Primer composition for genotype drug resistance detection based on HIV-1 PR and RT full length and application of primer composition

Abstract

The invention discloses a primer composition for genotype drug resistance detection based on HIV-1PR and RT full length and application of the primer composition. The primer group provided by the invention consists of a DNA molecule as shown in a sequence 1 of a sequence table, a DNA molecule as shown in a sequence 2 of the sequence table, a DNA molecule as shown in a sequence 3 of the sequence table and a DNA molecule as shown in a sequence 4 of the sequence table. The method can be applied to HIV-1 strain genotype drug resistance detection, is beneficial to understanding the real epidemic drug resistance condition of the HIV-1 strain, has potential application prospects in HIV-1 genotype drug resistance detection and HIV infected person treatment scheme adjustment, and provides reference for clinical doctors to formulate accurate antiviral treatment schemes for individuals.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to a primer composition for genotype drug resistance detection based on the full length of HIV-1 PR and RT and an application thereof. Background Art

[0002] Acquired Immune Deficiency Syndrome (AIDS) is an infectious disease caused by infection with the human immunodeficiency virus (HIV). Since the first case was reported in the United States in 1981, AIDS has spread all over the world and has become a major infectious disease threatening human health. As of 2021, there are approximately 38.4 million HIV-infected people and patients in the world; in 2021, there will be approximately 1.5 million new HIV infections and approximately 650,000 deaths from AIDS worldwide (http: / / www.unaids.org / ).

[0003] In order to effectively control the rapid progression and spread of this disease, antiretroviral therapy (ART) has emerged as a measure to control the course of the individual disease and also as a means to manage the source of infection. Clinical experimental studies have shown that ART has significantly reduced the morbidity and mortality of HIV-infected people. To date, more than 30 drugs have been marketed worldwide for HIV antiviral treatment. According to the different drug targets, they are mainly divided into nucleoside reverse transcriptase inhibitors (NRTIs), nonnucleoside reverse transcriptase inhibitors (NNRTIs), protease inhibitors (PIs), integrase inhibitors (INs) and fusion inhibitors (FIs). However, with the rapid expansion of treatment, millions of HIV-infected people start and maintain antiviral treatment for a long time every year, which poses a huge risk of the generation and spread of drug-resistant strains. The widespread prevalence of drug-resistant HIV-1 strains caused by antiviral treatment is a public health challenge facing the world.

[0004] In the prevention and treatment of AIDS, timely HIV-1 drug resistance testing and understanding of the drug resistance status of individuals and groups play an important role. First, drug resistance testing of HIV-1 infected people can monitor and understand the prevalence, development trend and influencing factors of HIV-1 drug-resistant strains; second, drug resistance testing of infected people before antiviral treatment can guide the attending physician to formulate accurate antiviral treatment plans to ensure the effectiveness of antiviral treatment; third, drug resistance testing of patients who have failed antiviral treatment can be performed. Clinicians can analyze the reasons for treatment failure through test results and adjust antiviral treatment plans in time. HIV-1 drug resistance detection methods can be divided into two categories: one is phenotypic detection and the other is genotypic detection. HIV-1 phenotypic drug resistance detection is based on in vitro culture technology. By detecting the drug concentration IC50 required to inhibit viral growth by 50% in the sample to be tested, it is compared with the sensitive reference strain to determine the degree of drug resistance of the virus to be tested. Phenotypic drug resistance detection is the gold standard for HIV-1 drug resistance detection. It can detect potential drug resistance mutation sites that have not yet been discovered and effectively explain the synergistic and antagonistic effects of multiple drug resistance mutation sites. However, phenotypic drug resistance detection has a long cycle, high cost, and high laboratory requirements. HIV-1 genotypic drug resistance detection is based on the detection of drug resistance-related gene mutations and uses a genotypic drug resistance interpretation system to determine whether the virus is resistant and the degree of resistance. Compared with phenotypic drug resistance detection, genotypic drug resistance detection has the advantages of short detection cycle, low cost, simplicity, and easy promotion. It has great applications in a wide range of drug resistance monitoring, antiviral treatment effect evaluation, and antiviral treatment regimen selection. It is also the most widely used method.

[0005] HIV-1 genotype resistance detection methods are all targeted at drug targets. ART usually includes two nucleoside reverse transcriptase inhibitors and one non-nucleoside reverse transcriptase inhibitor or one protease inhibitor. Therefore, the most commonly used HIV-1 genotype resistance detection covers the full length of the protease and part of the reverse transcriptase region, with a base length of approximately 1.3kb. This region covers the targets of all protease inhibitors and major reverse transcriptase inhibitors. The virus's tolerance to drugs can be assessed by detecting genetic mutations in this region and the interactions between mutations. The effects of mutations in the drug target region on drug sensitivity have been studied more thoroughly, but with the deepening of HIV-1 resistance research, it has been found that resistance sites are not limited to drug targets, and some mutations outside the target can also lead to tolerance to the drugs used. For example, some mutations in the RT linker region and RNase H region outside the target of reverse transcriptase inhibitors can lead to resistance to them. Among them, mutations E312Q, G335C / D, N348I, A360I / V, V365I and A376S are all related to AZT resistance. The linker region mutation A371V and the RNaseH region mutation Q509L significantly enhance the strain's tolerance to AZT in the presence of thymidine analog mutations (TAMs).

[0006] Therefore, establishing genotype resistance detection methods in more drug-resistant site areas can obtain more complete drug resistance detection and monitoring data, providing important technical support for AIDS prevention and treatment in my country. Summary of the invention

[0007] The technical problem solved by the present invention is how to detect more HIV-1 genotype drug resistance.

[0008] In order to solve the above problems, the first aspect of the present invention provides a primer set, which consists of a DNA molecule shown in sequence 1 of the sequence listing, a DNA molecule shown in sequence 2 of the sequence listing, a DNA molecule shown in sequence 3 of the sequence listing, and a DNA molecule shown in sequence 4 of the sequence listing.

[0009] The functions of the above primer set are any of the following:

[0010] 1) Amplify the full-length fragments of human immunodeficiency virus type Ⅰ PR and RT regions;

[0011] 2) Detection or auxiliary detection of human immunodeficiency virus type I genotype resistance;

[0012] 3) Identify or assist in identifying whether the sample to be tested is infected with human immunodeficiency virus type 1 or contains human immunodeficiency virus type 1 nucleic acid;

[0013] 4) Identify or assist in identifying drug resistance sites of human immunodeficiency virus type 1.

[0014] In a second aspect, the present invention provides a PCR reagent or kit comprising the primer set described in the first aspect.

[0015] The PCR reagents described above include PCR reagent 1 and PCR reagent 2;

[0016] The PCR reagent 1 includes the DNA molecule shown in sequence 1 of the sequence list and the DNA molecule shown in sequence 2 of the sequence list. In the PCR reagent 1, the final concentration of each primer is 20 μM.

[0017] The PCR reagent 2 includes the DNA molecule shown in sequence 3 of the sequence list and the DNA molecule shown in sequence 4 of the sequence list. In the PCR reagent 2, the final concentration of each primer is 20 μM.

[0018] In a third aspect, the present invention provides the use of the primer set described in the first aspect or the PCR reagent described in the second aspect in preparing a product having any of the following functions:

[0019] 1) Amplify the full-length fragments of human immunodeficiency virus type Ⅰ PR and RT regions;

[0020] 2) Detection or auxiliary detection of human immunodeficiency virus type I genotype resistance;

[0021] 3) Identify or assist in identifying whether the sample to be tested is infected with human immunodeficiency virus type 1 or contains human immunodeficiency virus type 1 nucleic acid;

[0022] 4) Identify or assist in identifying drug resistance sites of human immunodeficiency virus type 1.

[0023] The above product can be a test kit.

[0024] In a fourth aspect, the present invention provides a method for assisting in identifying whether a sample to be tested is infected with human immunodeficiency virus type 1 or contains human immunodeficiency virus type 1 nucleic acid, comprising the following steps:

[0025] (1) using the nucleic acid of the sample to be tested as a template, and using a primer pair consisting of a DNA molecule represented by sequence 1 in the sequence listing and a DNA molecule represented by sequence 2 in the sequence listing to perform a first round of PCR to obtain a first round of PCR amplification product;

[0026] (2) using the first round PCR amplification product as a template, and using a primer pair consisting of a DNA molecule represented by sequence 3 in the sequence listing and a DNA molecule represented by sequence 4 in the sequence listing to perform PCR amplification to obtain a second round PCR amplification product;

[0027] The second-round PCR amplification product is detected. If the second-round PCR amplification product has a product of 2020-2060 bp, the candidate sample to be tested is infected with human immunodeficiency virus or contains human immunodeficiency virus type I nucleic acid; otherwise, the candidate sample to be tested is not infected with human immunodeficiency virus or contains human immunodeficiency virus type I nucleic acid.

[0028] If the nucleic acid is DNA, the first round of PCR is PCR amplification;

[0029] If the nucleic acid is RNA, the first round of PCR is RT-PCR amplification.

[0030] In a fifth aspect, the present invention provides a method for identifying a human immunodeficiency virus resistance site in a sample to be tested, comprising the following steps: (1) using the nucleic acid of the sample to be tested as a template, and using a primer pair consisting of a DNA molecule shown in sequence 1 of the sequence table and a DNA molecule shown in sequence 2 of the sequence table to perform a first round of PCR to obtain a first round of PCR amplification product;

[0031] (2) using the first round PCR amplification product as a template, and performing PCR amplification using a primer pair consisting of a DNA molecule represented by sequence 3 in the sequence listing and a DNA molecule represented by sequence 4 in the sequence listing to obtain a second round PCR amplification product;

[0032] Detecting the second-round PCR amplification product, if the second-round PCR amplification product has a product of 2020-2060 bp, the candidate sample to be tested is infected with human immunodeficiency virus or contains human immunodeficiency virus type I nucleic acid; otherwise, the candidate sample to be tested is not infected with human immunodeficiency virus or contains human immunodeficiency virus type I nucleic acid;

[0033] (3) Sequencing the second-round PCR amplification products of the candidate sample infected with human immunodeficiency virus or containing human immunodeficiency virus type I nucleic acid to determine the drug resistance site of the sample.

[0034] The above second-round PCR amplification product sequencing is used to determine the drug resistance site of the sample to be tested. Specifically, the second-round PCR amplification product sequencing results are submitted to the Stanford Drug Resistance Database (https: / / hivdb.stanford.edu / ) for analysis to determine each drug resistance site in the second-round PCR amplification product, thereby determining the drug resistance site of the sample to be tested.

[0035] The human immunodeficiency virus type I mentioned above may specifically be HIV-1 CRF01_AE, CRF07_BC or other subtype strains prevalent in China.

[0036] The present invention obtains a set of primer pairs that can cover the drug resistance detection of HIV-1 PR and RT regions of various subtypes of strains by comparing the conservative regions of the full-length sequences of 689 main HIV-1 epidemic strains in my country. And by using plasma specimens of the main HIV epidemic strains in my country and specimens of other viruses (HBV, HCV), the set of primer pairs is specifically identified, proving that the set of primer pairs of the present invention can effectively detect the main HIV-1 epidemic strains in my country, is suitable for nucleic acid detection of various subtype strains, and has no cross reaction with HBV and HCV. The present invention can be applied to HIV-1 strain genotype drug resistance detection, helps to understand the real drug resistance of HIV-1 strains, has potential application prospects for HIV-1 genotype drug resistance detection and adjustment of HIV infected person treatment regimen, and provides reference for clinicians to formulate accurate antiviral treatment regimens for individuals. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 This is an agarose gel electrophoresis identification diagram of the amplified product of the 1.3 kb short fragment (HXB2: 2253-3550) of the pol region of the HIV-1 recombinant strain prevalent in my country (N=96, DNA Marker2000).

[0038] Figure 2 This is an agarose gel electrophoresis identification diagram of the amplified product of the 2.1kb short fragment (HXB2:2011-4072) of the pol region of the HIV-1 recombinant strain prevalent in my country (N=96, DNA Marker5000).

[0039] Figure 3 Electrophoresis diagram for specific identification of primer combination (HBV, HCV and negative control: water, DNA Marker5000).

[0040] Figure 4 The electrophoresis diagram is for the specific identification of the primer combination (healthy person, DNA Marker5000). DETAILED DESCRIPTION

[0041] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0042] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0043] Unless otherwise specified, the quantitative tests in the following examples were performed three times and the results were averaged.

[0044] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0045] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0046] The following examples are provided to facilitate a better understanding of the present invention, but are not intended to limit the present invention.

[0047] In the following examples, HBV represents human hepatitis B virus, and HCV represents human hepatitis C virus.

[0048] Example 1: Establishment of primer combination and method for detecting full-length fragments of PR and RT regions of HIV-1

[0049] 1. Design of primer combination

[0050] Based on the approximate full-length sequences of 689 major HIV-1 strains in my country, including HIV-1CRF01_AE, CRF07_BC and other strains (from HIV Database), the conserved regions of the above sequences were analyzed using BioEdit software. Based on the sequence analysis results, a set of nested PCR amplification primer combinations were designed using Primer 5.0 software in the conserved regions of the full-length fragments of HIV-1 PR and RT regions (approximately 2.1 kb, HXB2: 2011-4072 nt, the Genbank number of HXB2 is K03455, and the submission date is 2002.12.21). The primer combination consists of four primers, namely primers F1817, R4175, F2011 and R4072.

[0051] The sequences of the primers in the primer combination and the positions of the genes they target are shown in Table 1.

[0052] Table 1 shows the sequences of each primer and the location of the gene targeted

[0053]

[0054] Table 2 shows the sequencing primers

[0055]

[0056]

[0057] 2. Establishment of a method for detecting the full-length fragments of the PR and RT regions of HIV-1

[0058] 1. Extract RNA from the sample to be tested.

[0059] The sample to be tested can be the virus itself or plasma.

[0060] 2. Using the RNA from step 1 as a template, perform RT-PCR (first round of PCR amplification) using a primer pair consisting of primers F1817 and R4175 to obtain the first round of PCR amplification products.

[0061] The reaction system for the first round of PCR amplification is shown in Table 3.

[0062] Table 3 shows the reaction system for the first round of PCR amplification

[0063] Element Volume(ul) PrimeScript 1Step Enzyme Mix 1.0 2×1Step Buffer(Dye Plus) 12.5 Forward first round primer F1817 (20 μM) 0.5 Reverse first round primer R4175 (20 μM) 0.5 RNA 5 <![CDATA[ddH2O]]> 5.5 Total 25

[0064] The reaction program of the first round of PCR amplification is shown in Table 4.

[0065] Table 4 shows the reaction procedure for the first round of PCR amplification

[0066]

[0067] 3. Using the first-round PCR amplification product as a template, perform PCR (second-round PCR amplification) with a primer pair consisting of F2011 and R4072 to obtain the second-round PCR amplification product.

[0068] The reaction system for the second round of PCR amplification is shown in Table 5.

[0069] Table 5 is the reaction system for the second round of PCR amplification

[0070] Element Volume(ul) Premix Taq(Ex Taq Version 2.0plus dye) 15 Forward second round primer F2011 (20 μM) 0.6 Reverse second round primer R4072 (20 μM) 0.6 The first round of PCR amplification products 1 <![CDATA[ddH2O]]> 12.8 Total 30

[0071] The reaction program of the second round of PCR amplification is shown in Table 6.

[0072] Table 6 is the reaction program for the second round of PCR amplification

[0073]

[0074] 4. The second round of PCR amplification products were subjected to 1% agarose gel electrophoresis.

[0075] If the size of the PCR product is 2060 bp (the size can be further sequenced to confirm the size), the sample to be tested contains or is a candidate to contain the full-length fragment of the PR and RT regions of HIV-1 (recorded as HIV-1pol 2.1 kb, HXB2: 2011-4072 nt; covering the PR+partial RT region (about 1.3 kb) of conventional HIV drug resistance detection), or the sample to be tested is infected or is a candidate to be infected with HIV-1, or the sample to be tested contains or is a candidate to contain HIV-1 nucleic acid; or the virus to be tested is or is a candidate to be HIV-1;

[0076] If the size of the PCR product is not 2060bp (the size can be further sequenced to confirm), the sample to be tested does not contain or the candidate does not contain the full-length fragments of the PR and RT regions of HIV-1; or the sample to be tested is not infected or the candidate is not infected with HIV-1, or the sample to be tested does not contain or the candidate does not contain HIV-1 nucleic acid; or the virus to be tested is not or the candidate is not HIV-1.

[0077] 5. Identify resistance sites

[0078] The 2060 bp second-round PCR amplification product obtained in 4 above was sequenced and spliced ​​and submitted to the Stanford Drug Resistance Database (https: / / hivdb.stanford.edu / ) for analysis to determine the various drug resistance sites in the second-round PCR amplification product, thereby determining the drug resistance sites of the sample to be tested.

[0079] Example 2: Application of primer combination

[0080] (I) Identification of HIV-1 infection

[0081] 1. Experimental Sample

[0082] Plasma specimens from 96 clinically confirmed HIV-1 infected persons (informed consent volunteers) were used as experimental samples, including 34 patients infected with HIV-1 CRF01_AE strain, 20 patients infected with HIV-1 CRF07_BC, and 42 patients infected with other subtypes of HIV-1 (CRF08_BC, CRF55_01B, B, C, etc.).

[0083] 2. Application of primer combination

[0084] The plasma of each patient in step 1 was subjected to the following experiments:

[0085] The plasma RNA was extracted and tested according to the method of Example 1.

[0086] Results Figure 2 Some samples showed a 2060bp specific band at the same position (recorded as HIV-1pol2.1kb in the table), and these samples were regarded as positive samples.

[0087] Using primers for detecting HIV-1 pol 1.3 kb (Table 7) as a control, PCR amplification was first performed using DR1-1 and DR1-2 to obtain the first round of amplification products, and then PCR amplification was performed using DR1-3 and DR1-4 to obtain the second round of amplification products.

[0088] The results are as follows Figure 1 As shown, 1.3kb was obtained as a positive sample.

[0089] Table 7 shows the sequence of each primer and the location of the gene targeted (HIV-1pol1.3kb)

[0090] Primer name Sequence (5′-3′) Location (HXB2) DR1-1 TTGGAAATGTGGAAAGGAAGGAC 2028→2050 DR1-2 CTGTATTTCTGCTATTAAGTCTTTTGATGGG 3539→3509 DR1-3 CAGAGCCAACAGCCCCACCA 2147→2166 DR1-4 CTGCCAGTTCTAGCTCTGCTTC 3462→3441 DR1-S1* GCCAACAGCCCCACCA 2151→2166 DR1-S2* GGACCTACACCTGTCAAC 2484→2501 DR1-S3* CCTAGTATAAACAATGAGACAC 2946→2967 DR1-S4* GCTGGGTGTGGTATTCC 3144→3128 DR1-S5* GTTCTAGCTCTGCTTC 3456→3441

[0091] * HIV-1pol1.3 sequencing primer

[0092] The test results of each sample are shown in Table 8.

[0093] Table 8 is a comparison of the identification results of pol 1.3kb and pol 2.1kb in 96 clinically confirmed HIV-infected individuals

[0094]

[0095]

[0096] In the 96 samples of patients infected with HIV-1 selected in this embodiment, the positive rates of HIV-1pol 1.3kb short fragment amplification results and HIV-1pol 2.1kb amplification results were consistent, both of which were 87.5%. Compared with HIV-1pol 1.3kb short fragment, HIV-1pol2.1kb amplification product bands were almost all single bands, and the sensitivity of the primer combination was good.

[0097] (II) Detection of drug resistance sites

[0098] The 2060bp specific bands of each sample in (I) above were sent for sequencing, and 68 drug-resistant samples were tested and submitted to the Stanford drug resistance database for analysis. It can be seen that the drug resistance sites of the 68 samples are as shown in Table 9 below;

[0099] Table 9 shows the results of drug resistance identification of pol 2.1kb in 68 clinically confirmed HIV-infected individuals

[0100] Resistance sites Number of cases percentage PI M46L 2 2.94％ M46I 1 1.47％ G48V 1 1.47％ None 64 94.12％ NRTI K219R 1 1.47％ S68G 1 1.47％ A62V 1 1.47％ None 65 95.59％ NNRTI V106I 4 5.88％ V106M 1 1.47％ V179D 1 1.47％ V179E 1 1.47％ None 61 89.71％

[0101] The 1.3kb specific bands of each sample in (I) above were sent for sequencing, and 67 resistant samples were tested and submitted to the Stanford Drug Resistance Database for analysis. It can be seen that the drug resistance sites of the 67 samples are shown in Table 10 below.

[0102] Table 10 shows the results of drug resistance identification of pol 1.3kb in 96 clinically confirmed HIV-infected individuals

[0103]

[0104]

[0105] From the above, it can be seen that the detection rate of drug-resistant sites of the present invention is not inferior to 1.3kb.

[0106] Example 3: Specificity of primer combination

[0107] 1. Experimental Sample

[0108] Twenty-two HBV-infected patients with clinical diagnosis and positive nucleic acid test (informed consent volunteers; numbered 1: HBV-13699; 2: HBV-13704; 3: HBV-13711; 4: HBV-13716; 5: HBV-13732; 6: HBV-13876; 7: HBV-13899; 8: HBV-13905; 9: HBV-16032; 10: HBV-16073; 11: :HBV-18147; 12: HBV-18166; 13: HBV-18186; 14: HBV-18233; 15: HBV-18302; 16: HBV-18388; 17: HBV-18779; 18: HBV-18790; 19: HBV-18834; 20: HBV-18865; 21: HBV-18915; 22: HBV-18938) were used as experimental samples;

[0109] Twenty HCV-infected subjects with clinical diagnosis and positive nucleic acid test (informed consent volunteers; numbered 1: HCV-13671; 2: HCV-13673; 3: HCV-13755; 4: HCV-13878; 5: HCV-13879; 6: HCV-14045; 7: HCV-14357; 8: HCV-14069; 9: HCV-17529; 10: HCV-17529) were enrolled in the study. :HCV-17532; 11: HCV-17591; 12: HCV-17635; 13: HCV-17763; 14: HCV-17905; 15: HCV-17958; 16: HCV-18029; 17: HCV-18059; 18: HCV-18234; 19: HCV-18102; 20: HCV-18252) were used as experimental samples.

[0110] 48 healthy subjects with negative nucleic acid test results (informed consent volunteers; numbered 1: 1821, 2: 1822, 3: 1823, 4: 1824, 5: 1825, 6: 1826, 7: 1827, 8: 1828, 9: 1829, 10: 1830, 11: 1831, 12: 1832, 13: 1833, 14: 1834, 15: 1835, 16: 1836, 17: 1837, 18: 1838, 19: 1839, 20: 1840, 21: 1841, 22: 1842, 23: 1843, 24: 1844 45: 1865, 46: 1866, 47: 1867, 48: 1868, 49: 1859, 50: 1860, 51: 1861, 52: 1862, 53: 1863, 54: 1864, 55: 1865, 56: 1866, 57: 1867, 58: 1868) were used as negative control samples in the experiment.

[0111] 2. Application of primer combination

[0112] The samples of HCV patients and healthy subjects in step 1 were subjected to the same experiment as step 2 of Example 2.

[0113] Since HBV is a DNA virus, the samples of HBV patients in step 1 were subjected to the following experiments:

[0114] 1. Extract viral DNA.

[0115] 2. Using the DNA from step 1 as a template, perform PCR (first round PCR amplification) using a primer pair consisting of primers F1817 and R4175 to obtain the first round PCR amplification product.

[0116] The reaction system for the first round of PCR amplification is shown in Table 11.

[0117] Table 11 is the reaction system for the first round of PCR amplification

[0118] Element Volume(ul) Premix Taq(Ex Taq Version 2.0plus dye) 12.5 Forward first round primer F1817 (20 μM) 0.5 Reverse first round primer R4175 (20 μM) 0.5 DNA 5 <![CDATA[ddH2O]]> 6.5 Total 25

[0119] The reaction program for the first round of PCR amplification is shown in Table 12.

[0120] Table 12 shows the reaction procedure for the first round of PCR amplification

[0121]

[0122] The second round of PCR amplification reaction system and reaction procedure were the same as step 2 of Example 1.

[0123] The agarose gel of the second round of PCR amplification products is shown in Figure 3 and Figure 4 .

[0124] The experimental sample that amplified 2060 bp was a positive sample, indicated by "+". The experimental sample that did not amplify 2060 bp was a negative sample, indicated by "-".

[0125] The test results of each sample are shown in Tables 13 and 14.

[0126] Table 13 shows the identification results of each infected person (HBV and HCV)

[0127]

[0128] Table 14 shows the identification results of healthy people

[0129]

[0130]

[0131] All samples were negative. The results showed that the primer combination provided by the present invention had no cross-positive results for the detection of two other viruses and healthy people, had very good specificity, and was a good amplification and identification primer.

[0132] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. A primer set, which consists of a DNA molecule shown in sequence 1 of a sequence listing, a DNA molecule shown in sequence 2 of a sequence listing, a DNA molecule shown in sequence 3 of a sequence listing, and a DNA molecule shown in sequence 4 of a sequence listing.

2. The primer set according to claim 1, characterized in that: The function of the primer set is any of the following: 1) Amplify the full-length fragments of human immunodeficiency virus type Ⅰ PR and RT regions; 2) Detection or auxiliary detection of human immunodeficiency virus type I genotype resistance; 3) Identify or assist in identifying whether the sample to be tested is infected with human immunodeficiency virus type 1 or contains human immunodeficiency virus type 1 nucleic acid; 4) Identify or assist in identifying drug resistance sites of human immunodeficiency virus type 1.

3. A PCR reagent or kit containing the primer set according to claim 1 or 2.

4. Use of the primer set according to claim 1 or 2 or the PCR reagent according to claim 3 in preparing a product having any of the following functions: 1) Amplify the full-length fragments of human immunodeficiency virus type Ⅰ PR and RT regions; 2) Detection or auxiliary detection of human immunodeficiency virus type I genotype resistance; 3) Identify or assist in identifying whether the sample to be tested is infected with human immunodeficiency virus type 1 or contains human immunodeficiency virus type 1 nucleic acid; 4) Identify or assist in identifying drug resistance sites of human immunodeficiency virus type 1.

5. A method for assisting in identifying whether a sample to be tested is infected with human immunodeficiency virus type 1 or contains human immunodeficiency virus type 1 nucleic acid, comprising the following steps: (1) using the nucleic acid of the sample to be tested as a template, and using a primer pair consisting of a DNA molecule represented by sequence 1 in the sequence listing and a DNA molecule represented by sequence 2 in the sequence listing to perform a first round of PCR to obtain a first round of PCR amplification product; (2) using the first round PCR amplification product as a template, and using a primer pair consisting of a DNA molecule represented by sequence 3 in the sequence listing and a DNA molecule represented by sequence 4 in the sequence listing to perform PCR amplification to obtain a second round PCR amplification product; The second-round PCR amplification product is detected. If the second-round PCR amplification product has a product of 2020-2060 bp, the candidate sample to be tested is infected with human immunodeficiency virus or contains human immunodeficiency virus type I nucleic acid; otherwise, the candidate sample to be tested is not infected with human immunodeficiency virus or does not contain human immunodeficiency virus type I nucleic acid.

6. A method for identifying or assisting in identifying drug-resistant sites of human immunodeficiency virus in a sample to be tested, comprising the following steps: (1) using the nucleic acid of the sample to be tested as a template, and using a primer pair consisting of a DNA molecule represented by sequence 1 in the sequence listing and a DNA molecule represented by sequence 2 in the sequence listing to perform a first round of PCR to obtain a first round of PCR amplification product; (2) using the first round PCR amplification product as a template, and using a primer pair consisting of a DNA molecule represented by sequence 3 in the sequence listing and a DNA molecule represented by sequence 4 in the sequence listing to perform PCR amplification to obtain a second round PCR amplification product; Detecting the second-round PCR amplification product, if the second-round PCR amplification product has a product of 2020-2060 bp, then the candidate sample to be tested is infected with human immunodeficiency virus or contains human immunodeficiency virus type I nucleic acid; Otherwise, the candidate sample to be tested is not infected with human immunodeficiency virus or contains human immunodeficiency virus type I nucleic acid; (3) Sequencing the second-round PCR amplification products of the candidate sample infected with human immunodeficiency virus or containing human immunodeficiency virus type I nucleic acid to determine the drug resistance site of the sample.

Images