Sensor constructed by DNA (deoxyribonucleic acid) nanotechnology and used for detecting mycotoxin and preparation method of sensor

Abstract

The invention belongs to the technical field of electrochemical biosensors, and discloses an electrochemical method and an electrochemical sensor constructed by a DNA nanotechnology and used for detecting mycotoxin. The invention has the advantages of simple sample preparation, convenient operation, low cost, wide linear range, low detection limit, high sensitivity, high specificity, good reproducibility and good stability; a unique triple signal amplification strategy, including a tripedal DNA walker, a 3D DNAzyme walker and HCR, is utilized to be connected to the surface of MoS2 / Au for self-assembly by utilizing four-way, so that the binding capacity of methylene blue MB molecules is improved, the electrochemical response capacity is enhanced, the sensitivity of the sensor is improved, the linear range of aflatoxin B1 is 0.01-1000ng / mL, the detection limit is 0.0062 ng / mL, and the sensitivity of the sensor is improved. The linear range of the corn ketene is 0.01 to 100 ng / mL, and the detection limit of the corn ketene is 0.0046 ng / mL; according to the invention, other mycotoxins in an agricultural environment can be detected by replacing corresponding mycotoxin aptamers, and the mycotoxin aptamer has multifunctionality and wider application potential, and has a good application prospect.

Description

Technical Field

[0001] The invention belongs to the technical field of electrochemical biosensors, and relates to a sensor constructed by DNA nanotechnology for detecting mycotoxins and a preparation method thereof. Background Art

[0002] Mycotoxins are toxic secondary metabolites produced by organisms in the fungal kingdom that can cause illness and death in humans and other animals. Such mycotoxins include aflatoxins, limonene, fumigants, ochratoxin A, patulin, mucorene, zearalenone and alkaloids such as ergot alkaloids. At present, the problem of mycotoxins in food has attracted widespread attention around the world, prompting many governments to establish limit standards to protect public health. Among them, aflatoxins are a class of extremely harmful metabolites produced by parasitic Aspergillus and Aspergillus flavus, and are inevitable contaminants in food and feed. Zearalenone is another ubiquitous mycotoxin, known for its widespread contamination, strong toxicity, and persistent presence in agricultural products, especially grains. The accumulation of zearalenone toxins in the human body can lead to immunotoxicity, cytotoxicity, and reproductive toxicity.

[0003] In order to ensure food safety, it is crucial to develop highly sensitive and specific methods to detect mycotoxins in food samples. Current traditional technologies such as high performance liquid chromatography (HPLC), liquid chromatography / mass spectrometry (LC / MS) and enzyme-linked immunosorbent assay (ELISA) provide excellent accuracy and reliability. However, these traditional methods often require expensive equipment and a large amount of samples for pretreatment, and due to their complex procedures, the detection process is more time-consuming. Therefore, it is necessary to develop a more efficient and simple detection method. Since electrochemical biosensors have the advantages of simple operation, high sensitivity, low cost, and ease of on-site use, the inventors have developed a multifunctional electrochemical sensing platform. Summary of the invention

[0004] In view of this, the object of the present invention is to provide an electrochemical sensor and detection method with simple sample preparation, convenient operation and low cost.

[0005] To achieve the above object, the present invention provides an electrochemical method for detecting mycotoxins constructed by DNA nanotechnology, comprising the following steps:

[0006] S1: Preparation of 3D DNAzyme walkers and obtaining short-chain DNA

[0007] 100 μL of 25 mM Tris-acetate buffer with a pH of 8.3 was mixed with Fe3O4, substrate chain and aptamer, and the mixture was incubated at 37°C for 12 h, then washed with a magnet, and then 10 μL of the sample to be tested containing mycotoxin 1 and rocker DNA were added, and incubated at 37°C for 20 min to form a 3D DNAzyme walker;

[0008] Then, 5 μL of 20 mM MgCl2 was added to the 3D DNAzyme walker, and the reaction was carried out at 37°C for 10 h. Then, a magnet was used to obtain the supernatant and collect the short-chain DNA.

[0009] The sequence of the substrate chain is shown in SEQ ID NO.1, and the 5' end of the substrate chain is modified with biotin; the sequence of the rocker DNA is shown in SEQ ID NO.3;

[0010] S2: Preparation of MoS2 / Au nanomaterials

[0011] 1 mg / mL MoS2 was dispersed in 50 mL ultrapure water and heated to boiling while stirring. After 5 minutes, 1 mL of 2% HAuCl4 and 8 mL of 1% sodium citrate were added in sequence. After 10 minutes, the mixture was cooled to room temperature. The product was collected by centrifugation, washed with distilled water for 4 times, and dried in an oven at 60°C for 10 hours to obtain MoS2 / Au.

[0012] S3: Synthesis of MoS2 / Au / A1 / four-way and MoS2 / Au / A2 / four-way

[0013] The four-way hairpin structure is composed of the following four DNA chains: H1, H2, H3 and QS. The above H1, H2, H3 and QS are added to the buffer PBS;

[0014] In order to form a hairpin structure, the above H1, H2 and H3 were pretreated at 95°C for 5 min and then gradually cooled to room temperature; then, the four-way hairpin structure mixed with PBS was mixed with the MoS2 / Au obtained in step S2, and then A1 or A2 was added and incubated for 2 h to obtain MoS2 / Au / A1 / four-way or MoS2 / Au / A2 / four-way;

[0015] The sequences of H1, H2, H3 and QS are shown in SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6 and SEQ ID NO.7, respectively, wherein the 5' end of QS is modified with HS-(CH2)6; the sequences of A1 and A2 are shown in SEQ ID NO.8 and SEQ ID NO.9, respectively, wherein the 5' end of A1 is modified with a thiol group, and the 3' end of A2 is modified with a thiol group;

[0016] S4: Preparation of tripedal DNA walker

[0017] 10 μL of the sample containing mycotoxin II was mixed with 20 μL of a 1 nM DNA mixture, which included mycotoxin II aptamer and hairpins MB1, MB2 and MB3, and then a PBS buffer solution was added. The mixture was stored at 37°C for 50 min to form a fully assembled and stable tripedal DNA walker.

[0018] Among them, the sequences of MB1, MB2 and MB3 are shown in SEQ ID NO.11, SEQ ID NO.12 and SEQ ID NO.13 respectively;

[0019] S5: Construction of COF / MoS2 / AuPt electrode for simultaneous detection of mycotoxins I and II

[0020] The prepared COF suspension was dropped onto the Au surface and dried at room temperature to obtain COF@Au; MoS2 was then dropped onto the COF@Au surface to obtain MoS2 / COF@Au, and MoS2 / COF@Au was immersed in a 1mM HAuCl4 and 1mM H2PtCl6 solution containing 0.01M H2SO4, and electrolyzed at -1.6V to 0.6V to stabilize the AuPt nanoparticles on the electrode surface. After the electrodeposition was completed, the COF / MoS2 / AuPt electrode was gently washed with distilled water and dried at room temperature to obtain the final COF / MoS2 / AuPt electrode;

[0021] S6: Electrochemical analysis of mycotoxins I and II

[0022] First, MB4 was dripped onto the COF / MoS2 / AuPt electrode prepared in step S5 to control the working area of ​​the electrode, and then the electrode was treated with MCH at a concentration of 1 mM for 2 h, and washed with PBS buffer to remove any non-specifically adsorbed DNA, and then the short-chain DNA obtained in step S1, MoS2 / Au / A1 / four-way and MoS2 / Au / A2 / four-way synthesized in step S3, and methylene blue MB were added to the COF / MoS2 / AuPt electrode after the above treatment in sequence to obtain a COF / MoS2 / AuPt composite structure electrode, and then electrochemical analysis of mycotoxin 1 was performed;

[0023] When mycotoxin 1 is present in the sample, the 3D DNAzyme walker is activated by Mg 2+ Activation, release of short-chain DNA, COF / MoS2 / AuPt electrode interacts with MoS2 / Au / A1 / four-way and MoS2 / Au / A2 / four-way through the released short-chain DNA, so that a large amount of methylene blue MB is absorbed on the electrode surface, triggering A1 and A2 to form a network cross-linked structure, thereby absorbing a large amount of MB for electrochemical analysis of mycotoxin 1;

[0024] Then, the tripedal DNA walker prepared in step S4 was added to the COF / MoS2 / AuPt composite structure electrode, and 10 μL of 20 mM Mg was added to a buffer containing 20 mM Tris, 140 mM NaCl and 5 mM KCl. 2+ , incubated at room temperature for 60 min, and electrochemical analysis of mycotoxin II was performed;

[0025] When the sample to be tested contains mycotoxin II, the above reaction can lead to the release of MoS2 / Au / A1 / four-way and MoS2 / Au / A2 / four-way bound to MB, thereby enabling the detection of mycotoxin II;

[0026] The sequence of MB4 is shown in SEQ ID NO. 14, and the 5' end of MB4 is modified with a thiol group.

[0027] Furthermore, in step S1, the added volume of Fe3O4 was 10 μL, and the concentration was 1 mg / mL; the added volume of the substrate chain was 10 μL, and the concentration was 10 μM; the added volume of the aptamer was 10 μL, and the concentration was 10 μM; and the added volume of the rocker DNA was 10 μL, and the concentration was 10 μM.

[0028] Furthermore, in step S3, the added volumes of H1, H2, H3 and QS were all 10 μL and the concentrations were all 10 μM, the added volume of buffer PBS was 60 μL and the concentration was 10 mM; the volume of MoS2 / Au was 100 μL and the concentration was 1 mg / mL; the added volumes of A1 and A2 were all 10 μL and the concentrations were all 10 μM.

[0029] Furthermore, the DNA mixture in step S4 includes 5 μL of mycotoxin II aptamer with a concentration of 10 μM and 5 μL of hairpins MB1, MB2 and MB3 with a concentration of 10 μM; the added volume of PBS buffer solution is 70 μL and the concentration is 10 mM.

[0030] Furthermore, the preparation method of the COF suspension in step S5 is as follows: 70 mg TAPB and 72 mg DMTP are dissolved in 25 ml acetonitrile, mixed by ultrasonic oscillation, and COF nanocarriers are synthesized by a simple liquid phase method; 1.0 mg of the synthesized COF nanocarrier is dispersed in 1 mL deionized water, and ultrasonicated for 30 min to obtain a uniform COF suspension with a concentration of 1 mg / mL; the volume of the COF suspension dripped onto the Au surface in step S5 is 6 μL, and the concentration of MoS2 is 1 mg / mL.

[0031] Furthermore, in step S6, the added volume of MB4 was 10 μL, and the concentration was 6 μM; the dripping volume of the tripedal DNA walker was 10 μL; in step S6, the added volumes of short-chain DNA, MoS2 / Au / A1 / four-way, and MoS2 / Au / A2 / four-way were all 10 μL, and the added concentration of methylene blue was 0.5 mM, and the added volume was 10 μL.

[0032] Furthermore, the mycotoxin 1 in step S1 is aflatoxin B1, the sequence of the aptamer is shown in SEQ ID NO.2, and the 5' end of the aptamer is modified with biotin; the mycotoxin 2 in step S4 is zearalenone, the mycotoxin 2 aptamer is the zearalenone-specific aptamer MB0, and the sequence of MB0 is shown in SEQ ID NO.10.

[0033] To achieve the above object, the present invention also provides an electrochemical sensor for simultaneously detecting two mycotoxins.

[0034] Furthermore, the mycotoxins are aflatoxin B1 and zearalenone.

[0035] To achieve the above object, the present invention also provides the use of an electrochemical sensor in the preparation of a product for simultaneously detecting two mycotoxins.

[0036] The beneficial effects of the present invention are as follows: the sensor and electrochemical detection method of the present invention have the advantages of simple sample preparation, convenient operation, low cost, wide linear range, low detection limit, high sensitivity, high specificity, good reproducibility and stability; the present invention can be used to simultaneously detect aflatoxin B1 and zearalenone, the present invention utilizes a unique triple signal amplification strategy, including a tripedal DNA walker, a 3D DNAzyme walker and HCR, and utilizes four-way connection to self-assemble on the MoS2 / Au surface, thereby increasing the binding ability of methylene blue MB molecules and enhancing the electrochemical response ability, thereby improving the sensitivity of the sensor, the linear range of aflatoxin B1 of the present invention is 0.01-1000 ng / mL, the detection limit is 0.0062 ng / mL, the linear range of zearalenone is 0.01-100 ng / mL, and the detection limit is 0.0046 ng / mL; the present invention can also detect other mycotoxins in an agricultural environment by replacing the corresponding mycotoxin aptamers, has versatility and potential for wider application, and has good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] In order to make the purpose, technical solutions and advantages of the present invention more clear, the present invention will be described in detail below in conjunction with the accompanying drawings, wherein:

[0038] Figure 1 This is a schematic diagram of a signal amplification platform for detecting mycotoxins according to the present invention;

[0039] Figure 2 The morphological characterization images of the COFs-based materials synthesized in the embodiments of the present invention; wherein: (A) COF; (B) COF / MoS2; (C) SEM of COF / MoS2 / AuPt; (D) COF / MoS2 / AuPt; (E) MoS2; (F) EDX element mapping image of MoS2 / Au; (G) MoS2; (H) TEM image of MoS2 / Au; (I) EDX element mapping image of MoS2 / Au;

[0040] Figure 3 The tripedal DNA walker gel electrophoresis diagram (A), MoS2 / Au / A1 / four-way and MoS2 / Au / A2 / four-way gel electrophoresis diagram (B), and 3D DNAzyme walker gel electrophoresis diagram (C) in the embodiments of the present invention;

[0041] Figure 4(A) The response of the embodiment of the present invention to DPV when adding different concentrations of aflatoxin B1 (a-g are 0, 0.01, 0.1, 1, 10, 100, 1000 ng / mL respectively); (B) Linear relationship; (C) DPV response when adding different concentrations of zearalenone (a-e are 0.01, 0.1, 1, 10, 100 ng / mL respectively); (D) Linear relationship;

[0042] Figure 5 The sensor in the embodiment of the present invention selectively detects various interferons; wherein: (a) aflatoxin B1; (b) aflatoxin B2; (c) zearalenone; (d) ochratoxin a; (e) bovine serum albumin; (f) Mg 2+ (The concentration of aflatoxin and zearalenone is 1 ng / mL, and the concentration of interfering substances is 10 ng / mL). DETAILED DESCRIPTION

[0043] The following describes the embodiments of the present invention by specific examples, and those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and the details in this specification can also be modified or changed in various ways based on different viewpoints and applications without departing from the spirit of the present invention. It should be noted that the illustrations provided in the following embodiments only illustrate the basic concept of the present invention in a schematic manner, and the following embodiments and features in the embodiments can be combined with each other without conflict.

[0044] Example:

[0045] In this embodiment, the inventors designed a multifunctional electrochemical sensing platform using COF / MoS2 / AuPt, 3D DNAzyme walker, tripedal DNA walker and hybridization chain reaction (HCR), constructed electrodes with COF / MoS2 / AuPt, and used 3D DNAzyme walker, tripedal DNA walker and hybridization chain reaction (HCR) with MoS2 / Au / A1 / four-way and MoS2 / Au / A2 / four-way structures as amplified signals to detect the presence of mycotoxins by electrochemical means. This embodiment takes two mycotoxins, aflatoxin B1 and zearalenone, as examples.

[0046] All DNA oligonucleotides involved in this example are products of Shanghai Biotechnology Co., Ltd. and are stored at -20° C. The sequences of the DNA oligonucleotides described in this example are all from 5' to 3'.

[0047] The electrochemical method for simultaneously detecting aflatoxin B1 and zearalenone in this embodiment is as follows:

[0048] S1: Preparation of 3D DNAzyme walkers and obtaining short-chain DNA

[0049] 100 μL of 25 mM Tris-acetate buffer with a pH of 8.3 was mixed with 10 μL of 1 mg / mL Fe3O4, 10 μL of 10 μM substrate chain and 10 μL of 10 μM aptamer, and the mixture was incubated at 37°C for 12 h, then washed with a magnet, and then 10 μL of the sample to be tested containing aflatoxin B1 and 10 μL of 10 μM rocker DNA (arm) were added, and incubated at 37°C for 20 min to form a 3D DNAzyme walker;

[0050] Then, 5 μL of 20 mM MgCl2 was added to the 3D DNAzyme walker, and the reaction was carried out at 37°C for 10 h. Then, a magnet was used to obtain the supernatant and collect the short-chain DNA.

[0051] The sequence of the substrate chain is shown in SEQ ID NO.1, and the 5' end of the substrate chain is modified with biotin, as follows:

[0052] Biotin-TTTTTTTTTTTTTTCACTAT rA GGAAGAGACGGACAACTACAGCGGGGAGGAAGTTTTTTGGGCGGGATATCTCTTCC;

[0053] The sequence of the aptamer is shown in SEQ ID NO.2. The 5' end of the aptamer is modified with biotin, as follows:

[0054] Biotin-TTTTTTTTTTTTTTTTTTTTTTTTTCACCCCACCTCGCTCCCGTGACACTAATG CTA;

[0055] The sequence of the rocker DNA is shown in SEQ ID NO.3, which is as follows:

[0056] GTTGGGCACGTGTTGTCTCTCTGTGTCTCGTGCCCTTCGCTATTTTTTTTTTTTTTTTTTTTTTTTTTTTTCTCTCTTCTCCGAGCCGGTCGAAATAGT

[0057] S2: Preparation of MoS2 / Au nanomaterials

[0058] 1 mg / mL MoS2 was dispersed in 50 mL ultrapure water and heated to boiling while stirring. After 5 minutes, 1 mL of 2% HAuCl4 and 8 mL of 1% sodium citrate were added in sequence. After 10 minutes, the mixture was cooled to room temperature. The product was collected by centrifugation, washed with distilled water for 4 times, and dried in an oven at 60°C for 10 hours to obtain MoS2 / Au.

[0059] S3: Synthesis of MoS2 / Au / A1 / four-way and MoS2 / Au / A2 / four-way

[0060] The four-way hairpin structure is composed of the following four DNA chains: 10 μL of 10 μM Hairpin 1 (H1), 10 μL of 10 μM Hairpin 2 (H2), 10 μL of 10 μM Hairpin 3 (H3) and 10 μL of 10 μM Quarter Sequence (QS). The above H1, H2, H3 and QS are added to 60 μL of 10 mM buffer PBS;

[0061] In order to form a hairpin structure, the above H1, H2 and H3 were first pretreated at 95°C for 5 min, and then gradually cooled to room temperature; then, the four-way hairpin structure mixed with PBS was mixed with the MoS2 / Au obtained in step S2, the volume of MoS2 / Au was 100 μL, and the concentration was 1 mg / mL, and then 10 μL of 10 μM A1 or 10 μL of 10 μM A2 was added, and incubated for 2 h to obtain MoS2 / Au / A1 / four-way or MoS2 / Au / A2 / four-way;

[0062] The sequences of H1, H2, H3 and QS are shown in SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6 and SEQ ID NO.7, respectively, wherein the 5' end of QS is modified with HS-(CH2)6; the sequences of A1 and A2 are shown in SEQ ID NO.8 and SEQ ID NO.9, respectively, wherein the 5' end of A1 is modified with a thiol group, and the 3' end of A2 is modified with a thiol group; the sequences of the above DNA oligonucleotides are as follows:

[0063] H1:

[0064] GGAGGCGTTATGAGGTTGGGTGGTGGTGTCATAACGCCTCCAACTCTTCCACCGTC CCACTCTATCA;

[0065] H2:

[0066] GGAGGCGTTATGAGGTTGGGTGGGTGGTGTCATAACGCCTCCTGATAGAGTGGGATA GTGTTGATGAA;

[0067] H3:

[0068] GGAGGCGTTATGAGGTTGGGTGGGTGGTGTCATAACGCCTCCTTCATCAACACTATTC ATTCCATCCA;

[0069] QS: HS-(CH2)6-CCATAAACTGCTAACACATGGATGGAATGAACGGTGGAAGAGTT; A1: HS-TTTTTTTTCTTCCTCCCCGCTGACAAAGTTCAGCGGGG;

[0070] A2:TCAGCGGGGAGGAAGCCCCGCTGAACTTTGTTTTTTTT-HS;

[0071] S4: Preparation of tripedal DNA walker

[0072] 10 μL of the sample containing zearalenone was mixed with 20 μL of a 1 nM DNA mixture, wherein the DNA mixture included 5 μL of a 10 μM zearalenone-specific aptamer MB0 and 5 μL of hairpins MB1, MB2 and MB3, each of which was 10 μM in concentration. Then, 70 μL of a 10 mM PBS buffer solution was added, and the mixture was stored at 37°C for 50 min to form a fully assembled and stable tripedal DNA walker.

[0073] The sequences of MB0, MB1, MB2 and MB3 are shown in SEQ ID NO.10, SEQ ID NO.11, SEQ ID NO.12 and SEQ ID NO.13 respectively, as follows:

[0074] MB0:

[0075] GGAGGGGGCGCGAACGTCATCTATCTATGGTACATTACTATCTGTAATGTGATATGTA G CTT ATGTC TCT T ATG TTG

[0076] MB1:

[0077] TCG TTT CAA CAT A AGA GAC AT AAG CTA TGA TCA GA T CGT TAG CTT AT G TCTCT TC TCC GAG CCG GTC GAA ATA GT

[0078] MB2:

[0079] AAG AGA CAT AAG AAG AGA C TC TGA TCA CTG ATG TT G AAA TGA TCA GAG TCTCTT C TCC GAG CCG GTC GAA ATA GT

[0080] MB3:

[0081] AAG AGA CTC TGA AAG AGA C AA CAT CAG T TGA TCA TAG CTT AT GTC TCTTATG TTG AAA CGA C AGA CTG ATG TT G TCT CTT C TCC GAG CCG GTC GAA ATA GT

[0082] S5: Construction of COF / MoS2 / AuPt electrode for simultaneous detection of aflatoxin B1 and zearalenone

[0083] 70 mg TAPB and 72 mg DMTP were dissolved in 25 ml acetonitrile, mixed by ultrasonic oscillation, and COF nanocarriers were synthesized by a simple liquid phase method; 1.0 mg of the synthesized COF nanocarrier was dispersed in 1 mL deionized water and ultrasonicated for 30 min to obtain a uniform COF suspension with a concentration of 1 mg / mL, 6 μL of the COF suspension was dropped onto the Au surface and dried at room temperature to obtain COF@Au;

[0084] Subsequently, MoS2 with a concentration of 1 mg / mL was added dropwise to the COF@Au surface to obtain MoS2 / COF@Au. MoS2 / COF@Au was immersed in a 1 mM HAuCl4 and 1 mM H2PtCl6 solution containing 0.01 M H2SO4 and electrolyzed at -1.6 V to 0.6 V to stabilize the AuPt nanoparticles on the electrode surface. After the electrodeposition was completed, the COF / MoS2 / AuPt electrode was gently washed with distilled water and dried at room temperature to obtain the final COF / MoS2 / AuPt electrode.

[0085] S6: Electrochemical analysis of aflatoxin B1 and zearalenone

[0086] First, 10 μL of MB4 with a concentration of 6 μM was dropped onto the COF / MoS2 / AuPt electrode prepared in step S5 to control the working area of ​​the electrode. Then, the electrode was treated with MCH with a concentration of 1 mM for 2 h, and washed with PBS buffer to remove any non-specifically adsorbed DNA. Then, 10 μL of the short-chain DNA obtained in step S1, 10 μL of MoS2 / Au / A1 / four-way synthesized in step S3, 10 μL of MoS2 / Au / A2 / four-way, and methylene blue MB were added to the COF / MoS2 / AuPt electrode after the above treatment. The concentration of methylene blue added was 0.5 mM, and the added volume was 10 μL. A COF / MoS2 / AuPt composite structure electrode was obtained, and then electrochemical analysis of aflatoxin B1 was performed.

[0087] When aflatoxin B1 was present in the sample, the 3D DNAzyme walker was activated by Mg 2+ After activation, short-chain DNA is released. The COF / MoS2 / AuPt electrode interacts with MoS2 / Au / A1 / four-way and MoS2 / Au / A2 / four-way through the released short-chain DNA, so that a large amount of methylene blue MB is absorbed on the electrode surface, triggering A1 and A2 to form a network cross-linked structure, thereby absorbing a large amount of MB for electrochemical analysis of aflatoxin B1.

[0088] Then, 10 μL of the tripedal DNA walker prepared in step S4 was added to the COF / MoS2 / AuPt composite structure electrode, and 10 μL of 20 mM Mg was added to a buffer containing 20 mM Tris, 140 mM NaCl and 5 mM KCl. 2+ , incubated at room temperature for 60 min, and electrochemical analysis of zearalenone was performed;

[0089] When the sample to be tested contains zearalenone, the above reaction can lead to the release of MoS2 / Au / A1 / four-way and MoS2 / Au / A2 / four-way bound to MB, and then zearalenone can be detected;

[0090] The sequence of MB4 is shown in SEQ ID NO. 14, and the 5' end of MB4 is modified with a thiol group, as follows:

[0091] HS-TTT TGG GTT GGG CGG GAT CAC TAT rA GGA AGA GAT ATC CCG CCC.

[0092] In the two sequences of SEQ ID NO.1 and SEQ ID NO.14 of this example, rA represents a cleavage point, and the formed DNAzyme produces cleavage at rA in the presence of magnesium ions.

[0093] In this example, the morphology of the synthesized COFs-based material was characterized using a scanning electron microscope (SEM). Figure 2 A, the synthesized COFs are uniform spherical particles with a diameter of 500nm. Figure 2 B, shows that COFs are uniformly deposited on the surface of MoS2 nanosheets. Figure 2 C, After reducing 1mM HAuCl4 and 1mM H2PtCl6 on the MoS2 surface, COF / MoS2 / AuPt maintains its granular structure. Figure 2 D, it can be seen that the elemental composition of COF / MoS2 / AuPt is C: 11.31%, N: 0.92%, O: 5.51%, S: 17.74%, Mo: 27.52%, Pt: 14.58%, Au: 22.43%. See attached Figure 2 E and Attachment Figure 2 F, is the SEM image of MoS2 and MoS2 / Au nanocomposites, and the EDX element mapping of MoS2 / Au is shown in the attached figure. Figure 2 G. Figure 2 In H, the obvious MoS2 structure is similar to a soft silk film with wrinkles similar to those of a single-layer graphene. Figure 2 I shows that MoS2 nanosheets provide a large surface area for the decoration of a large number of Au nanoparticles, confirming the successful synthesis of MoS2 / Au nanocomposites.

[0094] In order to ensure that the entire method works as expected, the feasibility of the method was evaluated using native polyacrylamide gel electrophoresis (PAGE). Figure 3 Lanes 1 and 2 in A contain MB0 and tripedal DNA, and it can be seen that the final self-assembled tripedal DNA exhibits extremely low mobility. Figure 3 In B, lanes 1, 2, 3, and 4 represent markers M, H1, H2, and H3, respectively. It can be seen that the upstream band of lane 5 indicates that four-way is successfully assembled in this embodiment. Figure 2 Lane 1 in C serves as a marker, and lanes 2 and 3 contain the swing arm DNA and substrate strand, and the results show that the 3D DNAzyme walker was successfully synthesized.

[0095] Next, the inventors recorded the electrochemical responses of the sensor and detection method of this embodiment to different concentrations of aflatoxin B1 and zearalenone under optimal conditions. The responses of different concentrations of aflatoxin B1 and zearalenone to DPV are shown in the attached Figure 4 A, it can be seen that with the increase of aflatoxin B1 concentration, the current peak intensity also increases accordingly, see attached Figure 4 B, it can be seen that the data is positively correlated with the logarithm of the concentration, and the linear regression equation is y=164.3+12.9x, R 2 =0.981, which results in a linear range of 0.01-1000 ng / mL and a limit of detection (LOD) of 0.0062 ng / mL (S / N=3). Figure 4 C. For zearalenone, the peak current intensity decreases with increasing concentration. Figure 4 D, the linear regression equation is y = 122.2 + 8.0x (R 2 =0.994), showing a linear range of 0.01-100 ng / mL and a LOD of 0.0046 ng / mL (S / N=3). The success of the above electrochemical detection is attributed to the signal amplification provided by the 3D DNAzyme walker, tripedal DNA walker and HCR.

[0096] Since specificity is a key factor in the application of biosensors, in this study, the inventors introduced aflatoxin B1, ochratoxin A, bovine serum albumin (BSA) and Mg 2+ The selectivity of the electrochemical sensor constructed in this example for detecting aflatoxin B1 and zearalenone was evaluated. Figure 5 , even when the concentration of the interfering substance increased tenfold, the sensor remained largely unresponsive.

[0097] To evaluate the reproducibility of the sensor, the inventors prepared five independently modified electrodes and tested three different concentrations of aflatoxin B1 and zearalenone. The results showed that under the same experimental conditions, the relative standard deviation (RSD) of five repeated measurements was 5.4%, indicating good reproducibility.

[0098] Long-term stability is also crucial to the application of biosensors. In this embodiment, after being stored at 4° C. for 7 days and 14 days, the detection values ​​of the sensor for aflatoxin B1 and zearalenone remained at 97.2% and 94.8%, respectively.

[0099] In summary, the sensor of this embodiment has good selectivity, repeatability and stability, and can be used as a reliable tool for mycotoxin detection.

[0100] In order to demonstrate the potential application value of the method of this embodiment in actual samples, this embodiment tested the aptamer sensor on peanut extracts with different concentrations of aflatoxin B1 and zearalenone under optimal experimental conditions. Three different concentrations of mycotoxins were added to the peanut extract and detected using the aptamer sensor. The results are shown in Table 1. It can be seen that the recovery rate of aflatoxin B1 is 96.1% to 103%, the recovery rate of zearalenone is 97.3% to 104%, the relative standard deviation (RSD) of aflatoxin B1 is 1.6% to 4%, and the relative standard deviation (RSD) of zearalenone is 2.6% to 3.9%. The above results show reliable performance. The above results show that the electrochemical sensor of this embodiment has great potential in detecting aflatoxin B1 and zearalenone in actual food samples, and it can become a valuable detection tool to ensure food safety.

[0101] Table 1 Detection of mycotoxins in actual samples using the biosensor

[0102]

[0103] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the purpose and scope of the technical solution, which should be included in the scope of the claims of the present invention.

Claims

1. An electrochemical method for detecting mycotoxins constructed using DNA nanotechnology, characterized in that: The steps include: S1: Preparation of 3D DNAzyme walkers and obtaining short-chain DNA 100 μL of 25 mM Tris-acetate buffer with a pH of 8.3 was mixed with Fe3O4, substrate chain and aptamer, and the mixture was incubated at 37°C for 12 h, then washed with a magnet, and then 10 μL of the sample to be tested containing mycotoxin 1 and rocker DNA were added, and incubated at 37°C for 20 min to form a 3D DNAzyme walker; Then, 5 μL of 20 mM MgCl2 was added to the 3D DNAzyme walker, and the reaction was carried out at 37°C for 10 h. Then, a magnet was used to obtain the supernatant and collect the short-chain DNA. The sequence of the substrate chain is shown in SEQ ID NO.1, and the 5' end of the substrate chain is modified with biotin; the sequence of the rocker DNA is shown in SEQ ID NO.3; S2: Preparation of MoS2 / Au nanomaterials 1 mg / mL MoS2 was dispersed in 50 mL ultrapure water and heated to boiling while stirring. After 5 minutes, 1 mL of 2% HAuCl4 and 8 mL of 1% sodium citrate were added in sequence. After 10 minutes, the mixture was cooled to room temperature. The product was collected by centrifugation, washed with distilled water for 4 times, and dried in an oven at 60°C for 10 hours to obtain MoS2 / Au. S3: Synthesis of MoS2 / Au / A1 / four-way and MoS2 / Au / A2 / four-way The four-way hairpin structure is composed of the following four DNA chains: H1, H2, H3 and QS. The above H1, H2, H3 and QS are added to the buffer PBS; In order to form a hairpin structure, the above H1, H2 and H3 were pretreated at 95°C for 5 min and then gradually cooled to room temperature; then, the four-way hairpin structure mixed with PBS was mixed with the MoS2 / Au obtained in step S2, and then A1 or A2 was added and incubated for 2 h to obtain MoS2 / Au / A1 / four-way or MoS2 / Au / A2 / four-way; The sequences of H1, H2, H3 and QS are shown in SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6 and SEQ ID NO.7, respectively, wherein the 5' end of QS is modified with HS-(CH2)6; the sequences of A1 and A2 are shown in SEQ ID NO.8 and SEQ ID NO.9, respectively, wherein the 5' end of A1 is modified with a thiol group, and the 3' end of A2 is modified with a thiol group; S4: Preparation of tripedal DNA walker 10 μL of the sample containing mycotoxin II was mixed with 20 μL of a 1 nM DNA mixture, which included mycotoxin II aptamer and hairpins MB1, MB2 and MB3, and then a PBS buffer solution was added. The mixture was stored at 37°C for 50 min to form a fully assembled and stable tripedal DNA walker. Among them, the sequences of MB1, MB2 and MB3 are shown in SEQ ID NO.11, SEQ ID NO.12 and SEQ ID NO.13 respectively; S5: Construction of COF / MoS2 / AuPt electrode for simultaneous detection of mycotoxins I and II The prepared COF suspension was dropped onto the Au surface and dried at room temperature to obtain COF@Au; MoS2 was then dropped onto the COF@Au surface to obtain MoS2 / COF@Au, and MoS2 / COF@Au was immersed in a 1mM HAuCl4 and 1mM H2PtCl6 solution containing 0.01M H2SO4, and electrolyzed at -1.6V to 0.6V to stabilize the AuPt nanoparticles on the electrode surface. After the electrodeposition was completed, the COF / MoS2 / AuPt electrode was gently washed with distilled water and dried at room temperature to obtain the final COF / MoS2 / AuPt electrode; S6: Electrochemical analysis of mycotoxins I and II First, MB4 was dripped onto the COF / MoS2 / AuPt electrode prepared in step S5 to control the working area of ​​the electrode, and then the electrode was treated with MCH at a concentration of 1 mM for 2 h, and washed with PBS buffer to remove any non-specifically adsorbed DNA, and then the short-chain DNA obtained in step S1, MoS2 / Au / A1 / four-way and MoS2 / Au / A2 / four-way synthesized in step S3, and methylene blue MB were added to the COF / MoS2 / AuPt electrode after the above treatment in sequence to obtain a COF / MoS2 / AuPt composite structure electrode, and then electrochemical analysis of mycotoxin 1 was performed; When mycotoxin 1 is present in the sample, the 3D DNAzyme walker is activated by Mg 2+ Activation, release of short-chain DNA, COF / MoS2 / AuPt electrode interacts with MoS2 / Au / A1 / four-way and MoS2 / Au / A2 / four-way through the released short-chain DNA, so that a large amount of methylene blue MB is absorbed on the electrode surface, triggering A1 and A2 to form a network cross-linked structure, thereby absorbing a large amount of MB for electrochemical analysis of mycotoxin 1; Then, the tripedal DNA walker prepared in step S4 was added to the COF / MoS2 / AuPt composite structure electrode, and 10 μL of 20 mM Mg was added to a buffer containing 20 mM Tris, 140 mM NaCl and 5 mM KCl. 2+ , incubated at room temperature for 60 min, and electrochemical analysis of mycotoxin II was performed; When the sample to be tested contains mycotoxin II, the above reaction can lead to the release of MoS2 / Au / A1 / four-way and MoS2 / Au / A2 / four-way bound to MB, thereby enabling the detection of mycotoxin II; The sequence of MB4 is shown in SEQ ID NO. 14, and the 5' end of MB4 is modified with a thiol group.

2. The electrochemical method for detecting mycotoxins according to claim 1, characterized in that: In step S1, the added volume of Fe3O4 is 10 μL, and the concentration is 1 mg / mL; the added volume of substrate chain is 10 μL, and the concentration is 10 μM; the added volume of aptamer is 10 μL, and the concentration is 10 μM; the added volume of rocker DNA is 10 μL, and the concentration is 10 μM.

3. The electrochemical method for detecting mycotoxins according to claim 1, characterized in that: In step S3, the added volumes of H1, H2, H3 and QS are all 10 μL, and the concentrations are all 10 μM; the added volume of buffer PBS is 60 μL, and the concentration is 10 mM; the volume of MoS2 / Au is 100 μL, and the concentration is 1 mg / mL; the added volumes of A1 and A2 are all 10 μL, and the concentrations are all 10 μM.

4. The electrochemical method for detecting mycotoxins according to claim 1, characterized in that: The DNA mixture in step S4 includes 5 μL of mycotoxin II aptamer with a concentration of 10 μM and 5 μL of hairpins MB1, MB2 and MB3 with a concentration of 10 μM; the added volume of PBS buffer solution is 70 μL and the concentration is 10 mM.

5. The electrochemical method for detecting mycotoxins according to claim 1, characterized in that: The preparation method of the COF suspension in step S5 is as follows: 70 mg TAPB and 72 mg DMTP are dissolved in 25 ml acetonitrile, mixed by ultrasonic oscillation, and COF nanocarriers are synthesized by a simple liquid phase method; 1.0 mg of the synthesized COF nanocarrier is dispersed in 1 mL deionized water, and ultrasonicated for 30 min to obtain a uniform COF suspension with a concentration of 1 mg / mL; the volume of the COF suspension dripped onto the Au surface in step S5 is 6 μL, and the concentration of MoS2 is 1 mg / mL.

6. The electrochemical method for detecting mycotoxins according to claim 1, characterized in that: In step S6, the added volume of MB4 is 10 μL, and the concentration is 6 μM; the droplet volume of the tripedal DNA walker is 10 μL; in step S6, the added volumes of short-chain DNA, MoS2 / Au / A1 / four-way, and MoS2 / Au / A2 / four-way are all 10 μL, and the added concentration of methylene blue is 0.5 mM, and the added volume is 10 μL.

7. The electrochemical method for detecting mycotoxins according to any one of claims 1 to 6, characterized in that: The mycotoxin 1 in step S1 is aflatoxin B1, the sequence of the aptamer is shown in SEQ ID NO.2, and the 5' end of the aptamer is modified with biotin; the mycotoxin 2 in step S4 is zearalenone, the mycotoxin 2 aptamer is the zearalenone-specific aptamer MB0, and the sequence of MB0 is shown in SEQ ID NO.

10.

8. An electrochemical sensor for simultaneously detecting two mycotoxins prepared by the electrochemical method according to any one of claims 1 to 6.

9. The electrochemical sensor according to claim 8, characterized in that The mycotoxins are aflatoxin B1 and zearalenone.

10. Use of the electrochemical sensor according to claim 8 or 9 in preparing a product for simultaneously detecting two mycotoxins.

Images