Application of genetic marker associated with chest breadth character in RNASEH2B gene in genetic breeding of chicken

Abstract

The invention provides an application of a genetic marker associated with a chest width character in an RNASEH2B gene in chicken genetic breeding, and belongs to the technical field of chicken genetic breeding and biology.The genetic marker associated with the chest width character in the RNASEH2B gene comprises CBmark er1, the CBmark er1 corresponds to the 169817100th site of the physical position of a first chromosome of chicken reference genome bGa < 1 >. Mat.broi ler.GRCg7b version sequence information published in NCBI, and the CBmark er1 corresponds to the 169817100th site of the physical position of a second chromosome of the chicken reference genome bGa < 1 >. Mat.broi ler.GRCg7b version sequence information. The nucleotide sequence belongs to the ninth intron sequence of the gene RNASEH2B, and the basic group in the ninth intron sequence is G or A; the CBmarker1 contributes to heredity improvement of the chest breadth, and when the CBmarker1 is applied to genetic breeding of chickens, improvement of the chest breadth is facilitated, and a high-quality laying hen variety is obtained.

Description

Technical Field

[0001] The invention belongs to the field of chicken genetic breeding and biotechnology, and particularly relates to the application of a genetic marker associated with a chest width trait in an RNASEH2B gene in chicken genetic breeding. Background Art

[0002] Chest width is a commonly used indicator for broiler breeding. A large chest width means an increase in the attachment area of ​​the breast muscles, which also means an increase in the weight of the breast muscles. In order to meet the market demand for old hens with large chest width, it is urgent to conduct research on the genetic structure of chest width in order to cultivate high-quality old hens for production of suitable varieties. Chest width is a quantitative trait that is affected by both genetics and the environment. In recent years, the GWAS method has been extended to the genetic analysis of quantitative traits in poultry, mainly used for the study of egg production, body weight, feed utilization efficiency and egg quality. There is no research literature that uses the GWAS method to analyze the genetic laws of breast width in laying hens. The chest width trait is regulated by micro-effect polygenes, and conventional breeding methods are difficult to make effective progress genetically. The only way is to clarify the genetic structure of chest width and improve its breeding accuracy through genomic selection to obtain new chicken breeds or matching lines that can produce large chest widths to meet consumer demand. Summary of the invention

[0003] In order to obtain old hens with excellent chest width trait, the present invention provides the application of genetic markers associated with the chest width trait in RNASEH2B gene in chicken genetic breeding. The genetic markers associated with the chest width trait in the RNASEH2B gene help to genetically improve the chest width. Applying them to chicken genetic breeding is beneficial to improving the chest width and obtaining high-quality laying hen varieties.

[0004] The present invention is achieved through the following technical solutions:

[0005] The invention provides an application of a genetic marker associated with a chest width trait in an RNASEH2B gene in chicken genetic breeding. The genetic marker associated with a chest width trait in the RNASEH2B gene comprises CB_marker1, and the CB_marker1 corresponds to the physical position 169817100 of chromosome 1 of the chicken reference genome bGa lGa l 1.mat.broi ler.GRCg7b version sequence information published in NCBI, and belongs to the 9th intron sequence of the gene RNASEH2B, where the base is G or A.

[0006] Based on the same inventive concept, the present invention provides an early selection method for chicken breast width trait, the early selection method comprising performing early selection on the chicken breast width trait based on the genotype of the genetic marker CB_marker1;

[0007] The CB_marker1 corresponds to the physical position 169817100 of chromosome 1 of the chicken reference genome bGalGal 1.mat.broiler.GRCg7b version sequence information published in NCBI, and belongs to the 9th intron sequence of gene RNASEH2B, where the base is G or A.

[0008] Furthermore, the early selection method specifically includes:

[0009] Detect the genotype of CB_marker1 in the chicken genome to be tested;

[0010] Perform early selection on the chicken breast width trait to be tested based on the genotype of the CB_marker1;

[0011] Among them, the chest width of the GG genotype individual of CB_marker1 is greater than the chest width of the GA genotype individual, and the chest width of the GA genotype individual is greater than the chest width of the AA genotype individual.

[0012] Further, the detection of the genotype of the chicken genome CB_marker1 to be tested specifically includes:

[0013] The genomic DNA of the chicken to be tested was amplified by PCR using Pr_cb1 f and Pr_cb1 r as primers;

[0014] The PCR amplification product was sequenced to obtain the genotype of position 169817100 of the positive strand of chromosome 1 of the tested chicken;

[0015] Among them, the nucleotide sequence of the Pr_cb1 f is shown as SEQ ID NO.1, and the nucleotide sequence of the Pr_cb1 r is shown as SEQ ID NO.2.

[0016] Furthermore, the breeds of chickens to be tested include Dongxiang green-shell laying hens and / or White Leghorn chickens.

[0017] Based on the same inventive concept, the present invention provides primers for detecting the genetic marker CB_marker1, the primers include Pr_cb1 f and Pr_cb1 r, the nucleotide sequence of the Pr_cb1 f is shown in SEQ ID NO.1, and the nucleotide sequence of the Pr_cb1 r is shown in SEQ ID NO.2;

[0018] The CB_marker1 corresponds to the physical position 169817100 of chromosome 1 of the chicken reference genome bGalGal 1.mat.broiler.GRCg7b version sequence information published in NCBI, and belongs to the 9th intron sequence of gene RNASEH2B, where the base is G or A.

[0019] Based on the same inventive concept, the present invention provides the use of primers for detecting genetic marker CB_marker1 in chicken genetic breeding.

[0020] Based on the same inventive concept, the present invention provides a kit, which comprises the above-mentioned primers for detecting the genetic marker CB_marker1.

[0021] Based on the same inventive concept, the present invention provides the use of the above-mentioned kit in chicken genetic breeding.

[0022] Based on the same inventive concept, the present invention provides the application of the genetic marker CB_marker1 in predicting the breast width of 40-week-old chickens. The CB_marker1 corresponds to the physical position 169817100 of chromosome 1 of the chicken reference genome bGa lGa l 1.mat.broiler.GRCg7b version sequence information published in NCBI, and belongs to the 9th intron sequence of the gene RNASEH2B, where the base is G or A.

[0023] One or more technical solutions in the embodiments of the present invention have at least the following technical effects or advantages:

[0024] The invention discloses an application of a genetic marker associated with a chest width trait in the RNASEH2B gene in chicken genetic breeding. The genetic marker associated with a chest width trait in the RNASEH2B gene is CB_marker1. Individuals with a dominant genotype (GG) of CB_marker1 have a higher chest width at 40 weeks of age. Applying the genetic marker to chicken genetic breeding helps to genetically improve the chest width, thereby obtaining a laying hen variety with a high chest width, and meeting consumers' demand for high-quality old hens. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0026] Figure 1 This is the Manhattan plot of the chest width GWAS analysis of the resource population in Example 2 of the present invention;

[0027] Figure 2 This is the QQ graph of chest width GWAS analysis of the resource population in Example 2 of the present invention;

[0028] Figure 3 This is a box plot of chest width of individuals with different genotypes in Example 3 of the present invention. DETAILED DESCRIPTION

[0029] The present invention will be described in detail below in conjunction with specific implementations and examples, and the advantages and various effects of the present invention will be more clearly presented. It should be understood by those skilled in the art that these specific implementations and examples are used to illustrate the present invention, rather than to limit the present invention.

[0030] Throughout the specification, unless otherwise specifically stated, the terms used herein should be understood as meanings commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art to which the present invention belongs. In the event of a conflict, the present specification takes precedence.

[0031] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present invention can be purchased from the market or prepared by existing methods.

[0032] The application of the genetic marker associated with the chest width trait in the RNASEH2B gene of the present application in chicken genetic breeding will be described in detail below in combination with the examples and experimental data.

[0033] Example 1

[0034] Resource group building

[0035] According to F 2 The laying hen resource population was designed and constructed, with Dongxiang green-shell laying hens and white Leghorn chickens as parents, and F 1 Generation, F 2 The experimental chickens were raised in single cages in a fully enclosed chicken house. During the egg-laying period, artificial light was supplemented for 16 hours, and fans and wet curtains were used for cooling. Routine immunization was carried out according to the immunization program formulated by the Jiangsu Poultry Research Institute. The feed was from COFCO, and the ingredients of the laying hen feed included 16.5% crude protein and 11511 kJ / kg feed metabolizable energy. During the egg-laying period, the chickens were fed freely, with water supplied by nipple drinkers, feed supplied by a driving feeder, and manure removed by a chicken manure conveyor belt. At 40 weeks of age, the chest width was measured with an electronic vernier caliper.

[0036] The chest width data was preliminarily screened, and after removing the obviously wrong and repeated data, the outliers were removed and sorted into Excel tables. 2 There were 1512 records remaining in the chest width dataset. Using I BMSPSS21.0 software, QQ plot observation, kurtosis skewness statistics, and Ko lmogorov-Smi rnov test, it was determined that the distribution of chest width data was basically not skewed, which could be used for the next GWAS analysis and to analyze its genetic structure.

[0037] Example 2

[0038] GWAS analysis of chest width at 40 weeks of age

[0039] The experimental chickens were from the laying hen resource population constructed in Example 1. About 0.5 ml of blood samples were collected from the wing vein of the experimental chickens, placed in BD anticoagulant tubes (Suzhou BD Medical Instruments Co., Ltd.), and stored at -70°C. Genomic DNA was extracted by phenol imitation method, detected by 0.8% agarose electrophoresis and ultraviolet spectrophotometry, and the DNA samples were diluted to 50±5 ng / μl after passing the test for gene chip typing.

[0040] Affymetrix GeneChip 600K Chicken Genotyping Array was used for genotyping. Data quality control was performed according to the chip manual, including: using APT software for quality control before typing; using PLINK for quality control, removing SNP markers with a detection rate lower than 0.97 and deviating from Hardy-Weinberg equilibrium; using metrics.R, SNP_filter.R and SNP, CR, and FLD information analysis to screen SNPs; and using BEAGLE for genotype filling. After quality control, 435,867 autosomal SNPs remained for subsequent analysis.

[0041] Before the whole genome association analysis, multidimensional principal component analysis was performed to eliminate false positives and population structure. The first five principal components were added to the genetic model as covariate parameters, and the chicken house effect was placed in the model fixed effect. The R script "simpleM" method was used to calculate the independent test estimate of each SNPs site, and 59,308 independent markers were obtained. Using multiple corrections, the genome significance threshold was 8.43×10- 7 , the recommended threshold for genome is 1.69×10- 5 The mixed linear model was used to analyze the breast width of eggs at 40 weeks of age, and the P value of the significance test of each SNPs marker was obtained. The matrix expression of the linear model is:

[0042] y=Wα+xβ+Gu+ε

[0043] Where y represents the sample phenotypic value vector; W represents the covariance matrix; α is the intercept vector; x is the genotype vector of the marker, β is the effect value of the marker; G is the genetic relationship matrix constructed based on the chip, u is the random effect vector (here is the breeding value); ε is the residual.

[0044] After GWAS screening, CB_marker1 was obtained, which was associated with chest width at 40 weeks of age (Table 1). A genome-wide association analysis was performed on chest width of 1512 chickens at 40 weeks of age. Figure 1 , Figure 2 As shown. Figure 1(Manhattan plot) shows that there is a genome-significant level marker on chicken chromosome 1, and 255 SNPs around it exceed the genome-significant level, which can be used as evidence to support CB_marker1. The QQ plot further verifies that the GWAS results are reliable. Figure 2 (QQ graph) It can be seen that the vast majority of SNPs that did not deviate from the oblique line were affected by genetic drift, and the SNPs at the tail of the QQ graph were affected by artificial selection. The expansion coefficient was calculated to be 0.987, indicating that there was no obvious population stratification in the chest width trait of the resource population. The genetic parameters were analyzed using the pedigree genetic relationship matrix, and the heritability of chest width at 40 weeks of age was 0.342±0.038, of which the CB_marker1 genetic marker could explain 5.8% of the phenotypic variance.

[0045] Table 1 CB_marker1 genetic markers associated with chest width

[0046]

[0047] Wherein: the physical position of the marker chromosome refers to the chicken whole genome (bGal Gal 1.mat.bro i ler.GRCg7b).

[0048] Example 3

[0049] Detection and validation of genetic markers

[0050] The above SNP genetic markers were used to conduct candidate gene association analysis on the Dongxiang green-shell laying hen-white Leghorn chicken resource population. The specific operation steps are as follows:

[0051] 1) PCR primers: DNA template sequence information was downloaded from the NCBI website, and PCR amplification primers were designed using Primer Premier 6.0 software. The primer information is shown in Table 2. PCR primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0052] Table 2 Amplification primers used to detect the genetic markers of chest width in chickens at 40 weeks of age

[0053]

[0054] 2) Genomic DNA extraction: Genomic DNA of 1512 blood samples was extracted by phenol imitation method, and PCR amplification was performed after passing the ultraviolet spectrophotometer and agarose electrophoresis tests.

[0055] 3) PCR amplification process:

[0056] ① Reaction system: 10 μl system includes 50 ng DNA template of identification material, 10 ng of forward and reverse primers, 5 μl 2×power Taq MasterMix, and the remaining volume is made up with ultrapure water.

[0057] ② Reaction procedure: first, denature at 94°C for 30 s, anneal at 53.5°C for 30 s, and extend at 72°C for 30 s, for a total of 5 cycles; then denature at 94°C for 30 s, anneal at 53.5°C for 30 s, and extend at 72°C for 30 s, for a total of 30 cycles; extend at 72°C for 5 min and store at 4°C.

[0058] 4) The amplified product is sent to a sequencing company for sequence polymorphism detection.

[0059] The sequence of the amplified fragment is as follows:

[0060] >CB_marker1

[0061] ATGCCATTGATCTTGTGTTGTAATCTTCATACTGTCCAGTTTGTCAGCACAGGGAGTCTGGCCATTGGCCAATG ATAAGACAGCTTACAAAGA[A / G]TATGTGTGCTCTACTACAGCTGAAGAGCAAATACTTTGCTGAAATGCAAACATT GTATTATAAGTTTTTAAAAATTTGTTTATCAGATTCCAAAGAGAGAAGAATAGTAATTATTCATTAGATTGTCATTTGAAAATGTAATCACAGCTCAGTCAACAGCCTCCCGGAGAGTCTGATCCAGATACCATTGAAATCAAAAAAAGAAGGCTGCTGTTGGATCTGGTTCTAAGAGCTGAGAAATCTA AGCTGCAGACCTGGTTTCAGTGCCAGAGAAAGCGGGGGTGGGGAGTGGGGATCACAGGCTCCGTAAACAAAATGAATAAAACAGGATCTTAAAATGGTACAGTACCATCCACGTTGCTTGCAAAATCACTCTCTTTGGCACAGAAACTAGGAAGGCCACAGCTTAGGTTTCACAGGATATTAAGGACAGG

[0062] In the sequence, the ones marked with [] are mutation sites, those in brackets are allele variations, and the primer sequences are shown in bold at the beginning and end of the sequence.

[0063] 5) Association analysis: All subjects had genotypes and chest width at 40 weeks of age, and then a significance test was performed. Figure 3As shown, the chest width of individuals with AA genotype at 40 weeks of age is 5.96±0.39cm, the chest width of individuals with AG genotype at 40 weeks of age is 6.20±0.44cm, and the chest width of individuals with GG genotype at 40 weeks of age is 6.35±0.45cm. By using genotyping technology, increasing the frequency of G allele can improve the chest width of laying hens.

[0064] Finally, it should be noted that the terms "comprises," "includes," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that includes a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements that are inherent to such process, method, article, or apparatus.

[0065] Although the preferred embodiments of the present invention have been described, those skilled in the art may make other changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0066] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. Application of a genetic marker associated with chest width trait in RNASEH2B gene in chicken genetic breeding, characterized in that: The genetic marker associated with the chest width trait in the RNASEH2B gene includes CB_marker1, which corresponds to the physical position 169817100 of chromosome 1 of the chicken reference genome bGalGal 1.mat.broiler.GRCg7b version sequence information published in NCBI, and belongs to the 9th intron sequence of the gene RNASEH2B, where the base is G or A.

2. An early selection method for chicken breast width trait, characterized in that: The early selection method comprises performing early selection on the chicken breast width trait based on the genotype of the genetic marker CB_marker1; The CB_marker1 corresponds to the physical position 169817100 of chromosome 1 of the chicken reference genome bGalGal 1.mat.broiler.GRCg7b version sequence information published in NCBI, and belongs to the 9th intron sequence of gene RNASEH2B, where the base is G or A.

3. The early selection method for chicken breast width trait according to claim 2, characterized in that: The early selection method specifically includes: Detect the genotype of CB_marker1 in the chicken genome to be tested; Perform early selection on the chicken breast width trait to be tested based on the genotype of the CB_marker1; Among them, the chest width of the GG genotype individual of CB_marker1 is greater than the chest width of the GA genotype individual, and the chest width of the GA genotype individual is greater than the chest width of the AA genotype individual.

4. The early selection method for chicken breast width trait according to claim 3, characterized in that: The detection of the genotype of the chicken genome CB_marker1 to be tested specifically includes: The genomic DNA of the chicken to be tested was amplified by PCR using Pr_cb1 f and Pr_cb1 r as primers; The PCR amplification product was sequenced to obtain the genotype of position 169817100 of the positive strand of chromosome 1 of the tested chicken; Among them, the nucleotide sequence of the Pr_cb1 f is shown as SEQ ID NO.1, and the nucleotide sequence of the Pr_cb1 r is shown as SEQ ID NO.

2.

5. The early selection method for chicken breast width trait according to claim 3, characterized in that: The breeds of chickens to be tested include Dongxiang green-shell laying hens and / or white Leghorn chickens.

6. A primer for detecting genetic marker CB_marker1, characterized in that: The primers include Pr_cb1 f and Pr_cb1 r, the nucleotide sequence of Pr_cb1 f is shown in SEQ ID NO.1, and the nucleotide sequence of Pr_cb1 r is shown in SEQ ID NO.2; The CB_marker1 corresponds to the physical position 169817100 of chromosome 1 of the chicken reference genome bGalGal 1.mat.broiler.GRCg7b version sequence information published in NCBI, and belongs to the 9th intron sequence of gene RNASEH2B, where the base is G or A.

7. Use of the primer for detecting the genetic marker CB_marker1 as claimed in claim 6 in chicken genetic breeding.

8. A kit, characterized in that: The kit comprises the primers for detecting the genetic marker CB_marker1 as described in claim 6.

9. Use of the kit as claimed in claim 8 in chicken genetic breeding.

10. Application of genetic marker CB_marker1 in predicting breast width of 40-week-old chickens, characterized in that: The CB_marker1 corresponds to the physical position 169817100 of chromosome 1 of the chicken reference genome bGalGal 1.mat.brower.GRCg7b version sequence information published in NCBI, and belongs to the 9th intron sequence of gene RNASEH2B, where the base is G or A.

Images