Molecular marker 03W4 with high WSSV resistance of litopenaeus vannamei and application of molecular marker 03W4

Abstract

The invention discloses a molecular marker 03W4 for high WSSV (white spot syndrome virus) resistance of litopenaeus vannamei and application of the molecular marker 03W4, and belongs to the technical field of molecular marker-assisted breeding of aquatic animals. The nucleotide sequence of the molecular marker 03W4 is as shown in SEQ ID No.1, and the genotype TT of the 301st site of the molecular marker 03W4 is the WSSV resistance genotype. The invention also provides a primer of the molecular marker 03W4, and the primer comprises amplification primers as shown in SEQ ID No.2 and SEQ ID No.3 and an extension primer as shown in SEQ ID No.4. The invention also provides the primer of the molecular marker 03W4. The molecular marker 03W4 with high WSSV resistance of the litopenaeus vannamei can be not limited by the growth stage, can be used for early breeding of the litopenaeus vannamei, can screen WSSV high-resistance individuals from breeding populations with different growth performances, can rapidly breed parent populations with high WSSV resistance, and can promote the breeding process of new varieties with high WSSV resistance of the litopenaeus vannamei.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular marker-assisted breeding of aquatic animals, and in particular relates to a molecular marker 03W4 of high WSSV resistance of Litopenaeus vannamei and an application thereof. Background Art

[0002] Penaeus vannamei, also known as white shrimp, is native to the Pacific coast of South America. Since its fast growth rate and strong environmental adaptability, it has been introduced to my country in 1988 and has been widely promoted for breeding. It is a pillar industry of aquaculture in my country. Growth traits are the most concerned economic traits of Penaeus vannamei. However, with the continuous expansion of the scale of Penaeus vannamei farming and the deterioration of the farming environment, diseases frequently occur during the farming process. Among them, the white spot syndrome virus (WSSV) has a strong transmission ability. The infected shrimps have reduced food intake, enlarged liver and pancreas, white spots on the body, and the mortality rate can reach 100% within 3-13 days, causing huge economic losses to the shrimp industry. At present, there is no effective method to prevent and control the spread of the virus. Breeding new varieties with WSSV resistance is an urgent need of the market.

[0003] As of 2023, my country has bred 12 new varieties of Penaeus vannamei that have been approved by the state. The excellent traits of 11 varieties involve growth, and only the "Zhongxing No. 1" variety has shown resistance to the WSSV virus. The genetic correlation between growth and WSSV resistance ranges from moderate negative correlation to low positive correlation in different breeding populations of Penaeus vannamei, indicating that growth and WSSV resistance have different balance mechanisms in different breeding populations.

[0004] Single nucleotide polymorphism (SNP) markers have the characteristics of high richness, high density, strong stability, and co-dominance, and have become the most widely used molecular marker technology in economic crustaceans such as shrimp and crab. At present, there are few SNP markers related to WSSV resistance in Litopenaeus vannamei. The development of molecular markers that are significantly associated with WSSV resistance in different growth performance groups is of great significance for making full use of existing high-quality seed sources and accurately breeding new WSSV-resistant varieties. Summary of the invention

[0005] One of the purposes of the present invention is to provide a molecular marker 03W4 for high WSSV resistance of Penaeus vannamei, the nucleotide sequence of the molecular marker 03W4 is shown in SEQ ID No.1, and the 301st base of the molecular marker 03W4 is C or T.

[0006] The second object of the present invention is to provide a reagent for detecting the above molecular marker 03W4 for use in preparing a product for identifying WSSV resistance of Penaeus vannamei.

[0007] Preferably, the product is a kit.

[0008] More preferably, the genomic DNA of the tested Penaeus vannamei is used as a template, and the genotype of the molecular marker 03W4 is determined by PCR amplification and analysis. When the genotype is TT, the Penaeus vannamei population is determined to be a parent with high WSSV resistance.

[0009] More preferably, the primers used in the PCR amplification include amplification primers having nucleotide sequences as shown in SEQ ID No. 2 and SEQ ID No. 3 and an extension primer having a nucleotide sequence as shown in SEQ ID No. 4.

[0010] More preferably, the conditions for PCR amplification are pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 56°C for 25 s, extension at 72°C for 30 s, repeated for 40 cycles; final extension at 72°C for 3 min; and storage at 4°C.

[0011] More preferably, the PCR reaction conditions are: pre-denaturation at 94°C for 30s; denaturation at 94°C for 5s, annealing at 56°C for 5s, extension at 80°C for 5s, repeated for 40 cycles; final extension at 72°C for 3min; and storage at 4°C.

[0012] The third object of the present invention is to provide a method for identifying WSSV resistance of Penaeus vannamei, the identification method comprising the following steps:

[0013] (1) extracting DNA from the tested Litopenaeus vannamei;

[0014] (2) performing PCR amplification using the DNA in step (1) as a template;

[0015] (3) According to the PCR amplification result, the genotype of the 301st position in the molecular marker 03W4 is determined. The nucleotide sequence of the molecular marker 03W4 is shown in SEQ ID No. 1. If the genotype of the 301st position in the molecular marker 03W4 is TT, it is determined that the vannamei shrimp population is a parent with high WSSV resistance.

[0016] A fourth object of the present invention is to provide a product for identifying WSSV resistance of Penaeus vannamei, wherein the product contains amplification primers including nucleotide sequences as shown in SEQ ID No.2 and SEQ ID No.3 and an extension primer as shown in SEQ ID No.4.

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] (1) The molecular marker 03W4 for high WSSV resistance of Penaeus vannamei provided by the present invention can be used to screen WSSV-resistant individuals in breeding populations with different growth performances without being restricted by growth performance, quickly select parent populations with high WSSV resistance, and promote the breeding process of new varieties of Penaeus vannamei with high WSSV resistance.

[0019] (2) The molecular marker 03W4 provided by the present invention is used to detect the high WSSV resistance of Penaeus vannamei. The method is accurate, reliable, and simple to operate. It can effectively and quickly screen out the high WSSV resistance population, increase the utilization rate of the existing germplasm of Penaeus vannamei, and improve the seed yield. It is of great significance to the healthy breeding and development of Penaeus vannamei and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1a-1c The results of flight mass spectrometry typing validation in the validation population of the present invention are as follows: Figure 1a Corresponding to genotype CC, Figure 1b Corresponding to genotype CT, Figure 1c Corresponding to genotype TT. DETAILED DESCRIPTION

[0021] Example 1

[0022] The vannamei shrimp used in this example came from Bangpu Seed Technology Co., Ltd., a cooperative base of the Yellow Sea Fisheries Research Institute of the Chinese Academy of Fishery Sciences, and was commercially available. 59 full-sib families aged 77-94 days were selected, and all tested negative for WSSV, EHP, AHPND, IHHNV, and DIV1 pathogens. 40 tails were randomly selected from each family, and a total of 2,360 tails were transported to the Genetic Breeding Center of the Yellow Sea Fisheries Research Institute (Jimo, Qingdao, Shandong) for growth and WSSV resistance testing.

[0023] Before the infection test, each family was placed in a 200L plastic bucket for 4 days. During the period, the water temperature was controlled at 25±1℃, 150L of seawater was added, the salinity was 30, oxygen was continuously supplied, the bottom was sucked every day, and 50% of the water was changed. 12% of the body weight was weighed every day and fed three times at 8:00, 14:00, and 20:00.

[0024] The day before the infection test, feeding was stopped and the intestines were emptied. In the formal test, 30 shrimps were randomly selected from the temporary individuals of each family, totaling 1770 experimental group individuals. Referring to the method of feeding poison bait in the patent of Meng Xianhong et al. (patent number: ZL201210107377.8), 10 mg of poison bait was fed to each shrimp, and the virus content in the poison bait was 10 6Copies / mg. After feeding, each family was divided into three parallel groups, with 10 shrimps in each group, and placed in an acrylic box of 70cm×40cm×40cm. The acrylic boxes were placed in three tanks with the same environmental conditions. During the breeding period, feed was fed and water was changed regularly every day to ensure the same breeding conditions. Five individuals from each family were placed in another workshop as the control group, and the breeding conditions were consistent with those of the experimental group. No deaths occurred in the control group during the infection test. After the experimental group was fed with poison bait, it was observed every 2 hours, and the dead juvenile shrimps were fished out. The WSSV content in the tissue was detected using a probe quantitative kit to determine that the cause of death of the dead individuals was WSSV infection. The individual family number, individual death time and body length at the time of death (length from the end of the eyestalk to the end of the tail section) were recorded. After the peak of death, the experiment was stopped when there were no dead individuals for 3 consecutive days. Muscle samples were taken from all experimental groups, quickly frozen in liquid nitrogen, and stored in an ultra-low temperature refrigerator at -80℃.

[0025] The variance components and genetic parameters of body length and anti-WSSV survival time were estimated using the individual animal model, and the breeding values ​​of body length and anti-WSSV survival time of all individuals were estimated by the best linear unbiased prediction method. According to the growth breeding values, the fast-growing group and the slow-growing group were screened out; in the growth difference group, the high-resistance group and the low-resistance group were screened out according to the individual anti-WSSV survival time breeding values. Four extreme groups were screened out, namely A: slow-growing and weak-resistance group, B: slow-growing and strong-resistance group, C: fast-growing and weak-resistance group, and D: fast-growing and strong-resistance group. Each group had 30 individuals, and the individuals between groups did not cross and had significant differences in the breeding values ​​of growth and WSSV survival time traits (P<0.05). The ranges of body length and anti-WSSV survival time of the four extreme mixed pool individuals are shown in Table 1.

[0026] Table 1 Body length and survival time range of WSSV resistance of individuals in four extreme mixed pools

[0027]

[0028] Example 2

[0029] 1. Screening of candidate molecular markers associated with WSSV resistance

[0030] 1. High-throughput sequencing and sequence alignment

[0031] The CTAB (Cetyltrimethylammonium Bromide) method was used to extract DNA from muscle tissue of Penaeus vannamei. Add 1 ml of 1×CTAB to a 1.5 ml sterile enzyme centrifuge tube; take about 20 mg of sample and add it to the centrifuge tube, grind it at 60 Hz for 4 minutes; incubate it in a 65°C water bath for 60 minutes; centrifuge it at room temperature at 8000 g for 5 minutes; take 900 μL of the supernatant of the sample after centrifugation to a new 2 ml sterile enzyme centrifuge tube; add 450 μL of chloroform to the supernatant; cover the tube tightly and mix the sample by inversion for 30 seconds until the solution is completely emulsified and turns white; centrifuge it at room temperature at 13000 g for 10 minutes; transfer 800 μL of the supernatant to a new 1.5 ml sterile enzyme-free centrifuge tube; Beckman Agencourt AMPure XPbeads, equilibrate at room temperature in the dark for 30 minutes; add 0.6 times the volume of supernatant Beads, gently blow and mix with a pipette for more than 10 times, and let it stand at room temperature for 5 minutes; place it on the magnetic rack for 5 minutes until the solution is clear, carefully aspirate and discard the supernatant; keep the above 1.5mL centrifuge tube fixed on the magnetic rack, add 200μL of freshly prepared 80% ethanol to the tube, let it stand at room temperature for 30s, and discard the supernatant, taking care not to disturb the magnetic beads; repeat the 80% ethanol wash once; keep the 1.5mL centrifuge tube fixed on the magnetic rack, and dry the magnetic beads at room temperature for 2-5 minutes; remove the 1.5mL centrifuge tube from the magnetic rack, add 50μL 10mM Tris HCl eluent, gently blow and mix with a pipette, and let stand at room temperature for 5 minutes; place the 1.5mL centrifuge tube on a magnetic rack, let stand at room temperature for 5 minutes until the solution is clear, carefully pipette about 50μL of the supernatant and transfer it to the corresponding new sample storage tube to obtain the purified DNA. The purity and integrity of the DNA were analyzed by agarose gel electrophoresis; the purity of the DNA was detected by Nanodrop (OD260 / 280 ratio), and the DNA concentration was accurately quantified by Qubit.

[0032] Each pool of 30 individuals provided an equal amount of DNA samples, and four DNA pools were constructed, namely A with slow growth and weak resistance, B with slow growth and strong resistance, C with fast growth and weak resistance, and D with fast growth and strong resistance. The mixed DNA samples were randomly broken into fragments of 500 bp in length by Covaris S2 / E210 crusher, and the DNA fragments were prepared by end repair, ployA tail addition, sequencing adapter addition, purification, PCR amplification and other steps to complete the entire library preparation. The constructed library was sequenced by Illumina Novasek 6000 sequencing platform, and the sequencing data was quality controlled to obtain CleanData data, which was compared with the reference genome GCF_003789085.1 to complete the detection and annotation of the site. The quality statistics of the sequencing data of the four pools are shown in Table 2. The filtered valid data were aligned by Burrows-Wheeler alignment tool (BWA) software, and the alignment results were removed by SAMTOOLS software to remove PCR duplication. The average sequencing depth was above 30×, which can be used for subsequent analysis.

[0033] Table 2 Overview of sequencing quality control

[0034]

[0035]

[0036] 2. Screening of genomic differential regions

[0037] Different genomic regions were selected based on the sliding window strategy: 50 kb as the unit window and 25 kb as the sliding step. The nucleotide diversity difference multiples (π-Ratio) and genetic differentiation coefficient (Fixation index, Fst) between the AB group and the CD group were calculated for the selected specific genomic regions. Combining the results of π-Ratio and Fst, significant regions were screened according to the difference between groups P<0.05.

[0038] 3. Marker Detection and Annotation

[0039] The Unified Genotyper module in the Genome analysis toolkit (GATK) software was used to detect SNPs and InDels in the candidate intervals, and the filtering parameters were set as follows: -Window 4, -filter "QD<2.0||FS>60.0||MQ<40.0", -G_filter "GQ<20". 697 selected genomic regions were located between the AB group, containing 510,524 SNP sites; 842 selected genomic regions were located between the CD group, containing 585,675 SNP sites.

[0040] 4. SNP frequency difference analysis

[0041] The SNP-index of each site in the AB population and the CD population pool was calculated separately, and the frequency difference distribution of SNP was calculated at the same time, and the direction was as follows: △(index)=index(high WSSV resistance)-index(low WSSV resistance).

[0042] 5. Marker screening

[0043] The candidate SNPs were screened and the sites with △index close to 1 or close to -1 in the two populations were selected as the priority sites for the next step of verification. The screening criteria are as follows:

[0044] (1) Based on the annotation information of the SNP loci, and then sorted from high to low according to │△index│, the sites of synonymous, non-synonymous mutations or upstream and downstream regions are preferentially selected;

[0045] Finally, 69 markers with large frequency differences between the AB and CD groups were screened out.

[0046] Table 3 Statistical results of SNPs detection and annotation among resistance difference groups

[0047]

[0048] 2. Verification of molecular markers associated with WSSV resistance

[0049] Another batch of Penaeus vannamei was selected, and time-of-flight mass spectrometry was used to verify the candidate molecular markers related to WSSV resistance in the slow-growing and weak-resistance, slow-growing and strong-resistance groups, fast-growing and weak-resistance, and fast-growing and strong-resistance groups, with 30 individuals in each group. The specific operation steps are as follows:

[0050] (1) PCR amplification: Design primers on the flanking sequences of the marker site to amplify the DNA sequence containing the detection target;

[0051] (2) Single base extension: SNP sequence-specific extension primers are added to the PCR amplification product, and single base extension is performed using iPLEX technology. For the detection target, different genotypes only differ by one base at the end of the extension;

[0052] (3) Mass spectrometry detection: The product after single-base extension is purified and transferred to the SpectroCHIP chip for mass spectrometry detection. DNA is positively charged by laser irradiation and flies in the detection vacuum tube. The flying speed is inversely proportional to the mass of each extension product. Finally, the base type is determined by the position of the peak, thereby achieving genotyping;

[0053] (4) The mutation markers of each individual were counted based on the mass spectrometry detection results, and the correlation between the markers and WSSV resistance was analyzed using SPSS software.

[0054] The specific steps are as follows:

[0055] 1. Primer design

[0056] Primer design software Sequenom's Genotyping Tools and MassarrayAssay Design software were used to design PCR amplification primers and single base extension primers for the loci. Primer length 18-30 bp, PCR product 80-200 bp), T m Value 55-65℃, annealing temperature around 60℃; GC content 40-70%.

[0057] 2. PCR amplification

[0058] The total volume of each amplification reaction system is 5 μL, the PCR amplification reaction system is shown in Table 4, and the reaction program is shown in Table 5. Primer synthesis and sequencing were completed by Shanghai Sangon Biotechnology Co., Ltd.

[0059] Table 4 PCR amplification reaction system components

[0060]

[0061] Table 5 PCR amplification reaction program

[0062]

[0063] 3. Treatment of PCR products with alkaline phosphatase

[0064] (1) After the PCR reaction is completed, SAP (shrimp alkaline phosphtase) is used to purify the multiple PCR amplification reaction products to remove dNTPs in the reaction. The SAP reaction solution formula is as follows (taking a single sample as an example): SAP Buffer 0.17μl, SAP Enzyme (1.7U / μl) 0.3μl, ddH2O 1.53μl.

[0065] (2) Use a pipette to add the SAP reaction solution to the PCR reaction plate, add 2 μl to each well, seal the film, and centrifuge.

[0066] (3) Place the PCR reaction plate to which the SAP reaction solution has been added into a PCR instrument and run the following reaction program: 37°C, 40 min; 85°C, 5 min; store at 4°C.

[0067] (4) After the reaction is completed, remove the PCR reaction plate and centrifuge it briefly for later use.

[0068] 4. Single base extension reaction

[0069] The addition of ddSNP allows the PCR to extend only one base, the single base extension reaction system is shown in Table 6, and the total volume of the reaction system is 2 μL. The reaction procedure is shown in Table 7.

[0070] Table 6 Single base extension reaction system

[0071]

[0072] Table 7 Single base extension reaction program

[0073]

[0074] 5. Product purification

[0075] (1) Cover the resin scraper evenly with resin and leave it for 20 minutes.

[0076] (2) Centrifuge the PCR reaction plate at 1000 rpm for 1 min, add 25 μl of deionized water to each well, invert it on the resin plate (make sure it is fixed and cannot be moved), then invert the resin plate and buckle it on the PCR reaction plate, tap it to make the resin fall into the PCR reaction plate, and seal it with film.

[0077] (3) With the long axis of the PCR reaction plate as the axis, turn the PCR reaction plate over for 20 minutes, centrifuge at 3500 rpm for 5 minutes, and set aside.

[0078] 6. Mass spectrometry

[0079] (1) Nanodispenser SpectroCHIP chip spotting transfers the test sample from the PCR reaction plate to the MassARRAY SpectroCHIP chip with a surface covered with matrix;

[0080] (2) MassARRAYAnalyzer Compac mass spectrometry;

[0081] (3) TYPER software was used to analyze the experimental results and obtain typing data.

[0082] 7. Statistical analysis

[0083] As shown in Table 8, the proportion of genotype TT in the slow growth and strong resistance group and the fast growth and strong resistance group in 03W4 was 0.87 and 0.87 respectively, both of which were dominant genotypes. The two groups of data P = 0.001, with extremely significant differences, so it is believed that the genotype TT at the 301st site of the 03W4 molecular marker is a WSSV resistance genotype. The nucleotide sequence of the 03W4 molecular marker is shown in SEQ ID No. 1, wherein the amplification primers for developing the molecular marker are shown in SEQ ID No. 2 and SEQ ID No. 3, and the extension primer is shown in SEQ ID No. 4 (Table 9).

[0084] SEQ ID No.1Penaeus vannamei:

[0085] ATCCCCCAACATCAAGAAACACAGCAACACCCTCCACTCTCCCACTGACCTGTTGTCCACCCCCCAAACATCAAGAAACACAGCAACACCCTCCACTCTCCCACTGACCTGTGTCCATCCCCAAACATCAAGAAACACAGCAACACCCTCCACTCTCCCACTGACCTGTGTCCACCCCCAAACATCAAGAAACACAGCAACACTCTCCACTCTCCCACTGACCTGTGTCCATCCCCAAAACATCA AGAAGACAGCAACACACTCC ACTCCTCCCACTGACCTGTGTCCATGCAAG[T / C]CTCGTAGAAGCG GTTCACCATATGCAGGGGTT CCGCAGCACCTGGCG AGACGGGGCTCTCCAAGATCAGTTTAAGACGTTTGGTCAAGATGTCACCTGCTTCGTAGAATGTGCCGGTGCTTGGGGAAGAGAGGGAGGTCAGAAACAATGTTTTGGGGGTATTTACAAAAATGTAGGGAGGTGAGACACAATGTTTTTTTTTTGGGGGGGGGTATTTACAAAAATGTAATATGACATAAACAAGTATAAACACACACGGATAAACTTATAAAAGCGAAAAGACAGACACAAATGTGCACAC

[0086] Table 8 Typing results of 03W4

[0087]

[0088] Table 9 Primers for molecular markers

[0089]

[0090]

[0091] The molecular marker 03W4 obtained by the present invention can be used to assist in selecting a high WSSV resistance variety of Penaeus vannamei. The application steps are specifically as follows: extracting DNA of a test sample of Penaeus vannamei and using it as a template, performing flight mass spectrometry typing using amplification primers 03W4-F and 03W4-R of the molecular marker 03W4 and an extension primer 03W4-E, and if the genotype of the 301st nucleotide of 03W4 in the typing result is TT, the test sample can be selected as a parent for breeding a high WSSV resistance variety of Penaeus vannamei.

[0092] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A molecular marker 03W4 for high WSSV resistance of Penaeus vannamei, characterized in that: The nucleotide sequence of the molecular marker 03W4 is shown in SEQ ID No. 1, and the 301st base of the molecular marker 03W4 is C or T.

2. Use of a reagent for detecting the molecular marker 03W4 according to claim 1 in preparing a product for identifying WSSV resistance of Penaeus vannamei.

3. The use according to claim 2, characterized in that: The product is a kit.

4. The use according to claim 2 or 3, characterized in that: The genomic DNA of the tested Penaeus vannamei is used as a template, and the genotype of the molecular marker 03W4 is determined by PCR amplification and analysis. When the genotype is TT, the Penaeus vannamei population is determined to be a parent with high WSSV resistance.

5. The use according to claim 4, characterized in that: The primers used in the PCR amplification include amplification primers with nucleotide sequences as shown in SEQ ID No. 2 and SEQ ID No. 3 and an extension primer with a nucleotide sequence as shown in SEQ ID No.

4.

6. The use according to claim 5, characterized in that: The conditions for the PCR amplification are: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 56°C for 25 s, extension at 72°C for 30 s, repeated for 40 cycles; final extension at 72°C for 3 min; and storage at 4°C.

7. The use according to claim 6, characterized in that: The conditions of the PCR reaction were as follows: pre-denaturation at 94°C for 30s; denaturation at 94°C for 5s, annealing at 56°C for 5s, extension at 80°C for 5s, repeated for 40 cycles; final extension at 72°C for 3min; and storage at 4°C.

8. A method for identifying WSSV resistance in Penaeus vannamei, characterized in that: The identification method comprises the following steps: (1) extracting DNA from the tested Litopenaeus vannamei; (2) performing PCR amplification using the DNA in step (1) as a template; (3) According to the PCR amplification result, the genotype of the 301st position in the molecular marker 03W4 is determined. The nucleotide sequence of the molecular marker 03W4 is shown in SEQ ID No.

1. If the genotype of the 301st position in the molecular marker 03W4 is TT, it is determined that the vannamei shrimp population is a parent with high WSSV resistance.

9. A product for identifying the WSSV resistance of Penaeus vannamei, characterized in that: The product contains amplification primers including nucleotide sequences as shown in SEQ ID No.2 and SEQ ID No.3 and extension primers including nucleotide sequence as shown in SEQ ID No.4.

Images