium at the base of the seminiferous tubules of the testes, and the expression is higher than that in germ cells. There is no significant difference in the expression location of NAMPT protein. To clarify whether the NAMPT C39S point mutation affects the development of testicular tissue and spermatogenesis in mice, the testes of the first cycle of spermatogenesis in mice, i.e., from day 1 to day 80 after birth (Post-birth: P0-P80), were collected for HE staining of tissue sections. The results are shown in Figure 1. Figure 2 As shown in E, cells in the testicular lumen of KI and WT mice were arranged in an orderly manner on the first day after birth (P0: prespermatogonia formation stage), the fourth day (P4: spermatogonial stem cell formation stage), the tenth day (P10: primary spermatocyte formation stage), the 14th day (P14: secondary spermatocyte formation stage), the 20th day (P20: round spermatogenesis stage), the 42nd day (P42: elongated spermatogenesis stage), and the 80th day (P80: mature spermatogenesis stage). Cells at all stages of development were visible, and elongated spermatozoa were regularly arranged around the lumen waiting for release. The testicular tissue morphology of KI mice was normal. The above results indicate that the NAMPT C39S point mutation has no significant effect on the testicular tissue morphology and spermatogenesis of mice. The tail of the sperm is the sperm's motor device, which is divided into four parts: the neck segment, the middle segment, the main segment, and the terminal segment. The neck segment is short and contains centrioles. The longitudinal microtubules emitted from the centrioles constitute the axoneme in the center of the tail. Microtubules were arranged in groups of 2, 9 groups around, and 1 group in the middle. In order to determine whether the NAMPT C39S point mutation affects the morphology and structure of mouse sperm, sperm from the cauda epididymis of 12-week-old mice were collected for HE staining, and the mouse sperm morphology was observed under a 40x microscope. Figure 2 As shown in F, the structure of the sperm head, middle piece, main piece, and tail of KI mice was normal. After statistics, there was no significant difference in the percentage of normal morphology between KI mice and WT mice (P>0.05). In order to further explore whether the NAMPT C39S point mutation affects the internal structure of mouse sperm tail, mouse sperm was fixed with electron microscopy fixative and then sliced, and the internal structure of mouse sperm tail was detected by transmission electron microscopy. Figure 2As shown in G, the middle section of the sperm tail of KI and WT mice contains a "9+2 microtubule" structure, the microtubules are wrapped around the peripheral dense fibers, and the dense fibers are wrapped around the mitochondria; the main section contains a "9+2 microtubule" structure, the microtubules are wrapped around the peripheral dense fibers, and the two dense fibers are replaced by a fiber sheath; the terminal end has no dense fibers and fiber sheaths but contains a "9+2 microtubule" structure, indicating that there is no significant difference in the internal structure of the sperm tail of KI and WT mice. In order to explore the cause of infertility in male KI mice, sperm from the epididymal tail of 12-week-old mice were collected in HTF culture medium and incubated at 37°C for 10 minutes. The number of mouse sperm was detected by manual counting. The experimental results are shown in Figure 2 As shown in H, there was no significant change in sperm count in KI mice compared with the control group WT mice (P>0.05). The sperm motility of mice was detected by CASA, as shown in Figure 2 As shown in I, the percentage of forward-moving sperm was significantly reduced (P<0.01) and the percentage of total active sperm was significantly reduced (P<0.001). Figure 2 As shown in Figure 1, the average path velocity (VAP) was significantly reduced (P < 0.001); the straight-line velocity (VSL) was significantly reduced (P < 0.01); and the curviliner velocity (VCL) was significantly reduced (P < 0.001). Figure 2 As shown in K in the figure, the amplitude of lateral head displacement (ALH) of the sperm head was significantly reduced (P<0.05). The above results show that there is no significant difference in the number of sperm in KI mice compared with WT mice, but the sperm motility and sperm motility of KI mice are reduced. According to the above results, it can be observed that the NAMPT C39S point mutation affects the sperm motility of mice. The process of spermatogenesis requires the hypothalamus-pituitary gonad axis to provide sufficient exogenous hormones. In order to detect the function of testicular hormone production and exclude the effects of hormonal changes on sperm motility, the levels of luteinizing hormone (LH), follicle-stimulating hormone (FSH) and testosterone (T) in the serum of KI and WT mice were detected. The experimental results are shown in Figure 2 As shown in the LN in the figure, there was no significant difference in serum hormone levels between KI and WT mice (P>0.05). The above results indicate that the NAMPT C39S point mutation leads to decreased sperm motility in mice, but does not affect spermatogenesis and other sperm-related parameters.

[0194] 3. NAMPT C39S point mutation causes infertility in male mice.

[0195] Male wild-type WT mice, heterozygous HE mice (NAMPT C39S homozygous point mutation is represented by HE), and homozygous KI mice can be obtained through genotype identification. In this study, the fertility of mice was tested. Male WT, HE, and KI mice of the same litter at 8 weeks of age were mated with 8-week-old female WT mice in a 1:2 ratio. The experiment lasted for 3 months. Male mice that made 1 or more female mice pregnant were recorded as fertile male mice, and the average number of litters born by each female mouse that mated with them was recorded. The experimental results showed that HE, KI, and WT male mice all had normal mating behavior with WT female mice, and vaginal plugs were found in the vaginas of female WT mice that mated with them. Figure 4 As shown in Table 9, female WT mice mated with HE and WT mice were able to become pregnant and give birth normally, and there was no difference in the number of pups (P>0.05), but only one WT female mouse mated with the KI group became pregnant and gave birth to only one pup, but the pup died on the second day after birth, and the fertility was significantly reduced compared with the WT group (P<0.001). This shows that although KI mice have normal mating behavior with WT female mice, they hinder the natural conception of WT female mice, indicating that KI male mice may have fertility disorders. Except for experiments involving embryonic development, the following studies and discussions were conducted using WT and KI mice from the same litter.

[0196] Table 9. Effect of NAMPT C39S point mutation on fertility of male mice

[0197] Note: P values ​​were obtained using Fisher's exact test and unpaired two-tailed Students' t test, *** represents comparison with WT group, P < 0.001; ### represents comparison with HE group, P < 0.001; ns represents comparison with WT group, ns represents no statistical significance, WT: n = 8; HE: n = 10; KI: n = 15; data are expressed as mean ± standard error.

[0198] 4. NAMPT C39S causes in vitro fertilization failure in mice but does not affect the results of intracytoplasmic injection.

[0199] The fertilization of sperm and egg requires the process of sperm capacitation, sperm acrosome enzyme dissolving the zona pellucida of the oocyte, sperm and oocyte membrane fusion, sperm entering the oocyte cytoplasm to activate the oocyte, sperm and egg combination to form two pronuclear fertilized eggs, and then the fertilized egg divides and proliferates into 2-Cell, 4-Cell, 8-Cell, morula and finally blastocyst. In addition, the previous results showed that the number, morphology and testicular tissue morphology of KI mice did not change, but the total activity percentage and forward movement percentage of mouse sperm decreased, and the mice were infertile. We conducted in vitro fertilization experiments on mice. The experimental process is as follows Figure 3 As shown in A. Sperm from 12-week-old KI male mice was co-cultured with eggs from 4-week-old WT female mice to observe sperm-egg fusion and embryonic development. Fertilization and embryonic development were observed. The appearance of pronuclei is a sign of complete fertilization, and two pronuclei (2 Primitivenucleus, 2PN) indicate normal fertilization. The formation of 2PN is used to record the fertilization rate. As shown in Table 10, 6 hours after fertilization, it was found that the number of 2PN formed in KI mice was significantly reduced compared with WT mice (P<0.001), indicating that the fertilization rate of KI mice was reduced.

[0200] Table 10. Effect of NAMPT C39S point mutation on mouse 2PN cell formation n, (%)

[0201] Next, we record the embryonic development at each stage. Figure 3As shown in B, the embryonic cells formed by sperm from WT and HE mice developed evenly, were plump, had less cell fragments, and had uniform nuclei. By the 6th day of the blastocyst stage, the blastocyst cavity was almost full of embryos, with a large number of inner cell mass cells, tightly arranged cells, and a large number of trophoblast cells, forming a dense layer. Although sperm from KI mice could form embryos with eggs, only 8 2-Cells were formed after fertilization of 147 eggs with sperm from KI mice. We counted the number of embryos developed in each period. In order to avoid the uncertainty of whether the developed 2-Cells were developed from "parthenogenetic" cells or 2PN cells, we still used the total number of eggs obtained as the starting cell number to count the number of cell development in the 2-Cell period. The statistical results are shown in Table 11. At 24h after fertilization, the number of 2-Cell formation in KI mice was significantly reduced compared with WT mice (P<0.001); at 96h after fertilization, the number of blastocyst formation in KI mice was significantly reduced compared with WT mice (P<0.05); there was no significant difference in the number of embryonic development at each stage between WT and HE mice (P>0.05). The in vitro fertilization experiment was performed twice, and both experiments found that the number of 2PN formation, 2-Cell formation, and blastocyst formation of KI mouse sperm and eggs were significantly reduced. It is speculated that the sperm of mice with NAMPT C39S point mutation may be blocked due to poor vitality, and one or all of the processes of swimming to the oocyte, contacting, recognizing, and penetrating the oocyte are blocked, and normal fertilization cannot be completed, resulting in fertility disorders.

[0202] Table 11. Effect of NAMPT C39S point mutation on mouse IVF embryo culture n, (%)

[0203] Note: P values ​​were obtained using Fisher's exact test, *** represents P < 0.001; * represents P < 0.05; ns represents no statistical significance; statistical differences were compared with the WT group. The numbers in the table represent the number of embryos in that period, and the numbers in "()" represent the embryonic development rate in each period. Embryonic development rate = number of embryos in that period / number of eggs obtained.

[0204] To investigate whether sperm from KI mice have the ability to activate oocytes and fertilize them, 16-week-old WT, HE, and KI mice and 4-week-old WT female mice were selected for intracytoplasmic sperm injection experiments. The experimental procedures are as follows: Figure 3 The experimental results are shown in C. Figure 3As shown in D, the 2-Cell and 4-Cell morphology of WT, HE, and KI mice developed evenly and plumply, with less cell fragments and uniform nucleus size; by the 6th day of the blastocyst stage, the blastocyst cavity was full of embryos, the number of inner cell mass cells was large, the cells were closely arranged, and the number of trophoblast cells was large, forming a dense layer. Next, the number of embryos developed in each period was counted. As shown in Table 12, although the 2-Cell percentage of KI mice was lower than that of WT mice (P<0.01), more than 50% of WT, HE, and KI mouse embryos had 2-Cell development, and the percentage of normal embryo development in the 4-Cell, morula, and blastocyst stages formed by sperm from KI mice was not significantly different from that of WT (P>0.05). Although the IVF experiment of KI mice failed, ICSI experiments found that sperm could combine with eggs to form embryos after being injected into eggs and the embryos developed normally.

[0205] Table 12. Effect of NAMPT C39S point mutation on mouse ICSI embryo culture n, (%)

[0206] Note: P value was obtained using Fisher's exact test, ** represents P < 0.01, ns represents no statistical significance, and the statistical differences were compared with the WT group; the numbers in the table represent the number of embryos in that period, and the numbers in "()" represent the embryo development rate in each period, and the embryo development rate = number of embryos in that period / number of eggs obtained.

[0207] It can be seen that the construction method of the embodiment of the present application can well construct asthenozoospermia and mouse infertility models, and the experimental biological repeatability is high, the results are stable, and the mouse mortality rate during the modeling process is 0%, indicating that this method is effective, safe and feasible.

[0208] The sequences involved in the present invention are shown in Table 13.

[0209] Table 13. Sequence Listing

[0210] The description of the above embodiments is only used to understand the method and core idea of ​​the present invention. It should be pointed out that, for those skilled in the art, several improvements and modifications can be made to the present invention without departing from the principle of the present invention, and these improvements and modifications will also fall within the scope of protection of the claims of the present invention.

Claims

1. A gRNA for specifically targeting the NAMPT gene through the CRISPR-Cas9 system, characterized in that: The sequence of the gRNA is: UGAAAGUUACGGCACUUU.

2. A CRISPR-Cas9 gene targeting system for constructing a cell or animal model of NAMPT gene mutation, characterized in that: The CRISPR-Cas9 gene targeting system comprises the gRNA specifically targeting the NAMPT gene according to claim 1, Cas9 mRNA, and a donor DNA sequence containing a NAMPT mutation site.

3. The CRISPR-Cas9 gene targeting system according to claim 2, characterized in that: The NAMPT gene mutation is a gene mutation that causes the 39th amino acid of the NAMPT protein to mutate from cysteine ​​to serine; The target sequence of the gRNA specifically targeting the NAMPT gene is TTTCACGGCATTCAAAGTAGG, which includes the PAM sequence at the end; The PAM sequence is AGG; The donor DNA sequence containing the NAMPT mutation site is TAGGTTACTCACTATAAACAATACCCACCCAACACAAGCAAAGTTTATTCCTACTTTGAATGCCGTGAAAAGAAGACAGAAAACTCCAAAGTAAGG.

4. Use of the gRNA specifically targeting the NAMPT gene according to claim 1 and / or the CRISPR-Cas9 gene targeting system according to any one of claims 2-3 in preparing a cell / animal model of NAMPT gene mutation or a male infertility animal model.

5. A method for constructing a male sterile animal model, characterized in that: The animal model expresses a homozygous point mutant protein of the NAMPT gene, wherein the 39th amino acid of the homozygous point mutant protein is mutated from cysteine ​​to serine.

6. A method for constructing a male sterile animal model, characterized in that: The method comprises using the gRNA specifically targeting the NAMPT gene according to claim 1 and / or the CRISPR / Cas9 gene targeting system according to any one of claims 2-3.

7. The method according to claim 6, characterized in that The method comprises: microinjecting the CRISPR / Cas9 gene targeting system according to any one of claims 2 to 3 to obtain mutant DNA, transferring a fertilized egg containing the mutant DNA into a female animal, performing genotyping on the newborn animal, and obtaining a chimeric animal F0 generation; The mutant DNA sequence is TAGGTTACTCACTATAAACAATACCCACCAAATACAAGCAAAGTTTATTCATATTTTGAATCCCGTGAAAAGAAGACAGAAAACTCCAAAGTAAGG; The steps also include: hybridizing the chimera animal F0 generation with the wild-type animal to obtain the heterozygous animal F1 generation, backcrossing the F1 generation with the wild-type animal to obtain the heterozygous animal F2 generation, and self-pollinating the F2 generation to obtain the homozygous animal F3 generation, i.e., the male sterile animal model; The animals include mice, rats, guinea pigs, hamsters, rabbits, dogs, pigs, and monkeys; The animal is a mouse.

8. Use of the animal model obtained by the method according to any one of claims 5 to 7, characterized in that: The application includes any of the following: 1) Application in constructing disease models related to male sterility; 2) Application in the study of the pathogenesis of male infertility-related diseases; 3) Application in screening candidate drugs for male infertility-related diseases.

9. The use according to claim 8, characterized in that: The male infertility-related diseases include azoospermia, oligospermia, asthenozoospermia, asthenozoospermia and infertility with normal sperm count; The male infertility-related disease is asthenozoospermia.

10. A method for screening candidate drugs for male infertility-related diseases, the method comprising administering a drug to an animal model obtained by the method according to any one of claims 5 to 7 and / or cells derived from an animal model obtained by the method according to any one of claims 5 to 7, and if the drug can improve symptoms related to male infertility in the animal model or cells derived from the animal model, then the drug is a candidate drug for male infertility-related diseases.

Images