Phyllostachys pubescens PeTEM1 gene, its expressed protein and its application
By cloning the PeTEM1 gene of Moso bamboo and overexpressing it in Arabidopsis thaliana, the problems of regulating the flowering time and number of rosette leaves of Moso bamboo were solved, achieving the effects of delaying flowering and increasing the number of rosette leaves.
Patent Information
- Application Number
- CN202411684313.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-22
- Publication Date
- 2025-09-16
- Estimated Expiration
- 2044-11-22
AI Technical Summary
The flowering mechanism of moso bamboo is unclear, and existing technologies cannot effectively regulate the flowering time and number of rosette leaves of moso bamboo. In addition, the death of bamboo forests after flowering leads to production losses.
The PeTEM1 gene from Moso bamboo was cloned, an overexpression vector was constructed and transformed into Arabidopsis thaliana, resulting in transgenic Arabidopsis thaliana with delayed flowering time and increased rosette leaf number.
The flowering time of bamboo was successfully delayed, the number of rosette leaves was increased, and the expression levels of FT, SOC1 and GA3OX1 were downregulated to achieve the regulation of flowering time and rosette leaf number.
Smart Images

Figure CN119372214B_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of plant genetic engineering, and more specifically relates to a moso bamboo PeTEM1 gene, an expression protein and an application thereof. Background Art
[0002] Moso bamboo (Phyllostachys edulis), belonging to the subfamily Bambooideae of the Poaceae family, is widely distributed in southwest my country and boasts strong adaptability and rapid growth. The flowering time of bamboos differs significantly from that of other plants, typically taking decades to centuries to bloom; for example, Moso bamboo takes around 60 years to do so. After flowering, bamboo forests die, causing significant losses to production. Currently, the flowering mechanism of Moso bamboo remains unclear, so identifying the genes and mechanisms that regulate flowering in Moso bamboo is of great practical significance for variety improvement.
[0003] It is crucial for plants to flower and bear fruit at the right time for the continuation of the species. Plants have evolved different molecular mechanisms to regulate their flowering and fruiting at the appropriate time of the year. TEM1 is a transcriptional repressor involved in multiple flowering pathways. Under long-day conditions, CO activates the expression of FT, while TEM1 and TEM2 inhibit FT expression. Under short-day conditions, gibberellins accumulate and induce SOC1 and LFY to regulate flowering. TEM1 and TEM2 can regulate gibberellin accumulation by inhibiting GA3OX1 and GA3OX2, thereby affecting flowering. Although the function of the TEM1 gene has been reported in model plants, the function of the bamboo TEM1 gene is still unclear, especially its role in regulating flowering. Summary of the Invention
[0004] In response to the above-mentioned problems in the prior art, the present invention aims to provide a PeTEM1 gene from moso bamboo. Another technical problem to be solved by the present invention is to provide an expression protein of the PeTEM1 gene from moso bamboo. A further technical problem to be solved by the present invention is to provide the use of the PeTEM1 gene from moso bamboo in regulating the flowering time of plants. A further technical problem to be solved by the present invention is to provide the use of the PeTEM1 gene from moso bamboo in regulating the number of rosette leaves in plants. A further technical problem to be solved by the present invention is to provide the use of the PeTEM1 gene from moso bamboo in regulating the expression of downstream genes.
[0005] In order to solve the above technical problems, the technical solutions adopted by the present invention are as follows:
[0006] A PeTEM1 gene of moso bamboo, whose nucleotide sequence is shown as SEQ ID NO.1.
[0007] The amino acid sequence of the protein encoded by the PeTEM1 gene of Phyllostachys pubescens is shown in SEQ ID NO.2.
[0008] Vectors and recombinant bacteria containing the PeTEM1 gene from Moso bamboo.
[0009] Application of the bamboo PeTEM1 gene in regulating plant flowering time.
[0010] The method of regulating the flowering time of plants is to delay the flowering time of plants, including:
[0011] 1) Construction of an overexpression vector for the PeTEM1 gene of Phyllostachys pubescens;
[0012] 2) Transforming the constructed overexpression vector of the bamboo PeTEM1 gene into Arabidopsis thaliana;
[0013] 3) Cultivate, screen and obtain transgenic Arabidopsis lines with delayed flowering time.
[0014] Application of the PeTEM1 gene in regulating the number of rosette leaves in plants.
[0015] The regulating the number of rosette leaves of the plant is to promote an increase in the number of rosette leaves, comprising:
[0016] 1) Construction of an overexpression vector for the PeTEM1 gene of Phyllostachys pubescens;
[0017] 2) Transforming the constructed overexpression vector of the bamboo PeTEM1 gene into Arabidopsis thaliana;
[0018] 3) Cultivate, screen and obtain transgenic Arabidopsis thaliana with increased number of rosette leaves.
[0019] Application of the bamboo PeTEM1 gene in regulating the expression of downstream genes of the PeTEM1 gene.
[0020] Compared with the prior art, the present invention has the following beneficial effects:
[0021] The present invention discloses a bamboo PeTEM1 gene, whose nucleotide sequence is shown in SEQ ID NO.1, and the amino acid sequence of its expressed protein is shown in SEQ ID NO.2. The present invention constructs an overexpression vector for the bamboo PeTEM1 gene; transforms the constructed bamboo PeTEM1 gene overexpression vector into Arabidopsis thaliana; and cultivates, screens, and obtains transgenic Arabidopsis thaliana with delayed flowering time and / or increased number of rosette leaves. The results of the examples of the present application show that the strains overexpressing the PeTEM1 gene exhibit a significant late-flowering phenotype, with an increased number of rosette leaves and delayed flowering time; and the expression levels of the downstream regulatory genes FT, SOC1, and GA3OX1 are significantly downregulated. BRIEF DESCRIPTION OF THE DRAWINGS
[0022] Figure 1This is the electrophoresis diagram of PCR amplification of PeTEM1 gene in bamboo (lane 1 is DNA marker, lane 2 is PCR product of PeTEM1);
[0023] Figure 2 Figure 1 is a vector structure diagram of the expression vector pCAMBIA1302;
[0024] Figure 3 This is the subcellular localization map of PeTEM1 in bamboo (scale bar is 10 μm);
[0025] Figure 4 Figure 2 is the result of PCR identification of transgenic Arabidopsis thaliana (Control is the control plant, #1, 2, 3, 5, 6, 7, 8 are the overexpression lines pCAMBIA1302-PeTEM1-1, 2, 3, 5, 6, 7, 8 respectively);
[0026] Figure 5 Flowering phenotype (A), rosette leaf number (B), and flowering time (C) of transgenic Arabidopsis thaliana (Control is the control plant, #1 is the overexpression line pCAMBIA1302-PeTEM1-1, and #2 is the overexpression line pCAMBIA1302-PeTEM1-2);
[0027] Figure 6 Quantitative analysis of FT, SOC1 and GA3OX1 genes in transgenic Arabidopsis and control plants (Control is the control plant, #1 is the overexpression line pCAMBIA1302-PeTEM1-1, #2 is the overexpression line pCAMBIA1302-PeTEM1-2). DETAILED DESCRIPTION
[0028] To make the objects, technical solutions and advantages of the present invention clearer, the present invention is further described below in conjunction with specific examples. Unless otherwise specified in the following examples, the technical means used are conventional means well known to those skilled in the art. Molecular biology experimental methods not specifically described can be performed with reference to the methods listed in the book "Molecular Cloning Laboratory Manual" (3rd edition) by J. Sambrook or conventional methods in the art, or according to the kits and product instructions.
[0029] The plant materials used in this application are bamboo leaves, which were collected in Guangxi Zhuang Autonomous Region.
[0030] Example 1
[0031] 1. PeTEM1 gene cloning
[0032] Total RNA was extracted from bamboo leaves using a plant total RNA extraction kit (purchased from TIANGEN). Reverse transcription was performed using a reverse transcription kit (purchased from Vazyme) to obtain cDNA. Access the Moso bamboo genome database at http: / / gigadb.org / dataset / view / id / 100498 and, based on the PeTEM1 gene sequence, use Primer 5 software to design amplification primers with restriction sites. PCR amplification was performed using the Moso bamboo leaf cDNA as a template to obtain the PeTEM1 gene. The primer sequences are shown below:
[0033] Forward primer:
[0034] 5'-GAGAACACGGGGGACTCTAGAATGGACAGCACGAGCTGCCTCGTG GA-3',
[0035] Reverse primer:
[0036] 5'-GCCCTTGCTCACCATGGATCCCTCTACACTAGCGTATAGTGTCAGCT CT-3'.
[0037] The PCR reaction system was as follows: ddH2O 18 μL, 2×Super Pfx MasterMix (purchased from Vazyme) 25 μL, cDNA 2 μL, dNTP Mix 1 μL, Phanta Max Super-Fidelity DNA Polymerase 1 μL, and 2 μL each of upstream and downstream primers.
[0038] The PCR reaction program was as follows: pre-denaturation at 95°C for 30 seconds; denaturation at 95°C for 15 seconds, annealing at 59°C for 15 seconds, extension at 72°C for 1 minute 30 seconds, 35 cycles; and 72°C for 5 minutes.
[0039] The amplified product was subjected to 1% agarose gel electrophoresis and a single PCR band was detected ( Figure 1 After gel excision, the amplified fragments were recovered using a gel recovery kit (purchased from Beijing Kangwei Century Biotechnology Co., Ltd.) and sent to a biological company (Shanghai Sangon Biotechnology Co., Ltd.) for sequencing. The sequencing results showed that the nucleotide sequence of the PeTEM1 gene is shown in SEQ ID NO.1, and the amino acid sequence of the protein it encodes is shown in SEQ ID NO.2
[0040] 2. Construction of PeTEM1 gene overexpression vector
[0041] The pCAMBIA1302 vector (vector information is as follows) was double-digested with Xba I and Bam HI. Figure 2 shown).
[0042] The double enzyme digestion reaction system was as follows: 22 μL pCAMBIA1302 plasmid, 5 μL 10× Buffer, 2 μL Bam HI, 2 μL Xba I (purchased from Thermo Fisher Scientific), and 19 μL deionized water. Mix well on ice.
[0043] The double enzyme digestion reaction procedure is: enzyme digestion at 37℃ for 4 hours, followed by gel excision and recovery.
[0044] The linearized vector fragment after double enzyme digestion and the above gene amplification fragment were ligated at 37°C for 30 minutes using homologous recombinase (purchased from Vazyme).
[0045] The ligation reaction system was: 3 μL PeTEM1 amplified fragment, 1 μL linearized vector, 2 μL 5×CEⅡBuffer, 1 μL ExpressⅡ, and 3 μL deionized water.
[0046] After the ligation reaction, place the cells on ice immediately. After cooling, heat shock 10 μL of the ligation product into competent Escherichia coli DH5α cells (purchased from Shanghai Weidi Biotechnology Co., Ltd.). Single colonies were selected and shaken in LB liquid medium containing 50 mg / L kanamycin. After PCR analysis and sequencing verification, the recombinant plasmid pCAMBIA1302-PeTEM1 was obtained. The recombinant vector was transformed into Agrobacterium tumefaciens GV3101 cells (purchased from Shanghai Weidi Biotechnology Co., Ltd.) using the freeze-thaw method. The transformation product was plated onto solid LB medium containing 50 mg / L kanamycin and 50 mg / L rifampicin. Incubate at 28°C for 36 hours. Single colonies were selected and shaken in LB liquid medium containing 50 mg / L kanamycin and 50 mg / L rifampicin. After positive PCR analysis, the cells were retained for future use. E. coli and Agrobacterium transformation procedures were performed according to the manufacturer's instructions.
[0047] 3. Subcellular localization of PeTEM1
[0048] The Agrobacterium strain containing the recombinant plasmid pCAMBIA1302-PeTEM1 was inoculated into 50 ml LB liquid medium (containing 50 mg / L kanamycin and 50 mg / L rifampicin) and cultured at 28°C with shaking at 200 rpm for 24 hours until the OD value of the bacterial solution reached 0. 600 After the OD value reached 0.75, centrifuge at 4000 rpm for 15 minutes to collect the bacterial pellet. Resuspend the pellet in buffer (ddH2O 9 mL, 200 mM MES 500 μL, 200 mM MgCl2 500 μL, acetosyringone 30 μL) to an OD value of 600 The concentration of the bacterial suspension was 0.6, and the cells were placed in the dark for 5 hours. According to the tobacco transient expression technique, the bacterial suspension was injected into tobacco leaves and the fluorescence was observed using a confocal fluorescence microscope.
[0049] The results are as follows Figure 3 As shown, PeTEM1 is localized in the cell nucleus, indicating that PeTEM1 is a nuclear-localized protein.
[0050] Example 2
[0051] 1. Overexpression of the PeTEM1 gene in Arabidopsis
[0052] The preserved Agrobacterium strain containing the recombinant plasmid pCAMBIA1302-PeTEM1 was inoculated into 200 ml of LB liquid medium containing 50 mg / L kanamycin and 50 mg / L rifampicin at a volume ratio of 1:50 and cultured at 28°C at 200 rpm for 22 hours. The bacterial precipitate was collected by centrifugation at 5000 rpm for 12 minutes. The precipitate was vigorously resuspended in an equal volume of transformation solution (5 g sucrose, 20 μL surfactant, 100 mL ddH2O). The Arabidopsis inflorescence, after removing the opened flowers and siliques, was immersed in the resuspension for 8 minutes. After one day of dark incubation, the inflorescence was transferred to a climate chamber for normal culture. The seeds received after infection were sown on MS solid medium containing hygromycin. Leaves of positive seedlings that had grown true leaves were selected for total RNA extraction and cDNA synthesis using the same method as in Example 1. The quantitative primers (forward primer qPeTEM1-S: GAGCTACGTCCTCACCAAGGG, reverse primer qPeTEM1-A: GTCCACGCCGAAGAGCCT) were designed based on the PeTEM1 gene sequence. PCR was performed to detect PeTEM1 expression using the quantitative primers.
[0053] The results are as follows Figure 4 As shown, the target fragment was not detected in the control plants, but was detected in all seven positive seedlings, indicating that PeTEM1 was successfully introduced into Arabidopsis. Two transgenic lines (#1 and #2) with brighter target bands were selected and further self-pollinated, and quantitative analysis was performed using T3 seedlings.
[0054] 2. Phenotypic statistics and quantitative analysis of transgenic plants
[0055] T3 Arabidopsis plants of lines #1 and #2 were grown in a climate chamber under long-day conditions (16 hours of daylight and 8 hours of darkness). Twenty-four plants of each line were transplanted, and the number of rosette leaves and flowering time were counted.
[0056] The results are as follows Figure 5 As shown in the figure, compared with the control plants, the number of rosette leaves in the PeTEM1 overexpressing plants was significantly increased, the flowering time was significantly delayed, and they showed an obvious late-flowering phenotype.
[0057] Total RNA was extracted and cDNA was synthesized from positive T3 Arabidopsis seedlings using the same method as in Example 1. The AtActin gene was used as an internal reference gene. Quantitative primers for AtFT, AtSOC1, and AtGA3OX1 were designed and quantitative PCR was performed to detect their expression in transgenic plants.
[0058] qAtActin-S: 5'-TTGACAATTGATGCAAACAATGACG-3'
[0059] qAtActin-A: 5'-CCATTGCTTAATTCCACGGACAAAC-3'
[0060] qAtFT-S: 5'-AGTCCTAGCAACCCTCACCTCC-3'
[0061] qAtFT-A: 5'-CCTGCCAAGCTGTCGAAACA-3'
[0062] qAtSOC1-S: 5'-ATCGAGTCAGCACCAAACCG-3'
[0063] qAtSOC1-A: 5'-TTCCTATGCCTTCTCCCAAGAG-3'
[0064] qAtGA3OX1-S: 5'-ACAAGTGGACCCCTAAAGACGA-3'
[0065] qAtGA3OX1-A: 5'-TTGGACAGGTAGCCCGAAGA-3'
[0066] Quantitative PCR reaction system: 5 μL qPCR Master Mix (purchased from TOROIVD), 1 μL cDNA, 0.4 μL forward primer, 0.4 μL reverse primer, 3.2 μL deionized water.
[0067] The quantitative PCR reaction program was as follows: 95°C for 1 minute; 95°C for 10 seconds, 60°C for 30 seconds, for 40 cycles.
[0068] The results are as follows Figure 6 As shown in Figure 3, the expression levels of AtGA3OX1, AtSOC1, and AtFT were significantly downregulated in PeTEM1-overexpressing plants compared with control plants. These results suggest that PeTEM1 delays flowering by inhibiting the expression of GA3OX1, SOC1, and FT.
[0069] The above description is only illustrative of the present invention and not restrictive. Those skilled in the art will understand that many modifications, changes or equivalents may be made without departing from the spirit and scope defined by the appended claims, but all of them will fall within the scope of protection of the present invention.
Claims
1. A type of bamboo PeTEM1 The nucleotide sequence of the gene is shown in SEQ ID NO.
1.
2. The bamboo of claim 1 PeTEM1 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.
2.
3. Containing the bamboo described in claim 1 PeTEM1 Gene vectors and recombinant bacteria.
4. The bamboo of claim 1 PeTEM1 The application of a gene in regulating the flowering time of a plant is characterized in that: The regulating plant flowering time is to delay the plant flowering time; the plant is Arabidopsis thaliana.
5. The use according to claim 4, characterized in that include: 1) Construction of bamboo PeTEM1 Gene overexpression vectors; 2) The bamboo PeTEM1 The gene overexpression vector was transformed into Arabidopsis thaliana; 3) Cultivate, screen, and obtain transgenic Arabidopsis lines with delayed flowering time.
6. The bamboo of claim 1 PeTEM1 The use of a gene in regulating the number of rosette leaves in a plant is characterized in that: The regulating the number of rosette leaves of a plant is to promote the increase of the number of rosette leaves; the plant is Arabidopsis thaliana.
7. The use according to claim 6, characterized in that include: 1) Construction of bamboo PeTEM1 Gene overexpression vectors; 2) The bamboo PeTEM1 The gene overexpression vector was transformed into Arabidopsis thaliana; 3) Cultivate, screen, and obtain transgenic Arabidopsis thaliana with increased rosette leaf numbers.
Citation Information
Patent Citations
Plants with increased seed size
CN108012523A
Green bamboo PpSPL12 gene as well as expression protein and application thereof
CN118599865A