A primer combination for detecting rice MITE transposon insertion site and its application

Abstract

The present invention relates to the field of molecular biology, and in particular to a primer set for detecting rice MITE transposon insertion sites and its application. The primer set includes 16 specific primers, and the sequence is shown in SEQ ID NO: 11-26; by using any single primer or a mixed combination of any primers in the primer set, through library construction PCR, and then NGS second-generation deep sequencing, about 29,000 MITE sites can be enriched from each rice material, and the detection rate exceeds 80%; the present invention provides a powerful tool for rice MITE site detection, and has important technical guiding significance for the fields of rapid rice molecular breeding, germplasm identification, etc.

Description

Technical Field

[0001] The present invention belongs to the field of molecular biology, and in particular, relates to a primer combination and method for isolating a genome sequence of a rice MITE transposon insertion site, and application of a liquid phase chip formed by sequencing data thereof in genotype identification of different rice varieties or germplasm resource materials. Background Art

[0002] Transposons are widely present in plants and animals, and play an important role in the evolution, domestication and formation of new varieties of species. Transposons are a class of mobile DNA sequences that can "jump" from one location to another in the genome. Transposons do not need to have extensive homology with the target site to transpose, and this phenomenon is usually controlled by transposase. Transposons play an important regulatory role in the genome, can turn on or off certain genes, and may cause rearrangements such as deletions, duplications or inversions of the genome. In crops, people use active transposons to make mutant libraries, create artificial mutations, and create new crop varieties. However, during the long evolutionary process, a large number of transposons have lost their active transposases or undergone transposase recognition sequence mutations, and then lost the ability to move, becoming a large number of islands fixed on the genome.

[0003] There is a highly abundant transposon in rice, the MITE transposon family. MITE (micro inverted repeat transposon) is a truncated DNA transposon characterized by: MITE has terminal inverted repeats (TIR) ​​and flanking target site copies (TSD), but lacks transposase-encoding sequences inside, so its transposition needs to rely on transposases encoded by homologous autonomous DNA transposons; MITE has a high copy number in the genome and is randomly distributed on chromosome arms. The whole genome search using a homology-independent algorithm is suitable for discovering new MITE rice transposon families. There are 178,533 MITE-related sequences in the genome of the rice cultivar "Nipponbare", which are divided into 6 superfamilies and 338 families; MITE has an important influence on gene expression and genome differentiation. They prefer to insert near genes and produce small RNAs through transcription, which play a role in gene expression regulation. MITE is inserted near 23,623 (58.2%) rice genes. At least 7,887 MITEs can be transcribed, of which 3,463 are transcribed together with genes. The transcribed MITE sequences can form at least 1,130 potential sense / antisense transcript pairs. MITEs produce 23.5% of rice small RNAs, and some families mainly produce small RNAs from the ends, while others mainly produce small RNAs from the middle region. 51.8% of MITE-derived small RNAs are produced from MITEs far from genes. About 14.8% of full-length MITE loci produce presence / absence polymorphisms between the japonica rice cultivars "Nipponbare" and the indica rice cultivars 93.11.

[0004] The copy number of MITE is basically the same in different rice germplasm resources or varieties, and it has great potential in the application of genotype detection tools such as molecular markers and liquid phase chips. Among the existing detection methods, liquid phase chips can complete the detection of tens of thousands of sites at the same time, rely on NGS high-depth sequencing, and the cost is lower than solid phase chips, which has excellent advantages. Relatively speaking, the throughput of detection markers such as indel markers and kasp markers is often small, and only one site is detected at a time. The disadvantage of resequencing is that it obtains random sequences, and its disadvantages are low efficiency and high cost. Taking advantage of the high copy number and simple and short sequence of MITE microtransposon, specific primers and detection methods are developed to construct a new type of liquid phase chip, which can realize efficient rice molecular detection and is applied to rapid molecular breeding, germplasm identification and other fields. Summary of the invention

[0005] The purpose of the present invention is to provide a primer combination and method for isolating the genome sequence of the rice MITE transposon insertion site, and the application of the liquid phase chip formed by the sequencing data in the genotype identification of different rice varieties or germplasm resource materials.

[0006] In order to achieve the above object, the present invention provides the following technical solutions:

[0007] The first aspect of the present invention provides a primer set for detecting a MITE transposon insertion site in a rice genome, the primer set comprising the following 16 primers: rnd-1-38inner, rnd-1-56inner, rnd-1-58_1inner, rnd-1-58_2inner, rnd-1-66_1inner, rnd-1-66_2inner, rnd-1-91_1inner, rnd-1-91_2inner, rnd-2-77_1inner, rnd-2-77_2inner, rnd-4-216_1inner, rnd-4-216_2inner, rnd-6-1845_1inner, rnd-6-2373_1inner, rnd-6-2373_2inner, rnd-6-18707inner, the sequences of the 16 primers are as shown in SEQ ID Shown in NO:11-26.

[0008] The second aspect of the present invention provides a kit for detecting MITE transposon insertion sites in the rice genome, the kit comprising 16 primers shown in sequences SEQ ID NO:11-26, a linker primer shown in sequence SEQ ID NO:29, and linkers 1 and 2 shown in sequences SEQ ID NO:27 and 28.

[0009] The third aspect of the present invention provides the use of the above-mentioned primer set or the above-mentioned kit in high-throughput detection of rice MITE transposon whole-genome sites based on second-generation sequencing.

[0010] A fourth aspect of the present invention provides a method for isolating a genomic sequence of a MITE transposon insertion site, comprising the following steps:

[0011] Step 1: extract rice genomic DNA, and use a shearing enzyme to shear the DNA to obtain a DNA fragment between 250 bp and 5 kb;

[0012] Step 2: Connect the DNA fragment obtained in step 1 to adapter 1 and adapter 2 using DNA ligase to obtain a DNA fragment with an adapter, and recover the DNA fragment with an adapter using a kit;

[0013] Step 3: using 16 primers shown in SEQ ID NO: 11-26 and the adapter primer to perform a round of PCR amplification on the DNA fragment with adapter recovered in step 2 to obtain an amplified product;

[0014] Step 4: Recover the amplified product obtained in step 3, quantify it, and sequence it using a second-generation sequencer. Compare the sequencing result with the rice genome sequence to obtain the corresponding site;

[0015] Among them, the adapter 1 and adapter 2 described in step 2, and the 16 primers and adapter primers described in step c are from the above-mentioned kit.

[0016] Furthermore, in the step 1, the breaking enzyme is a DNA enzyme that recognizes a sticky end sequence of 4-6 bases; and the breaking condition is incubation at 37° C. for 1-5 hours.

[0017] Furthermore, the interrupting enzyme is NlaIII restriction endonuclease.

[0018] Furthermore, in step 2, the DNA ligase is T4 DNA ligase, and the ligation conditions are incubation at 25° C. for 1-3 hours.

[0019] Furthermore, in the step 2, the ratio of linker 1, linker 2 and DNA fragment is 10pM:10pM:50ng.

[0020] Furthermore, in step three, the method of using the 16 primers shown in the sequence SEQ ID NO: 11-26 is: using any one of the 16 primers or a mixed combination of any several primers and an adapter primer to perform a round of PCR amplification on the DNA fragment with adapter recovered in step two.

[0021] Furthermore, in the step three, the PCR amplification conditions are: 95°C for 3 minutes, first using any one of the 16 primers shown in the sequence SEQ ID NO:11-26 or a mixed combination of any several primers and a linker primer for 15 cycles, the conditions are 98°C for 10 seconds, 62°C for 20 seconds, 72°C for 1 minute; and finally 72°C for 8 minutes.

[0022] Beneficial effects of the present invention:

[0023] At present, high-copy number transposon sites are generally obtained by resequencing. Compared with the existing MITE transposon site identification method, the method provided by the present invention can enrich almost all sites on the genome, with extremely high efficiency. By filtering through the bioinformatics process, low-abundance sequencing products can be filtered out, which can greatly improve the accuracy and generate 10 4The above reliable markers; in addition, this method uses the label sequence on the primer, which can achieve a mixed sequencing scale of 384 samples each time, separate the loci of a single sample from large-scale data, significantly improve the efficiency of the entire process, and greatly reduce the cost of library construction and sequencing. The specific design of the primers not only ensures that the MITE end length is 70-700bp specific sequence in subsequent analysis, but also ensures that 10-700bp flanking genomic sequences are obtained in the subsequent second-generation NGS sequencing process; at the same time, different specific primers are mixed according to the multiplex PCR method to obtain the flanking sequences of different MITE family members in one PCR reaction, which is an ingenious and efficient new design. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 Statistics of the number of sites of the MITE microtransposon on 12 chromosomes of the Nipponbare genome.

[0025] Figure 2 Statistics of the types of rice MITE transposon superfamily and the number of different MITE family sites in the NIP genome: statistics of the top 200 families in terms of abundance.

[0026] Figure 3 Statistics of the types of rice MITE transposon superfamily and the number of different MITE family sites in the NIP genome: statistics of the top 10 families in terms of abundance.

[0027] Figure 4 The number of MITE transposon sites mapped for valid sequences.

[0028] Figure 5 The number of transposon sites on each chromosome of the MITE genome was detected using different primer combination methods.

[0029] Figure 6 The distribution of NIP1 loci throughout the genome.

[0030] Figure 7 The distribution of NIP2 sites in the whole genome.

[0031] Figure 8 The distribution of NIP3 sites in the whole genome.

[0032] Fig. 9 The distribution of NIP4 loci throughout the genome.

[0033] Fig.10 The distribution of NIP5 sites in the whole genome.

[0034] Fig.11 The distribution of NIP6 loci throughout the genome. DETAILED DESCRIPTION

[0035] The specific implementation modes of the present invention are described below so that those skilled in the art can understand the present invention. However, it should be clear that the present invention is not limited to the scope of the specific implementation modes. For those of ordinary skill in the art, as long as various changes are within the spirit and scope of the present invention as defined and determined by the attached claims, these changes are obvious, and all inventions and creations utilizing the concept of the present invention are protected.

[0036] The present invention aims to provide a method for capturing nearly 10 5 , high-throughput, high-efficiency, and low-cost primers and methods.

[0037] The present invention also provides a method for detecting the insertion site of a MITE transposon.

[0038] The present invention adopts the following technical solution:

[0039] The present invention provides specific primers for separating a genome sequence of a MITE transposon insertion site. The specific primers include rnd-1-38inner, rnd-1-56inner, rnd-1-58_1inner, rnd-1-58_2inner, rnd-1-66_1inner, rnd-1-66_2inner, rnd-1-91_1inner, rnd-1-91_2inner, rnd-2-77_1inner, rnd-2-77_2inner, rnd-4-216_1inner, rnd-4-216_2inner, rnd-6-1845_1inner, rnd-6-2373_1inner, rnd-6-2373_2inner, and rnd-6-18707inner, and meet the following conditions a, b, c or d:

[0040] a. Conserved consensus sequences on both sides of the transposon in the genomic sequence;

[0041] b. The distance between inner and the last base of the transposon end is about 70-300 bp;

[0042] c. Carrying 4-8bp tag sequence to distinguish samples;

[0043] d. Contains anchor sequences for NGS deep sequencing.

[0044] The genome is a rice genome.

[0045] The present invention also provides a kit for detecting MITE transposon insertion sites in a rice genome, the kit comprising 16 primers shown in sequences SEQ ID NO:11-26, a linker primer shown in sequence SEQ ID NO:29, and linkers 1 and 2 shown in sequences SEQ ID NO:27 and 28.

[0046] The present invention also provides a method for isolating the genome sequence of the Opie-ji transposon insertion site, the specific steps of which are as follows:

[0047] a. Take rice genomic DNA and break it with DNA breaking enzyme to obtain the breaking product. The breaking DNA fragment is between 250 bp-5kb;

[0048] b. Connecting the fragmented product obtained in step a with synthetic linker 1 (sequence: SEQ ID NO: 27) and linker 2 (sequence: SEQ ID NO: 28) and DNA ligase to obtain a DNA fragment with a linker;

[0049] c. The product obtained in step b is recovered using a kit;

[0050] d. The recovered product of step c was amplified by PCR using one or a mixture of the rnd-1-38inner, rnd-1-56inner, rnd-1-58_1inner, rnd-1-58_2inner, rnd-1-66_1inner, rnd-1-66_2inner, rnd-1-91_1inner, rnd-1-91_2inner, rnd-2-77_1inner, rnd-2-77_2inner, rnd-4-216_1inner, rnd-4-216_2inner, rnd-6-1845_1inner, rnd-6-2373_1inner, rnd-6-2373_2inner, rnd-6-18707inner and a linker PCR primer adapter primer (sequence SEQ ID NO: 29), and a single round of amplification was performed for 15 cycles;

[0051] e. Recover the amplified product of step d, quantify it, and sequence it using an NGS sequencer. Compare the sequencing results with the genome sequence to obtain the corresponding sites.

[0052] The interruption enzyme in step a is NlaIII or other DNA enzymes with a recognition sequence of 4-6 base sticky ends, and the interruption conditions are 37° C. for 1-5 hours.

[0053] The ligase in step b is T4 DNA ligase, and the ligation conditions are 25°C for 1-3 hours;

[0054] The kit in step c is Axygen Gel Recovery Kit AP-GX-250;

[0055] The PCR amplification strategy of step d is multiplex PCR, and the amplification conditions are: 95°C for 3 minutes, first amplifying with the above primers and adapter primers for 15 cycles, the conditions are 98°C for 10 seconds, 62°C for 20 seconds, 72°C for 1 minute; and finally 72°C for 8 minutes.

[0056] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Unless otherwise specified, the examples are all based on conventional experimental conditions, such as Sambrook et al. Molecular Cloning Laboratory Manual (Sambrook J & Russell DW, Molecular Cloning: a Laboratory Manual, 2001), or the conditions recommended by the manufacturer's instructions.

[0057] Example 1 Design and verification of Opie-ji specific primers

[0058] The identification of MITE transposons usually adopts the structure-based method. In the present invention, the genome was searched using MITE-Hunter software. According to the sequence difference differentiation, a total of 9316 MITE families with a total of 35750 sites were obtained. The alignment results and site number statistics are shown in Figure 1 .

[0059] All the sites are widely distributed throughout the genome, with basically no vacant areas, and are relatively more distributed on the outside of the two arms of the chromosome. According to the distribution characteristics of MITE, MITE tends to be inserted near rice genes, more than 40% of MITE are near the locus, and less than 60% of MITE are in the non-coding region far away from the gene. The above preliminary analysis characteristics show that MITE has a high marker density in individuals separated from the gene coding region population, which is conducive to efficiently capturing the genotype variation of the separated offspring, and is suitable for large-scale molecular markers and liquid phase chip development and application.

[0060] The statistics of the top 200 MITE families in terms of abundance across the genome are shown in Figure 2The largest number of sites is 4563, and the smallest is only 1. The top 10 families in terms of abundance are rnd-1_family-56, rnd-1_family-91, rnd-1_family-38, rnd-4_family-216, rnd-6_family-18707, rnd-1_family-66, rnd-2_family-77, rnd-6_family-1845, rnd-6_family-2373, and rnd-1_family-58. The sequences are shown below. A total of 29535 sites were obtained. The abundance is shown in Figure 2 and Figure 3 .

[0061] The sequences of the top 10 most abundant MITE transposon families are shown in SEQ ID NOs: 1-10. The specific sequences are as follows:

[0062] SEQ No:1(rnd-1_family-38):

[0063] TAATACTCCCTCCGTTTCGAAATGTTTGACGCCGTTGACTTTTTAGCACGTGTTTGACCGTTCGTCTTATTCAAAAAATTTAAGTAATTATTNATTCTTTTCNTATCATTTGATTCATTGTTAAATATACTTTCATGTACGCATATAGTTTTACATATTTCACAAAANTTTTTGAATAAGACGAACGGTCAAACATGTGCTAAAAAGTCAACGGTGTCAAACATTTCGAAACGGAGGGAGTA;

[0064] SEQ No:2(rnd-1_family-56):

[0065] TACTCCCTCCGTTTCACAATGTAAGTCATTCTAGCATTTCCCACATTCATATTGATGTTAATGAATCTAGACATATATATCTATCTAGATTCATTAACATCAATATGAATGTGGGAAATGCTAGAATGACTTACATTGTGAAACGGAGGAAGTA;

[0066] SEQ No:3(rnd-1_family-58):

[0067] AGGCTGTGTTCGGATGTGGGGGTTGGGAACCCATCCCCCCCGCACGGAAAACGGAGCGGTCCATTAGCGCACATCGCACGGAAAACGGAGCGGTCCATTAGCGCGTGATTAATTAAGTATTAGCTATTTTTTTNAAAAATGGATTAATNTGATTTTTTAAGCAACTTTCGTATAGAAACTTTTTGCAAAAAACGCACCGTTTAGCAGTTTGAAAAGCGTGCGCGCGGAAAACGAGGGAGAGGGGTTGGGAACACGGGGNNNCGAACACAGCC;

[0068] SEQ No:4(rnd-1_family-66):

[0069] TACTCCCTCCGTCCCATAAAAAACCAACCTAGTACTGGATGTGACACATCCTAGTACNACGAATCTGGACATACNTCTGTCCAGATTCGTTGTACTAGAATATGTCACATCCAGTCCTAGATTCGTTTTTTTGGGACGGAGGGAGTA;

[0070] SEQ No:5(rnd-1_family-91):

[0071] TAGGCCGNGTTTAGTTCCAAACTTTTTCTTCAAACTTCCAACTTTTCCATCACATCAAAACTTTCCTACACACACAAACTTCCAACTTTTCCGTCACATCGTTCCAATTTCAACCAAACTTCCAATTTTGGCGTGAACTAAACACACCC;

[0072] SEQ No:6(rnd-2_family-77):

[0073] CCTGTGTTCGGNAGCGAGGGTTGGGAACCTTCACTCCCTAGCACGCAAAACGAGGCGGTCATTAGCGCATGATTAATTAAGTATTAACTATTATAAACTTGAAAAATAGATTAATNTGATTTTTTAAAGCAACTTTTATATAGAAATTTTTTTTAAAAAACACACCGTTTAGCAGTTTGAAAAGCGTGCNCGCGGAAAACGAGGGAGATGAGTTGGGAANNTAGAGGNAAAAACTTAG;

[0074] SEQ No:7(rnd-4_family-216):

[0075] TGGAAACTACGTACTCCCTCCGTTTCTAAATGTATGACGCCGTTGACTTTTTAACATACGTTTGACCATTCGTCTTATTCAAAAAAATTATGTAANTATCATTTATTTTGTTGTGACTTGATTTATCATCAAATATATTTTTAAGTATGACATANATATTTTACATATTTGCACGAAAATTTTTGAATAAGACGAATGGTCAAACGTGTGCTAAAAAGTCAACGGCGTCATACATTAGAAACGGAGGGAGTATGTAGTAGAGACGTGGAAACTACCGTATGGATCGAAGAAGAAAGACGTTAAGATTCGTCCACNTCATGATCACTCATGAGTAAAANTTTTACTCATGATGATATGGACAAATTCTCAGACGTTCATTTTTTATCCTACGGTAGTTTTCAGGTTTNTACTACATATATAGGTTNCACCATATATTTTCA;

[0076] SEQ No:8(rnd-6_family-1845):

[0077] CTCCGTTTCATATTATAAGTCGTTTGACTTTTTTCTTAGTCAAACTTTNTTAAGTTTGACCAAGTTTATAGAAAAATATAGCAACATCTACAACACCAAATTAGTTTCATTAAATCTAACATTGAATATATTTTGATAATATGTTTGTTTTGTGGTTGAAAATGTTACTATATTTTTCTATAAACTTGGTCAAACTTAAAAAGTTTGACTAAGAAAAAAAGTCAAAACGACTTATAATATGAAACGGA;

[0078] SEQ No:9(rnd-6_family-2373):

[0079]

[0080] SEQ No:10(rnd-6_family-18707):

[0081] TAATTAGAGAACATATNTANCTNTAGCATANTACTACGTACTCCCTCCGTCCCATAATATAAGGGATTTTGAGTTTTTNCTTGCACTGTTTGACCACTCGTCTTATTAAAAAAAATTGTGCAAATATAAAAAACGAAAAGTTNTGCTTAAAGTACTTTGGATAATAAAGCAAGTCACAA AAAAATAAATAATAATTCTAAATTTTTTTAATAAGACGAGTGGTCAAACAGTGCAAACAAAAACTCAAAATCCCTTATATTATGGGACGGAGGGAGTAGTAATTAATTTGCGATCTAAAGTTGTTTGTACTAATTTGAGTAATTTAAAATGTGGAGGATAACATTTTATTTTATGTTA.

[0082] The MITE transposon site at the whole genome level was obtained using NGS sequencing technology. The double-end read length of NGS is 300-700bp. In order to ensure that within this read length range, adjacent genomic sequences greater than 10-700bp can be obtained, the present invention designs the 5' or 3' primers on the MITE to be about 70bp away from the ends in their respective directions, and the estimated sequence obtained on the genome is 10-700bp. The technical personnel of the present invention designed specific primers at the 5' and 3' ends of MITE (as shown below) to anchor the location of the specific sequence at the end of the transposon. In addition, the corresponding adapter 1 (as shown in SEQ ID NO:27) and adapter 2 (as shown in SEQ ID NO:28), and adapter PCR primers (as shown in SEQ ID NO:29) were also designed. The adapter PCR primers match the sequencing primer sequence used in NGS second-generation high-throughput sequencing. The specific sequences of SEQ No:27-29 are as follows:

[0083] SEQ No:27 (Adaptor1):

[0084] Atgaagacgcaatagaacatg;

[0085] SEQ No:28 (Adaptor2):

[0086] Ttctattgcgtcttcatcctgttaataacac;

[0087] SEQ No:29 (Adaptor primer):

[0088] CAAGCAGAAGACGGCATACGAGATgcgtcttcatcctgttaa.

[0089] The present invention loads specific adapters with genome fragments interrupted by NlaIII (NEB, Cat. No R0125L). NlaIII is a highlight of the present invention. The use of this enzyme cutting site (4 bp) can obtain a large number of cutting sites from the chromosome, which is conducive to the capture of MITE sequences. At the same time, highly specific adapter sequences adapter 1 and adapter 2 are designed. Adapter 1 and adapter 2 are melted at high temperature and annealed, the program is 95°C for 2 minutes, and adapter 1 and adapter 2 are mixed and then slowly cooled to room temperature.

[0090] The sequences of specific primers used to detect MITE sites in the whole genome are shown in SEQ ID NO: 11-26, and the specific sequences are as follows:

[0091] SEQ No:11(rnd-1-38inner):

[0092] GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGCGTCAAACATTTCGAAACGGAGG;

[0093] SEQ No:12(rnd-1-56inner):

[0094] GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGTGGGAAATGCTAGAATGACTTACATTGTG;

[0095] SEQ No:13(rnd-1-58_1inner):

[0096] GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGTGCGATGTGCGCTAATGG;

[0097] SEQ No:14(rnd-1-58_2inner):

[0098] GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGTTTGAAAAGCGTGCCGG;

[0099] SEQ No:15(rnd-1-66_1inner):

[0100] GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGTGTCACATCCAGTACTAGGTTGG;

[0101] SEQ No:16(rnd-1-66_2inner):

[0102] GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGTTGTACTAGAATATGTCACATCCAG;

[0103] SEQ No:17(rnd-1-91_1inner):

[0104] GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGATGTGATGGAAAAGTTGGAAGTTTGAAG;

[0105] SEQ No:18(rnd-1-91_2inner):

[0106] GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGTTCCAATTTCAACCAAACTTCCAATTTTGG;

[0107] SEQ No:19(rnd-2-77_1inner):

[0108] GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGTTTTGCGTGCTAGGGAGTGAAGG:

[0109] SEQ No:20(rnd-2-77_2inner):

[0110] GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGGAAAACGAGGGAGATGAGTTGGG;

[0111] SEQ No:21(rnd-4-216_1inner):

[0112] GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGTCATACATTTAGAAACGGAGGGAGTAC;

[0113] SEQ No:22(rnd-4-216_2inner):

[0114] GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGGTAGTTTTCAGGTTTNTACTACATATATGG;

[0115] SEQ No:23(rnd-6-1845_1inner):

[0116] GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGTCAAAACGACTTATAATATGAAACGG;

[0117] SEQ No:24(rnd-6-2373_1inner):

[0118] GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGGAGTAAAGACGGTTTCTCCACCAG;

[0119] SEQ No:25(rnd-6-2373_2inner):

[0120] GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGGTTTTTATTGCAACCGGGACTATTGTGG;

[0121] SEQ No:26(rnd-6-18707inner):

[0122] GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCCCTTATATTATGGGACGGAGGGAG.

[0123] Example 2 NGS sequencing method to enrich MITE sites from rice genome

[0124] Select the reference genome NIP leaf sample and follow the steps below:

[0125] (1) Take 50 ng of rice genomic DNA and use NlaIII (NEB, Cat. No R0125L) at 37℃ for 5 hours to obtain the fragmentation product. The resulting DNA fragment is between 250 bp and 5 kb.

[0126] (2) Add 10 pM of adapter 1 and adapter 2 and 1 µl of T4 DNA ligase to the fragmented product, react at 25°C for 3 hours to obtain DNA fragments with adapters; in this step, the ratio of adapter to fragmented product is 10 pM:10 pM:50 ng.

[0127] (3) Recover the product using a PCR product purification kit.

[0128] (4) Add 10 pM of specific primers to the system, which are one or a mixed sample of several of SEQ No11-26, and the experimental strategy is a multiplex PCR strategy, 10 pM of adaptor primer, and 1 µg of the sample in step (3), and perform PCR under the amplification conditions of 95°C for 3 minutes. First, use the primers and adapter primers to amplify for 15 cycles under the conditions of 98°C for 10 seconds, 62°C for 20 seconds, and 72°C for 1 minute; and finally 72°C for 8 minutes.

[0129] (5) Recover the product using an equal volume of Beckman AMPure XP beads.

[0130] (6) NGS novaseq sequencing. The sequencing depth and alignment rate are shown in Table 1.

[0131] Example 3 Differences in enrichment of MITE sites from rice genome using different primer combinations

[0132] In Example 1, we analyzed the top 10 MITE families in terms of abundance and their number of sites. The number of sites predicted for these 10 families ranged from 2000 to 5000. A single family test could yield 10 3 However, it is difficult to obtain a site close to 10 4 If we test each family separately and then combine the data for testing, we may get 10 4 The number of sites at the same level is increased, but the cost and sample input amount are greatly increased, which is not conducive to efficient and low-cost application. It is true that there is differentiation in the sequences between different MITE families. The technical personnel of the present invention designed specific detection primers according to the sequence characteristics of each family in Example 1, and it is difficult to detect all target sites with one primer. Based on the above analysis, the technical personnel of the present invention adopted the idea of ​​multiple PCR in this design, mixing different primers to achieve the effect of increasing the number of sites in one experiment, and also tested the efficiency of several primers separately. According to this idea, 6 groups of experiments were carried out in this embodiment, each group used a different primer combination or a single primer, and the experimental system used was exactly the same. The primer combination method is shown in Table 1. The analysis results show that the mixed combination of MITE family-specific primers or a single primer used can achieve a 99% comparison rate with the genome, of which the proportion of single sites without duplication reaches 65%-71%.

[0133] Table 1 Alignment rates of NIP genome MITE detected by 6 different primer combinations of the method of the present invention

[0134]

[0135] According to the sequencing data, using the standard analysis process, the test results show that the number of sites with more than 10 reads is considered to be valid sequences. The number of valid sequences refers to the genome sequence containing the MITE sequence and the flanking sequence (the number of valid sequences on each chromosome and their proportion are shown in Table 2). The number of MITE transposons located by the valid sequences is shown in Table 2. Figure 4 and Figure 5 As shown, there are approximately 80,000 to 100,000 sites.

[0136] Table 2 The number of transposon sites on each chromosome of the MITE genome detected by the different primer combinations of the present invention using the standard analysis process

[0137]

[0138] Since the number of MITE transposons obtained by the standard method is about 100,000, far exceeding the amount required as a molecular marker or liquid phase chip, some primers of NIP1, NIP4, NIP5, and NIP6 overlap, and we believe that the MITE transposons detected should be consistent. By comparing and testing the sequencing stability, the analysis results show that 29,061 sites were detected in at least two materials, which are absolutely reliable sites.

[0139] Furthermore, the technicians of the present invention designed bioinformatics analysis parameters with stronger screening power, re-analyzed and screened, and selected sites with higher abundance of sequencing reads. The number of sites obtained by the six detection primer patterns is shown in Table 3. The number of sites for NIP1, NIP2, NIP3, NIP4, NIP5, and NIP6 in the predicted genome are 16181, 5623, 5401, 3214, 4565, and 2249, respectively, and the number of sites actually detected are 7730, 8891, 8692, 2629, 3088, and 7917, respectively. The number of sites and predicted genomic positions of NIP2, NIP3, NIP4, and NIP5 are consistent with our expectations. The distribution of NIP1 sites in the entire genome is shown in Figure 6 The NIP2, NIP3, NIP4, and NIP5 loci were merged to obtain 23,300 single loci.

[0140] Table 3 The number of transposon sites on each chromosome of the MITE genome detected by the strong screening and filtering process using different primer combinations of the present invention

[0141]

[0142] Although the present invention has been described in detail above with general descriptions and specific embodiments, it is obvious to those skilled in the art that some modifications or improvements can be made based on the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention.

Claims

1. A primer set for detecting MITE transposon insertion sites in rice genome, characterized in that: The primer set includes the following 16 primers: rnd-1-38inner, rnd-1-56inner, rnd-1-58_1inner, rnd-1-58_2inner, rnd-1-66_1inner, rnd-1-66_2inner, rnd-1-91_1inner, rnd-1-91_2inner, rnd-2-77_1inner, rnd-2-77_2inner, rnd-4-216_1inner, rnd-4-216_2inner, rnd-6-1845_1inner, rnd-6-2373_1inner, rnd-6-2373_2inner, rnd-6-18707inner, and the sequences of the 16 primers are shown in SEQ ID NOs: 11-26 respectively.

2. A kit for detecting MITE transposon insertion sites in a rice genome, characterized in that The kit includes 16 primers shown in SEQ ID NO:11-26, a linker primer shown in SEQ ID NO:29, and linkers 1 and 2 shown in SEQ ID NO:27 and 28.

3. Use of the primer set according to claim 1 or the kit according to claim 2 in high-throughput detection of whole-genome MITE transposon loci in the rice Nipponbare genome based on second-generation sequencing.

4. A method for isolating the genome sequence of the MITE transposon insertion site of Nipponbare rice, characterized in that: The following steps are involved: Step 1, extracting rice genomic DNA, and using a shearing enzyme to shear the DNA to obtain a DNA fragment between 250 bp and 5 kb, wherein the shearing enzyme is NlaIII restriction endonuclease; Step 2: Connect the DNA fragment obtained in step 1 to adapter 1 and adapter 2 using DNA ligase to obtain a DNA fragment with an adapter, and recover the DNA fragment with an adapter using a kit; Step 3: using 16 primers shown in SEQ ID NO: 11-26 and adapter primers to perform a round of PCR amplification on the DNA fragment with adapter recovered in step 2 to obtain an amplified product; Step 4: Recover the amplified product obtained in step 3, quantify it, and sequence it using a second-generation sequencer. Compare the sequencing result with the rice genome sequence to obtain the corresponding site; Wherein, the adapter 1 and adapter 2 described in step 2, and the 16 primers and adapter primer described in step c are from the kit described in claim 2.

5. The method according to claim 4, characterized in that In the step 1, the interruption condition is incubation at 37° C. for 1-5 hours.

6. The method according to claim 4, characterized in that In the step 2, the DNA ligase is T4 DNA ligase, and the ligation condition is incubation at 25° C. for 1-3 hours.

7. The method according to claim 4, characterized in that In the step 2, the ratio of adapter 1, adapter 2 and DNA fragment is 10 pM: 10 pM: 50 ng.

8. The method according to claim 4, characterized in that In the step 3, the PCR amplification conditions are: 95°C for 3 minutes, first using the 16 primers shown in the sequence SEQ ID NO: 11-26 and the adapter primer to amplify for 15 cycles, the conditions are 98°C for 10 seconds, 62°C for 20 seconds, 72°C for 1 minute; and finally 72°C for 8 minutes.

Images