Application of overexpressed OsbZIP64 gene in efficient utilization of rice nitrogen

Abstract

The invention discloses application of an overexpressed OsbZIP64 gene in efficient utilization of rice nitrogen, and belongs to the technical field of molecular breeding. The invention discloses the effect of the OsbZIP64 gene in efficient utilization of rice nitrogen for the first time, regulation and control of the nitrogen nutrition utilization rate of rice can be realized by precisely regulating and controlling the expression level of the gene, and the nitrogen utilization rate, the maturing rate, the effective ear number, the single-plant yield and the dry weight of a plant are remarkably improved by overexpressing the OsbZIP64 gene of rice; the mutant OsbZIP64 gene can significantly reduce the nitrogen utilization rate, the maturing rate, the effective ear number, the single plant yield and the dry weight of the plant; the nitrogen fertilizer can promote the increase of the rice yield, can effectively relieve the environmental problem caused by excessive application of the nitrogen fertilizer, shows huge application potential in the agricultural field, especially in the aspect of cultivating crop varieties capable of efficiently absorbing and utilizing the nitrogen fertilizer, and is expected to lead the agricultural production to be more environment-friendly and efficient by wide application. Powerful scientific and technological support is provided for solving global grain safety problems and environmental protection challenges.

Description

Technical Field

[0001] The invention relates to the technical field of molecular breeding, and in particular to application of overexpressing OsbZIP64 gene in efficient nitrogen utilization of rice. Background Art

[0002] Rice (Oryza sativa L.), as one of the most important food crops in Asia and even the world, plays a vital role in ensuring world food security and meeting the growing population's demand for food. Nitrogen is the fertilizer with the largest amount used in the rice planting process and is crucial to increasing rice yields. my country's nitrogen fertilizer production and use currently ranks first in the world, and the current amount accounts for 38.3% of the global amount. However, with the excessive application of nitrogen fertilizer in farmland, the pollution of nitrogen fertilizer to the environment is becoming increasingly serious. Improving the nitrogen utilization efficiency of rice has become one of the important ways to achieve sustainable agricultural development and environmental protection. For the sustainable development of agriculture, it is necessary to explore a benign agricultural development path that is efficient, low-consumption, and takes into account both production and ecological benefits. Cultivating and utilizing rice varieties with high nitrogen utilization efficiency is one of the most effective ways to effectively utilize fertilizer resources and reduce environmental pollution.

[0003] Nitrogen plays an irreplaceable and important role in the growth of rice, directly affecting its growth, development, yield and quality, as well as its ability to adapt to adverse environmental conditions. Rice nitrogen utilization includes processes such as nitrogen absorption, transport, assimilation and reuse, involving the participation and regulation of multiple genes and multiple pathways. Nitrogen fertilizer exists in the soil in the form of nitrate nitrogen and ammonium nitrogen. The rice root system uses NO 3 -Transporter and NH 4 + Transport proteins regulate the absorption and transport of nitrate nitrogen and ammonium nitrogen, and nitrogen assimilation is achieved through nitrate reductase, nitrite reductase, glutamine synthetase and glutamate synthetase. In the aboveground part of the plant, the transport and distribution of nitrogen are regulated by nitrogen transport proteins, amino acid transport proteins, etc.

[0004] Plants have abundant nitrogen transport genes, which can absorb and redistribute nitrogen nutrition from the soil to meet the nitrogen needs of crops in various stages of growth, development and reproduction. Among them, transcription factors play a key role in regulating the nitrogen use efficiency of plants. These transcription factors affect the physiological and molecular responses of plants when nitrogen supply is insufficient or sufficient by regulating the expression of related genes, thereby regulating the absorption, transportation, distribution and utilization efficiency of nitrogen. In Arabidopsis thaliana, several bZIP transcription factors have been found to play an important role in the regulation of nitrogen use efficiency. Among them, an important transcription factor is AlatbZIP1. It achieves these functions by regulating the expression of a series of genes related to nitrogen metabolism, including nitrogen absorption, transportation, distribution and the regulation of key enzymes in nitrogen metabolic pathways. Future research needs to further reveal the specific roles and interaction mechanisms of different transcription factors in the nitrogen regulatory network to provide theoretical and technical support for the development of rice varieties with efficient nitrogen utilization. Summary of the invention

[0005] The purpose of the present invention is to provide an application of overexpressing the OsbZIP64 gene in rice nitrogen efficient utilization, so as to provide a new candidate gene for developing rice varieties with nitrogen efficient utilization.

[0006] To achieve the above object, the present invention provides the effect of overexpressing the OsbZIP64 gene on efficient nitrogen utilization in rice, wherein the nucleotide sequence of the OsbZIP64 gene can be selected from 1) the DNA sequence shown in SEQ ID NO.3, or 2) a nucleotide sequence that can hybridize with the DNA sequence shown in SEQ ID NO.3 under highly stringent conditions.

[0007] The protein sequence of the OsbZIP64 gene is as follows (a) or (b) or (c):

[0008] (a) a protein consisting of the amino acid sequence shown in SEQ ID NO.4;

[0009] (b) a protein derived from (a) in which one or more amino acid residues of the amino acid sequence shown in SEQ ID NO. 4 are substituted, deleted and / or added and which has the same activity as (a);

[0010] (c) A protein encoded by another gene having more than 50% amino acid identity with the protein consisting of the amino acid sequence shown in SEQ ID NO. 4 and having the same activity as (a).

[0011] Preferably, overexpression of the rice OsbZIP64 gene improves nitrogen utilization efficiency of the plant.

[0012] As described above, the use of overexpressing the OsbZIP64 gene in increasing rice yield, overexpressing the rice OsbZIP64 gene increases the rice fruit setting rate, effective panicle number, single plant yield or dry weight.

[0013] The invention relates to an application of a recombinant vector comprising the above-mentioned OsbZIP64 gene overexpression gene in improving nitrogen utilization efficiency and yield of rice, wherein the recombinant vector is an overexpression vector.

[0014] An expression vector comprising the nitrogen efficient utilization gene OsbZIP64; a transgenic cell line comprising the nitrogen efficient utilization gene OsbZIP64; a host cell comprising the nitrogen efficient utilization gene OsbZIP64, wherein the host cell is a microbial cell, for example, a fungal cell or a bacterial cell, for example, but not limited to, Agrobacterium, yeast, Escherichia coli, etc.

[0015] The host cell containing the above OsbZIP64 gene recombinant vector is used to improve the nitrogen utilization rate and yield of rice. The host cell is a microbial cell, preferably an Escherichia coli cell or an Agrobacterium cell.

[0016] The OsbZIP64 gene or its active fragment or a recombinant expression vector containing the OsbZIP64 gene can be introduced into plant cells by conventional transformation or transfection techniques to obtain transgenic plant cells, and further obtain transgenic plants that overexpress the OsbZIP64 gene or its active fragment.

[0017] Those skilled in the art should understand that obtaining plants overexpressing the OsbZIP64 gene can be achieved through transgenic technology, for example, through Agrobacterium-mediated transfection, plasmid transformation, direct DNA transformation, microinjection and other technologies.

[0018] Rice plants overexpressing the above OsbZIP64 gene.

[0019] As mentioned above, the OsbZIP64 gene is used in the breeding of rice varieties with high nitrogen utilization efficiency.

[0020] A method for cultivating plants with high nitrogen utilization efficiency, the method comprising: introducing the nitrogen efficient utilization gene OsbZIP64 or its active fragment into plant cells, thereby obtaining transgenic plants with enhanced nitrogen utilization efficiency, or obtaining offspring plants overexpressing the nitrogen efficient utilization gene OsbZIP64 or its active fragment by hybridization. In one embodiment of the present invention, the plants include, but are not limited to, rice, Arabidopsis, wheat, corn, cotton, rapeseed or soybean, preferably rice. In one embodiment of the present invention, the nitrogen efficient utilization gene OsbZIP64 is overexpressed in plants and plants with high nitrogen utilization efficiency are further obtained. The specific transformation and selection methods in the method can be carried out according to various methods known in the art. In one embodiment of the present invention, the method can be carried out with reference to the process described in the examples and appropriately modified according to different plants.

[0021] Preferably, the method further comprises the step of codon-optimizing the gene according to the codon usage of the plant before introducing the gene into the plant cell.

[0022] Provided is a method for cultivating plants with improved nitrogen utilization efficiency, the method comprising: introducing an isolated nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO.4 or an active fragment thereof into plant cells to obtain transgenic plant cells, producing a transgenic plant expressing the isolated nucleotide sequence or the active fragment thereof from the transgenic plant cells, and compared with a control plant not introduced with the isolated nucleotide sequence or the active fragment thereof, the transgenic plant has improved nitrogen utilization efficiency.

[0023] In another embodiment, the nitrogen efficient utilization gene OsbZIP64 is introduced into the offspring plants by hybridization.

[0024] For example, a plant containing an isolated nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO.4 or an active fragment thereof is hybridized with another plant to obtain offspring plants, and stably homozygous hybrid plants containing the nucleotide sequence or an active fragment thereof are screened out. Compared with unhybridized plants, the obtained hybrid offspring plants have improved nitrogen utilization efficiency.

[0025] Those skilled in the art will appreciate that the above method further comprises the step of codon-optimizing the isolated nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO. 4 according to the codon usage of the plant before introducing it into the plant cell.

[0026] The breeding method of the present invention can be used for the breeding of rice, corn, wheat, cotton, rape, soybean, forage or Arabidopsis, preferably for rice breeding. Using this method, plant varieties with improved nitrogen utilization efficiency can be obtained. The principle of breeding is to overexpress the OsbZIP64 gene in the plant, specifically, it can be achieved by overexpressing the isolated nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO.4 or its active fragment in the plant. The transgenic plant or hybrid offspring plant obtained by the breeding method has a growth advantage under low nitrogen and / or high nitrogen growth conditions. In the present invention, the normal nitrogen application amount is generally 150KG nitrogen / hectare, and "low nitrogen growth conditions" generally refers to the application of 0.1-0.5 times the normal nitrogen application amount of nitrogen fertilizer, and "high nitrogen growth conditions" generally refers to the application of 1.5-2.0 times the normal nitrogen application amount of nitrogen fertilizer.

[0027] When used to cultivate rice with improved nitrogen utilization efficiency, the cultivation method comprises: introducing an isolated nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO.4 or an active fragment thereof into rice cells to obtain transgenic rice cells, producing transgenic rice plants expressing the isolated nucleotide sequence or the active fragment thereof from the transgenic rice cells, and the transgenic rice has improved nitrogen utilization efficiency compared with control rice without the isolated nucleotide sequence or the active fragment thereof introduced; or the method comprises: hybridizing a rice plant containing the isolated nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO.4 or the active fragment thereof with another rice plant to obtain offspring rice plants, screening out stably homozygous hybrid plants containing the nucleotide sequence or the active fragment thereof, and the obtained hybrid offspring plants have improved nitrogen utilization efficiency compared with unhybridized rice plants.

[0028] In addition, the present invention introduces the isolated nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO.4 or its active fragment into the mutant nlp7-1 cell of the model plant Arabidopsis thaliana with low nitrogen utilization efficiency to obtain transgenic Arabidopsis cells, and the transgenic Arabidopsis thaliana cells produce transgenic Arabidopsis thaliana plants expressing the isolated nucleotide sequence or its active fragment, and the transgenic Arabidopsis thaliana has improved nitrogen utilization efficiency compared with the control Arabidopsis thaliana not introduced with the isolated nucleotide sequence or its active fragment. This result shows that the function of the gene provided by the present invention is conservative in the model plant, which provides strong evidence for the gene in the breeding of different crops.

[0029] In general, the nitrogen efficient utilization gene provided by the present invention is named 0sbZIP64, is derived from rice, and is one of the following nucleotide sequences:

[0030] 1) a nucleotide sequence encoding the polypeptide shown in SEQ ID NO.4;

[0031] 2) DNA sequence of SEQ ID NO.3;

[0032] 3) A nucleotide sequence that can hybridize with the DNA sequence defined in SEQ ID NO. 3 under highly stringent conditions.

[0033] The so-called high stringency conditions are hybridization and membrane washing at 65°C in a solution of 0.1×SSPE (or 0.1×SSC) and 0.1% SDS.

[0034] SEQ ID NO.3 consists of 1254 bases, and its coding sequence starts from the first base at the 5′ end and encodes the amino acid sequence shown in SEQ ID NO.4.

[0035] The expression vector, transgenic cell line and host bacteria containing the nitrogen efficient utilization gene of the present invention are also within the protection scope of the present invention.

[0036] Primer pairs for amplifying any fragment of OsbZIP64 are also within the scope of protection of the present invention.

[0037] By using a plant expression vector, the nitrogen efficient utilization gene of the present invention is introduced into plant cells to obtain transgenic cell lines and transgenic plants with enhanced nitrogen utilization efficiency.

[0038] The plant expression vector includes a binary Agrobacterium vector and a vector that can be used for plant microprojectile bombardment. The plant expression vector may also include the 3′ non-translated region of the foreign gene, i.e., a polyadenylic acid signal and any other DNA fragment that can participate in mRNA processing or gene expression. The polyadenylic acid signal can guide the addition of polyadenylic acid to the 3′ end of the mRNA precursor, such as the Agrobacterium crown gall induction (Ti) plasmid gene (such as the rouge synthase NOS gene) and the 3′ non-translated region of the plant gene (such as the soybean storage protein gene) have similar functions.

[0039] When OsbZIP64 is used to construct a plant expression vector, any enhanced promoter or inducible promoter can be added before its transcription initiation nucleotide, such as cauliflower mosaic virus (CAMV) 35S promoter, root specific expression promoter, etc., which can be used alone or in combination with other plant promoters; in addition, when the gene of the present invention is used to construct a plant expression vector, enhancers can also be used, including translation enhancers or transcription enhancers. These enhancer regions can be ATG start codons or adjacent region start codons, etc., but must be the same as the reading frame of the coding sequence to ensure the correct translation of the entire sequence. The sources of the translation control signal and the start codon are extensive and can be natural or synthetic. The translation initiation region can come from the transcription initiation region or the structural gene.

[0040] In order to facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be processed, such as adding genes that can be expressed in plants and encode enzymes or luminescent compounds that can produce color changes (GUS gene, luciferase gene, etc.), antibiotic markers with resistance (gentamicin marker, kanamycin marker, etc.) or chemical agent resistance marker genes (such as herbicide Bar gene), etc. Considering the safety of transgenic plants, no selective marker genes can be added, and transformed plants can be directly screened by adversity.

[0041] The plant expression vector carrying OsbZIP64 of the present invention can be transformed into plant cells or tissues by conventional biological methods such as Ti plasmid, Ri plasmid, plant virus vector, direct DNA transformation, microinjection, electroporation, Agrobacterium-mediated, etc., and the transformed plant cells or tissues can be cultivated into plants. The transformed plant host can be monocotyledonous plants such as rice, corn, wheat, etc., or dicotyledonous plants such as Arabidopsis, soybean, rapeseed, cotton, etc.

[0042] Through the growth experiment of the transgenic rice obtained after the transformation of OsbZIP64 gene in nutrient solution with different nitrogen levels and field experiment, it is proved that the gene can significantly improve the nitrogen utilization efficiency of the plant and increase the biomass of the plant after being transferred into the plant; through the growth experiment of the transgenic Arabidopsis obtained after the transformation of OsbZIP64 gene in culture medium with different nitrogen levels, it is proved that the function of the gene in the model plant is conservative. The present invention provides a basis for artificially enhancing the nitrogen utilization efficiency of plants, and will play an important role in cultivating plants (especially crops such as rice, corn, wheat, rapeseed, soybean, cotton, etc.) that efficiently utilize nitrogen nutrition.

[0043] Therefore, the application of the overexpressed OsbZIP64 gene in rice nitrogen efficient utilization provided by the present invention has the following specific technical effects:

[0044] (1) The present invention discloses for the first time the role of the OsbZIP64 gene in the efficient nitrogen utilization of rice. Overexpression of the rice OsbZIP64 gene significantly improves the nitrogen utilization rate of the plant, while mutation of the OsbZIP64 gene significantly reduces the nitrogen utilization rate of the plant.

[0045] (2) Overexpression of the rice OsbZIP64 gene significantly increased the rice seed setting rate, number of effective panicles, yield per plant, and dry weight; mutation of the OsbZIP64 gene significantly reduced the rice seed setting rate, number of effective panicles, yield per plant, and dry weight;

[0046] (3) The mutation and / or overexpression of the OsbZIP64 gene resulted in normal plant development. The expression level of this gene can be precisely regulated to achieve regulation of the nitrogen utilization rate of rice, which can not only increase rice yield but also effectively alleviate environmental problems caused by excessive nitrogen fertilizer application. It has great application potential in the agricultural field, especially in the breeding of crop varieties that can efficiently absorb and utilize nitrogen fertilizer, such as rice, corn, wheat, soybean, cotton, rapeseed and other key crops. Its widespread application is expected to lead to more environmentally friendly and efficient agricultural production, and provide strong scientific and technological support for solving global food security issues and environmental protection challenges.

[0047] The technical solution of the present invention is further described in detail below through the accompanying drawings and embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings required for use in the description of the embodiments of the present invention will be briefly introduced below. Obviously, the accompanying drawings in the following description are only some embodiments of the present invention. For ordinary technicians in this field, other accompanying drawings can be obtained based on these accompanying drawings without paying creative labor.

[0049] Figure 1 is the subcellular localization result of the OsbZIP64 gene in Example 1 of the present invention; wherein A is the GFP green fluorescent protein of the control group, B is the red fluorescence observation result of the control group, C is the protoplast state of the control group under bright field, D is the cell state of the control group under bright field, E is the GFP green fluorescent protein of OsbZIP64, F is the red fluorescence observation result of OsbZIP64, G is the protoplast state of OsbZIP64 under bright field, H is the cell state of OsbZIP64 under bright field,

[0050] Figure 2 is the physical map of the recombinant expression vector pEGOEP-OsbZIP64 constructed in Example 2 of the present invention;

[0051] Figure 3 is the relative expression result of the transgenic positive plants and the WT plants in Example 2 of the present invention;

[0052] Figure 4 It is a physical map and target location information map of the pYLCRISPRbZIP64-gRNA recombinant expression vector obtained in Example 3 of the present invention;

[0053] Figure 5 is the sequencing result information at the mutation site of the OsbZIP64 gene of the transgenic positive plant in Example 3 of the present invention;

[0054] Figure 6The nitrogen absorption rate of the WT, OsbZIP64 gene overexpression lines (OE-1, OE-2), and mutant lines (KO-1, KO-2, and KO-3) in the seedling stage is measured in Example 4 of the present invention, wherein WT represents wild-type rice;

[0055] Figure 7 These are the results of investigating the fruit setting rate (A), effective ear number (B), yield per plant (C), and dry weight (D) of WT, OsbZIP64 gene overexpression lines (OE-1, OE-2), and mutant lines (KO-1, KO-2, and KO-3) under normal conditions in the field in Example 4 of the present invention, wherein LN represents low nitrogen conditions, HN represents high nitrogen conditions, and * represents the significant difference P value between groups (* represents P≤0.05; ** represents P≤0.01; *** represents P≤0.001; **** represents P≤0.0001). DETAILED DESCRIPTION

[0056] The technical solution of the present invention is further described below through the accompanying drawings and embodiments.

[0057] In order to make the purpose, technical scheme and advantages of the present application clearer, more thorough and more complete, the technical scheme of the present invention is clearly and completely described below through the accompanying drawings and examples. The following detailed descriptions are all descriptions of the embodiments, and are intended to provide further detailed descriptions of the present invention. Unless otherwise specified, all technical terms used in the present invention have the same meaning as those generally understood by those skilled in the art to which the present application belongs.

[0058] The methods used in the following examples are all conventional methods in the art unless otherwise specified, and the instruments, equipment, reagents and materials used are all commercially available instruments, equipment, reagents and materials unless otherwise specified.

[0059] Embodiment 1

[0060] Obtaining the cDNA sequence of OsbZIP64 gene

[0061] (1) Total RNA was extracted from leaves of 7-day-old Dongnong 427 rice seedlings using TRIzol reagent (Invitrogen, Carlsbad, CA). 1 μg of total RNA was used to reverse transcribe the cDNA of the OsbZIP64 gene using a reverse transcription kit produced by Hangzhou Xinjing Biological Reagent Development Co., Ltd. according to the product instructions.

[0062] The obtained cDNA was used as a template to amplify the cDNA sequence of the OsbZIP64 gene by RT-PCR with the upstream primer shown in SEQ ID NO.1 and the downstream primer shown in SEQ ID NO.2. The amplification system was: 0.8 μL FastPfu polymerase (Beijing Quanshijin Biotechnology Co., Ltd.), 0.5 μL cDNA, 10 μL 5×PCR buffer, 100 μM dNTPs, 25 μM each of the upstream and downstream primers, and then the reaction system was supplemented to 50 μL with double distilled water. The PCR program was: first 95°C, 1 min, then 58°C, 30 s, and finally 72°C, 1 min, for a total of 40 cycles.

[0063] SEQ ID NO.1:AAGTGGTGTTTGCCCTTTGGACCTC

[0064] SEQ ID NO.2:GAGGTCCAAAGGGCAAACACCACTT

[0065] After the reaction, the PCR product was subjected to agarose gel electrophoresis and then recovered using a gel recovery kit. The recovered product was sent to the company for sequencing to obtain the CDS sequence of the OsbZIP64 gene (nucleotide sequence of the PCR amplification product) as shown in SEQ ID NO.3. The protein sequence encoded by the amplified product was analyzed as shown in SEQ ID NO.4, which consists of 417 amino acid residues.

[0066] SEQ ID NO.3:

[0067]

[0069] SEQ ID NO.4:

[0070]

[0071]

[0072] (2) Subcellular localization of OsbZIP64 gene: pEGOEP empty vector was digested with ECORI, pEGOEP vector fragment was recovered by gel, and then homologous recombination was performed to connect the target gene to the vector, and then transformation was performed, single plaque was picked, and sequencing was performed; its subcellular localization was determined by transfecting rice protoplasts, and the fluorescence signal was observed by laser confocal microscopy. The results are as follows: Figure 1 As shown, the green fluorescence signal of the control group sample transformed with the empty vector exists in the rice protoplasts, while the green fluorescence signal of the OsbZIP64 fusion protein appears in the nuclear region of the protoplasts, indicating that the protein encoded by the OsbZIP64 gene is localized in the nucleus.

[0073] Embodiment 2

[0074] Construction of OsbZIP64 gene overexpression vector and acquisition of transgenic positive plants

[0075] (1) Using the primer sequences shown in SEQ ID NO.5 and SEQ ID NO.6, PCR was performed using the CDS fragment obtained in Example 1 as a template. The reaction system was 25 μL of 2×PCR buffer, 10 μL of 2 mM dNTPs, 1 μL of each upstream and downstream primer, 1 μL of KOD-FX, 1 μL of template, and ddH 2 The PCR reaction conditions were: 98°C for 3 min, 98°C for 10 sec, 68°C for 2 min, 32 cycles, and 68°C for 4 min.

[0076] SEQ ID NO.5:

[0077] ACTAGGGTCTCGCACCAAGGTACATGACCTCGGCGGCGCCGGCGGCCGCGCAGTT

[0078] SEQ ID NO.6:

[0079] ACTAGGGTCTCTCGCCCGCCGGCTCGCGCGGGCGCGCCGCCCAGAGCGA

[0080] The PCR product was subjected to agarose gel electrophoresis, and a gel recovery kit was used to recover the electrophoresis fragment of 1251 bp. The enzyme digestion-ligation reaction system was constructed with the components shown in Table 1. The enzyme digestion-ligation reaction conditions were: 37°C for 5 min, 20°C for 5 min.

[0081] Table 1

[0082] Reagents Addition amount 10×CutSmart Buffer 1.5μl 10mM ATP 1.5μl pEGOEO empty vector 100ng Glue recovery target fragment 50ng Bsa I-HF 10U T4 DNA ligase 35U <![CDATA[H 2 The]]> Final volume 15 μl

[0083] (2) Take a tube of 100 μL DH5a E. coli competent cells and mix with 5 μL of the obtained ligation product, and place on ice for 30 minutes. Then quickly place in a 42°C constant temperature water bath, heat shock for 90 seconds, and add 500 μL LB liquid culture medium after ice bath for 2 minutes, and mix well. Incubate at 37°C and 200 rpm for 45 minutes to allow the cells to return to normal growth. Spread the bacterial solution evenly on the Kana-resistant LB solid culture medium plate, and after 30 minutes, place in a 37°C constant temperature incubator and culture overnight.

[0084] Using the primers shown in SEQ ID NO.7 and SEQ ID NO.8, single colonies were picked for colony PCR detection. The PCR system was: 2×Taq Mix 10μL, primers 0.5μL each, ddH 2 O to 20μL. The PCR reaction program is: 95℃5min; 95℃30sec, 55℃30sec, 72℃2min, 25 cycles; 72℃5min. The band size is about 1400bp. The positive plaques detected are picked and shaken.

[0085] SEQ ID NO.7:CACGGGGGACTCTTGCCACC

[0086] SEQ ID NO.8:GACACGCTGAACTTGTGG

[0087] The plasmid was extracted using a plasmid extraction kit and sent to the company for sequencing. The plasmid with the correct sequencing was the recombinant expression vector pEGOEO-OsbZIP64. The physical map is as follows: Figure 2 shown.

[0088] (3) The recombinant expression vector pEGOEO-OsbZIP64 constructed above was introduced into the wild type Dongnong 427 variety using the genetic transformation method mediated by Agrobacterium EHA105 (for details, refer to Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA, 1994, Plant Journal 16: 271-282).

[0089] When the transgenic plants grow up, leaves are cut to extract DNA, and the obtained DNA is used as a template for PCR to screen out positive plants with the OsbZIP64 gene transferred in. Individual plants are harvested until transgenic positive homozygous plants are detected in the T2 generation.

[0090] The transgenic positive homozygous strains germinated on MS medium (formula shown in Table 2) were used to identify the expression of the OsbZIP64 gene in each strain by qRT-PCR. The expression of OsbZIP64 in the wild type and overexpression strains was also detected. The specific operation is as follows: Take the 7-day-old seedlings of the OsbZIP64 overexpression strain and the wild type, extract total RNA according to the method in step 1, reverse transcribe to obtain cDNA, use the cDNA as a template, use the ACTIN1 gene as an internal reference (the upstream primer for amplifying the ACTIN1 gene is shown in SEQ ID NO.9, and the downstream primer sequence is shown in SEQ ID NO.10), and use the primers shown in SEQ ID NO.11 and SEQ ID NO.12, and use the Q-PCR kit (Takara Premix ExTaqT MII) produced by Dalian Bao Bioengineering Co., Ltd. for qRT-PCR. qRT-PCR system: 10μM LP 0.25μL, 10μM RP 0.25μL, cDNA 0.3μL, ddH 2 O 4.2μL, SYBR Green reagent 5μL. qRT-PCR program: 95℃, 1min; 95℃, 5s; 60℃, 30s, 40 cycles.

[0091] SEQ ID NO.9: TGGTCGTACCACAGGTATTGTGTT

[0092] SEQ ID NO.10:AAGGTCGAGACGAAGGATAGCAT

[0093] SEQ ID NO.11:ATGACCTCGGCGGCGCCGGCGGCCG

[0094] SEQ ID NO.12:CGGCCGCCGGCGCCGCCGAGGTCAT

[0095] Two strains were selected from the constructed rice strains overexpressing the OsbZIP64 gene, named OE-1 and OE-2, for subsequent experiments. The relative expression levels of OE-1, OE-2 and WT plants are shown in Figure 3 shown.

[0096] Table 2 MS culture medium formula (1L):

[0097] 10× macroelements (MSmax) 100mL 100× trace elements (MSmin) 10mL Iron salt 10mL sucrose 100g water Make up to 1L

[0098] Embodiment 3

[0099] Construction of OsbZIP64 gene CRISPR-cas9 expression vector and acquisition of transgenic positive plants

[0100] (1) According to the Golden Gate cloning method, the gRNA expression cassette with one target site was connected to the pYLCRI SPR / Cas9Pubi-H vector backbone. The constructed vector is the pYLCRISPRbZIP64-gRNA recombinant expression vector (physical map and target site location information are shown in Figure 4 ).

[0101] (2) Obtaining and identifying OsbZIP64 gene CRISPR-cas9 transgenic plants

[0102] The pYLCRISPRbZIP64-gRNA recombinant expression vector obtained in step (1) was introduced into the wild-type Dongnong 427 rice variety using the Agrobacterium EHA105-mediated genetic transformation method (for specific steps, see Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA, 1994, Plant Journal 6: 271-282).

[0103] When the transgenic plants grow up, the leaves are cut to extract DNA, and PCR is performed using the primers shown in SEQ ID NO.13 and SEQ ID NO.14. The PCR products are sent to the company for sequencing, and the positive plants with effective mutations in the OsbZIP64 gene are screened out, and the individual plants are harvested until homozygous plants are detected in the T2 generation. Three of the multiple OsbZIP64 gene mutant strains obtained are selected for subsequent experiments. The selected three OsbZIP64 gene mutant strains are named KO-1, KO-2 and KO-3, respectively. The sequencing results of the three strains are shown in Figure 5 As shown, the OsbZIP64 gene of the KO-1 strain had a 1-base deletion at the target site, the OsbZIP64 gene of the KO-2 strain had a 2-base insertion at the target site, and the OsbZ IP64 gene of the KO-3 strain had a 3-base deletion at the target site.

[0104] Embodiment 4

[0105] Evaluation of nitrogen nutrient utilization efficiency of transgenic positive strains obtained in Examples 2 and 3

[0106] 1. Nitrogen absorption rate of WT, overexpression strains, and mutant strains at the seedling stage

[0107] Each strain was grown in the field under normal conditions until the seedling stage, and the nitrogen absorption rate of each strain was measured. Figure 6As shown, the nitrogen absorption rate of the shoots and roots of the overexpression lines at the seedling stage was significantly higher than that of the wild type, while the nitrogen absorption rate of the shoots and roots of the KO-1, KO-2 and KO-3 lines was significantly reduced compared with the wild type.

[0108] 2. Growth status of WT, overexpression strains, and mutant strains under normal field conditions

[0109] Each strain was grown in the field under normal conditions for 3 months. The growth status of each strain was observed, photographed and the fruit set rate, number of effective ears, yield per plant and dry weight of each strain were counted. The statistical results are as follows: Figure 7 As shown, the fruit setting rate of the overexpression strain increased compared with the wild type, but not significantly, the number of effective panicles increased significantly, the yield increased significantly, and the dry weight increased significantly; while the fruit setting rate of the KO-1, KO-2 and KO-3 strains decreased compared with the wild type, the decrease was not obvious, but the number of effective panicles decreased significantly, the yield decreased significantly, and the dry weight decreased significantly; the above data show that rice overexpressing the OsbZIP64 gene has obvious advantages in field growth, suggesting that this gene will be a gene with broad application prospects. Through this gene, the nitrogen utilization efficiency of crops can be improved, thereby increasing crop biomass and yield and reducing environmental pollution.

[0110] Therefore, the present invention discloses for the first time the role of OsbZIP64 gene in efficient nitrogen utilization of rice. Overexpression of rice OsbZIP64 gene significantly improves nitrogen utilization rate of plants, while mutation of OsbZIP64 gene significantly reduces nitrogen utilization rate of plants. Overexpression of rice OsbZIP64 gene significantly improves rice fruit setting rate, number of effective panicles, yield per plant, and dry weight. Mutation of OsbZIP64 gene significantly reduces rice fruit setting rate, number of effective panicles, yield per plant, and dry weight. Mutation and / or overexpression of OsbZIP64 gene leads to normal plant development. The expression level of this gene can be precisely regulated to achieve regulation of nitrogen nutrition utilization in rice, which can not only promote the increase of rice yield, but also effectively alleviate the environmental problems caused by excessive application of nitrogen fertilizer. It shows great application potential in the agricultural field, especially in the breeding of crop varieties that can efficiently absorb and utilize nitrogen fertilizers, such as key crops such as rice, corn, wheat, soybeans, cotton and rapeseed. Its wide application is expected to lead agricultural production to be more environmentally friendly and efficient, and provide strong scientific and technological support for solving global food security issues and environmental protection challenges.

[0111] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that they can still modify or replace the technical solution of the present invention with equivalents, and these modifications or equivalent replacements cannot cause the modified technical solution to deviate from the spirit and scope of the technical solution of the present invention.

Claims

1. The effect of overexpression of OsbZIP64 gene on efficient nitrogen utilization in rice, characterized by: The nucleotide sequence of the OsbZIP64 gene is shown in SEQ ID NO.3, and the protein sequence is shown in SEQ ID NO.

4.

2. The use of the overexpression of the OsbZIP64 gene in increasing rice yield as claimed in claim 1, characterized in that: Overexpression of rice OsbZIP64 gene increases rice seed setting rate, effective panicle number, yield per plant or dry weight.

3. Use of a recombinant vector comprising the OsbZIP64 gene according to claim 1 in improving nitrogen utilization efficiency and yield of rice, characterized in that: The recombinant vector is an overexpression vector.

4. Use of a host cell comprising the OsbZIP64 gene recombinant vector according to claim 3 in improving nitrogen utilization efficiency and yield of rice, characterized in that: The host cell is an Escherichia coli cell or an Agrobacterium cell.

5. Use of the OsbZIP64 gene as claimed in claim 1 in breeding rice varieties with high nitrogen utilization efficiency.

6. A method for cultivating plants with high nitrogen utilization efficiency, characterized in that: The method comprises: introducing the gene or active fragment thereof according to claim 1 or the recombinant expression vector according to claim 4 into plant cells to obtain transgenic plants, or hybridizing a plant comprising the gene or active fragment thereof according to claim 1 with another plant.

Images