Therapeutic compounds and compositions

Abstract

The present invention relates to siRNA molecules which are specific for mRNA 5 encoding a mutant form of an FGFR3 (Fibroblast Growth Factor Receptor 3) protein. More specifically, the present invention relates to such siRNA molecules for use in the treatment of cartilage hypoplasia.

Description

Technical Field

[0001] The present invention relates to small interfering (si) RNA molecules that are specific for mRNA encoding a mutant form of the FGFR3 (fibroblast growth factor receptor 3) protein. More specifically, the present invention relates to such siRNA molecules for use in the treatment of achondroplasia. Background Art

[0002] Achondroplasia (ACH) is a skeletal dysplasia caused by the FGFR3 (fibroblast growth factor receptor 3) gene and is the most common cause of disproportionate short stature in humans. FGFR3 mutations are also involved in other skeletal dysplasias, such as hypochondroplasia and lethal dysplasia. All ACH cases are caused by autosomal dominant mutations, with missense mutations p.Gly380Arg (located in the FGFR3 transmembrane domain) accounting for about 97% of cases. (Shiang R et al., (1994) Cell 78:335-342, DOI:10.1016 / 0092-8674 (94) 90302-6; Ornitz DM and Legeai-Mallet L (2017) Developmental Dynamics 246:291-309, DOI:10.1002 / DVDY.24479).

[0003] ACH is a rare disease that is estimated to affect approximately 250,000 people worldwide. If untreated, ACH is associated with multiple orthopedic and neurological complications; patients with achondroplasia often also suffer from chronic pain, which can have a profound negative impact on quality of life (Pauli RM (2019) Orphanet Journal of Rare Diseases 14:1, https: / / doi.org / 10.1186 / sl3023-018-0972-6). There are currently few therapies available for achondroplasia, and in order to be effective, these therapies must be administered within a limited time frame from birth to adolescence. (Ornitz DM and Legeai-Mallet L (2017) Developmental Dynamics 246:291-309, DOI:10.1002 / DVDY.24479).

[0004] Clinically, the treatment for achondroplasia is limited to invasive orthopedic surgery, such as hip or knee replacement surgery and limb lengthening surgery, and a small amount of drug intervention, including growth hormone therapy. Limb lengthening surgery involves cutting cortical long bones (femur and / or tibia), and then gradually stretching the limbs to increase bone length within a few months. Although this operation is effective in increasing height, it is time-consuming, painful, and accompanied by complications, including infection, muscle problems and increased risk of fracture. Growth hormone (GH) therapy involves the use of recombinant human growth hormone (rhGH). This has been shown to produce moderate growth increase, and if rhGH is co-administered with thyroid hormone, growth gain is further increased. However, GH therapy involves daily subcutaneous injections, and is considered to be invalid for cases suffering from spinal deformity and lower limb deformity. Importantly, these treatments are not curative, and if complications occur, further negative effects may be produced on the patient's quality of life. (Wrobel W et al., (2021) Int. J. Mol. Sci. 22:5573, DOI: https: / / doi.org / 10.3390 / ijms22115573).

[0005] Some alternative non-surgical therapies are under development, but most are still in trials or in the preclinical stage. The most advanced of these therapies is BioMarin's vosoritide, which is an analog of CNP (C-type natriuretic peptide, which is involved in normal longitudinal growth). Vosoritide was approved by the FDA and EMA in 2021 for the treatment of achondroplasia. Other therapies include small molecules targeting FGFR3 signaling, such as the tyrosine kinase inhibitor infigratinib (NVP-BGJ398 / BGJ398), which is currently in Phase II clinical trials (NCT04265651). However, these therapies are not targeted therapies, and they reduce overall FGFR3 signaling. In addition, these therapies have different effects on different symptoms associated with achondroplasia. Although these treatments are effective in increasing bone length, their effects on other important aspects, such as disproportion, narrowing of the axial skeleton and foramen magnum (all of which may be associated with further complications) remain unproven. Generally, because achondroplasia treatment is long-term, there is also a need for treatments that can be delivered in a form suitable for pediatric patients with side effects minimized to dose-tolerant levels.

[0006] Therefore, there remains a need for new treatments for achondroplasia and other skeletal dysplasias that are reliable and effective, but do not impede the patient's quality of life. The present invention addresses the above needs. Summary of the invention

[0007] According to a first aspect, the present invention provides a siRNA molecule comprising a sequence selected from the group consisting of GCAGGCAUCCUCAGCUACX M GGGUGGGCUUCUUCCUGU (SEQ ID NO: 1), wherein X M selected from nucleotides A and C, wherein the consecutive nucleotides selected from SEQ ID NO: 1 must include X found at position 19 of SEQ ID NO: 1 M nucleotide; or a variant of the siRNA molecule having at least 1 and no more than 6 nucleotide substitutions relative to SEQ ID NO: 1, provided that the X at the position corresponding to position 19 of SEQ ID NO: 1 of the variant siRNA molecule M The nucleotides are not substituted and are thus selected from nucleotides A and C, and wherein the siRNA molecule is not a siRNA having a length of 19 nucleotides having the sequence GAAGGCAUCCUCAGCUACA.

[0008] According to the second aspect of the present invention, a siRNA molecule is provided, wherein the siRNA molecule comprises a sequence selected from GX 1A GX2X3AUCCX4CX5X6X 7U X8X9X M X 10 X 11 X 12 X 13 X 14 GX 15 CX 16 UCX 17 UX 18 CUGU (SEQ ID NO: 14), wherein X M selected from nucleotides A and C, wherein the consecutive nucleotides selected from SEQ ID NO: 14 must include X found at position 19 of SEQ ID NO: 14 M Nucleotide; wherein X1 is selected from C and U, X2 is selected from G and U, X3 is selected from C and U, X4 is selected from A and U, X5 is selected from A and U, X6 is selected from G and U, X7 is selected from C, G and U, X8 is selected from A and U, X9 is selected from C and U, X 10 Selected from G, A and U, X 11 Selected from G and U, X 12 Selected from G and A, X 13 Selected from A and U, X 14 Selected from G and C, X 15 Selected from G and C, X 16 Selected from A and U, X 17Selected from A and U, and X 18 Selected from C and U.

[0009] According to a third aspect of the present invention, there is provided a method for producing a siRNA molecule or a variant thereof as disclosed herein, the method comprising the step of synthesizing the siRNA molecule or a variant thereof.

[0010] According to a fourth aspect of the present invention, a pharmaceutical composition is provided, comprising the siRNA molecule or variant thereof as disclosed herein and a pharmaceutically acceptable carrier.

[0011] According to a fifth aspect of the present invention, there is provided a composite comprising:

[0012] (i) lipid particles comprising hydrolyzable silicon;

[0013] (ii) an siRNA or variant thereof as disclosed herein associated with the lipid particle.

[0014] According to a sixth aspect of the present invention, there is provided a composite comprising:

[0015] (i) particles comprising hydrolyzable silicon;

[0016] (ii) optionally, one or more lipids; and

[0017] (iii) an siRNA or variant thereof as disclosed herein associated with the particle.

[0018] According to a seventh aspect of the present invention, there is provided a composite comprising:

[0019] (i) particles comprising hydrolyzable silicon;

[0020] (ii) optionally, one or more lipids; and

[0021] (iii) an siRNA that targets an mRNA encoding a mutant FGFR3 protein, wherein the siRNA targets a portion of the mRNA sequence that includes nucleotides encoding a Gly to Arg mutation at position 380 of the protein, and wherein the siRNA is associated with the particle.

[0022] According to an eighth aspect of the present invention, there is provided an siRNA molecule or variant thereof, a pharmaceutical composition or a complex as disclosed herein for use as a medicament.

[0023] According to a ninth aspect of the present invention, there is provided an siRNA molecule or variant thereof, a pharmaceutical composition or a complex as disclosed herein for use in treating achondroplasia.

[0024] According to a tenth aspect of the present invention, there is provided an siRNA molecule or variant thereof, a pharmaceutical composition or a complex as disclosed herein for use in downregulating the expression of a FGFR3 protein carrying a Gly to Arg mutation at position 380 (G380R).

[0025] According to an eleventh aspect of the present invention, there is provided a method for treating achondroplasia in a mammal in need thereof, the method comprising administering to the mammal a pharmaceutically effective dose of an siRNA molecule or variant thereof, a pharmaceutical composition or a complex as disclosed herein.

[0026] Of course, it should be understood that features described with respect to one aspect of the invention may be incorporated into other aspects of the invention. For example, methods, pharmaceutical compositions and complexes of the invention may be combined with any of the features described with respect to the siRNA molecules of the invention (or variants thereof), and vice versa. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 shows the generation of FGFR expression vector.

[0028] (A) A diagram illustrating the structure of the FGFR3 GFP expression vector.

[0029] (B) from FGFR3 WT (Top) and FGFR3 G380R Electropherogram resulting from Sanger sequencing of the expression vector (bottom) showing the G>A transition in the mutant gene.

[0030] Figure 2 HEK-FGFRS WT Cells and HEK-FGFR3 G380R GFP expression at the mRNA and protein levels in cells. WT ) or mutant (HEK-FGFR3 G380R HEK293 cells were transfected with a GFP-tagged vector of the FGFR3 gene. GFP expression was assessed using real-time RT-PCR (A) and fluorescence microscopy (B). Gene expression was normalized by human GAPDH.

[0031] Figure 3 The candidate FGFR3 G380R Preliminary in vitro screening results of specific siRNA. WT ) or mutant (HEK-FGFR3 G380R HEK293 cells transfected with a GFP-tagged vector expressing FGFR3 gene were treated with 100 nM of the indicated FGFR3 G380R-siRNA treatment for 48 hours. At the end of the experiment, RNA was isolated and GFP gene expression was evaluated in (A) mutant HEK-FGFR3 cells and (B) wild-type HEK-FGFR3 cells by real-time RT-PCR. Gene expression was normalized by human GAPDH. The data for each siRNA represent the arithmetic mean + / - standard deviation of 3 or 4 independent experiments. Multiple comparison ANOVA (MC-ANOVA) was used to calculate p values ​​without any correction.

[0032] Figure 4 Human FGFR3 is exemplified G380R Schematic representation of the structure of the targeting vector and homologous recombination in the mouse locus used to generate a knock-in (KI) mouse model of achondroplasia.

[0033] Figure 5 shows that human FGFR3 G380R (A) Schematic diagram and (B) restriction digestion of the targeting vector PBS-DTA / FGFR3(NM_000142)MUT G380R.

[0034] Figure 6 The results of PCR analysis of ESC clones using the primer pairs listed in Table 8 are shown.

[0035] 7A to 7D Shown are the results of PCR analysis of tail biopsy samples from littermates generated by crossing chimeras with wild-type animals. NEO+HT indicates animals that are positive for the neomycin cassette (i.e., carry the desired G380R mutation), and NEO- indicates animals that are negative for the neomycin cassette (i.e., do not carry the desired G380R mutation).

[0036] FIG. 8A to FIG. 8B Shown are the results of PCR analysis of tail biopsy samples from littermates generated by crossing chimeras directly with FlpE animals (second mating strategy). FLP-e+ indicates animals that are positive for FlpE (i.e., identified as potential heterozygotes carrying the desired G380R mutation), and FLP-e+ indicates animals that are FlpE negative (i.e., not carrying the desired G380R mutation).

[0037] Fig. 9 The results of PCR detection of the G380R mutation using the primers listed in Table 11 are shown.

[0038] Fig.10 Shown are the results of PCR analysis detecting the G380R mutation from tail biopsy samples of FLP-e+ animals obtained from the second mating strategy (samples 16 and 22) as well as representative NEO+ (sample 4) and NEO- (sample 3).

[0039] Fig.11 Shown are the results of PCR analysis detecting the G380R mutation from tail biopsy samples of additional FLP-e+ animals obtained from the second mating strategy, as well as representative NEO+ (sample 4) and NEO- (sample 3).

[0040] Fig.12 Shown are the results of PCR analysis of FLP-e+ / G380R+ animals in the presence or absence of the neomycin cassette. DETAILED DESCRIPTION

[0041] ACH is caused by an autosomal dominant mutation in the FGFR3 gene, which results in the expression of a mutant functional gain FGFR3 protein comprising a Gly to Arg substitution at position 380. Patients with ACH carry both mutant FGFR3 alleles and normal (non-mutated) FGFR3 alleles, so the inventors hypothesized that an RNAi-based approach could be used to treat ACH. Specifically, the inventors developed a targeted therapy based on a mutation-driven approach using siRNAs that were able to complement mutant FGFR3 mRNA, leading to its degradation.

[0042] Therefore, the present invention is partly related to siRNA molecules, which can target and lower the mRNA encoding mutant FGFR3 protein. Such siRNA molecules can therefore be used to treat or prevent ACH. Advantageously, the siRNA molecules of the present invention can selectively target and lower the messenger RNA (mRNA) encoding mutant FGFR3 protein, i.e., the siRNA molecules lower the mutant mRNA, while substantially not lowering the expression of wild-type mRNA (encoded by normal, non-mutated FGFR3 alleles). Advantageously, the siRNA molecules of the present invention can differentially affect the amount of mutant mRNA and wild-type / normal mRNA present in the cell, so that the amount of wild-type / normal mRNA in the cell is greater than the amount of mutant mRNA in the cell. This can be achieved in the following manner: lower the amount of mutant mRNA in the cell, while substantially not lowering the amount of wild-type mRNA in the cell, or raising the amount of wild-type mRNA in the cell, while substantially not lowering the amount of mutant mRNA in the cell, or lowering the amount of mutant mRNA in the cell, while also raising the amount of wild-type mRNA in the cell.

[0043] Therefore, the inventor has designed the siRNA of specific targeting mutant mRNA.This is achieved in the following manner: the siRNA complementary to the region of design and mutant mRNA, the mutant mRNA comprises the point mutation encoded by the mutant human FGFR3 gene.In certain embodiments, the siRNA design strategy of the inventor includes adding other nucleotide mispairing compared with the corresponding target sequence of mutant FGFR3 mRNA, to improve siRNA specificity.Therefore this type of siRNA molecule will have two nucleotide mispairings (point mutation and additional nucleotide mispairing causing disease) relative to wild-type FGFR3mRNA sequence.

[0044] The inventors have demonstrated herein that they are able to design siRNA sequences that only bind to and degrade mutant FGFR3 mRNA, without substantially affecting normal / wild-type FGFR3 mRNA. The latter can therefore be translated into a normal protein that is sufficient to restore normal FGFR3 function. This is referred to as "single dose sufficiency."

[0045] The strategy based on siRNA as described herein is advantageous because they have high specificity to mutant FGFR3, when compared with other treatment selections (comprising blocking antibodies, nucleic acid ligands, decoy receptors and inhibitors of tyrosine kinase activity), there is no off-target effect or the off-target effect is minimum. In addition, siRNA molecules are more specific than other RNAi molecules (comprising miRNA). In fact, miRNA is not specific to single mRNA, but can target different unrelated mRNAs simultaneously, and they can not be designed in a mutation-specific manner.

[0046] Another advantage of the inventors' method is shown by the low or absent risk of overdose. In fact, since the inventors advantageously target mutant FGFR3 signaling, where downregulation of normal FGFR3 is minimal or absent, the maximal effect of the siRNA should be to normalize FGFR3 signaling.

[0047] As mentioned above, siRNA causes gene silencing by targeting mRNA. siRNA is a short (usually about 19 to 25 nucleotides) double-stranded RNA molecule that works by absorbing RNA interference reactions. This distinguishes them from single-stranded antisense oligonucleotides (ASOs), which are another tool for oligonucleotide-induced gene silencing that directly binds to mRNA. When siRNA enters cells, the siRNA is first identified and processed by the protein mechanism of RNA-induced silencing complex (RISC). The siRNA chain (also referred to as "guide strand") complementary to the target mRNA is then incorporated into RISC. Once the guide strand is incorporated into the target mRNA, a protein Argonaute in the protein in RISC cleaves the mRNA, which then triggers the degradation of the cleaved mRNA by exonucleases. Therefore, the expression of the target mRNA and the expression of the protein encoded by the mRNA are all down-regulated by siRNA.

[0048] definition

[0049] As used herein, the term “ Coding sequence (CDS) ” refers to the portion of the DNA of a gene that encodes the mRNA, specifically the strand of the DNA duplex that contains a sequence equivalent to the sequence of the corresponding mRNA (wherein the DNA coding sequence contains thymine instead of uracil as found in the mRNA). This is also called the "coding strand" or "sense strand" of the DNA.

[0050] As used herein, the term “ Template chain "Antisense" refers to the strand of the DNA duplex within a gene that serves as a template for mRNA transcription, ie, it is the strand that is complementary to the coding sequence or coding strand. The template strand may also be referred to as the "antisense strand."

[0051] As used herein, the term “ siRNA" refers to a short (usually about 19 to 25 nucleotides) RNA molecule that is at least partially double-stranded, or can be completely double-stranded, and can be used for post-transcriptional gene silencing. The siRNA contains a first strand that hybridizes to a complementary second strand, and the sequence of the first strand is identical or substantially similar to the sequence of the target mRNA. The siRNA molecule does not need to be double-stranded along its entire length. For example, the advantageous siRNA molecule of the present invention can be double-stranded along the length of the sequence complementary to the target mRNA (wherein the possibility of one or two mismatches with the target mRNA is allowed, as described herein), but has a single-stranded overhang at one or both 3' ends of the double-stranded molecule (wherein the single-stranded overhang may or may not be complementary to the target mRNA). Relative to the first strand, the siRNA is represented by the symbol Represents the sequence of the siRNA molecule disclosed herein, i.e., a sequence identical or substantially similar to the sequence of the target mRNA. In certain embodiments, the siRNA molecule as described herein may have an overhang of a single-stranded sequence at one or both ends of the molecule. For example, the siRNA molecule as described herein may have an overhang at one or both 3' ends of the double-stranded segment of the siRNA molecule. The overhang may advantageously be one or two nucleotides long, wherein the nucleotide is an extension of a sequence complementary to the target mRNA, or wherein the nucleotide is a non-complementary sequence, for example, a UU overhang or a deoxythymidine dinucleotide (dTdT) overhang. If there are overhangs at both 3' ends, the overhangs may be symmetrical or asymmetrical.

[0052] References to GFP herein are to be understood as references to enhanced green fluorescent protein (EGFP).

[0053] siRNA molecules

[0054] In one aspect, the present invention provides an siRNA molecule comprising a sequence selected from the group consisting of GCAGGCAUCCUCAGCUACX M GGGUGGGCUUCUUCCUGU (SEQ ID NO: 1), wherein X M selected from nucleotides A and C, wherein the consecutive nucleotides selected from SEQ ID NO: 1 must include X found at position 19 of SEQ ID NO: 1 M nucleotide; or a variant of the siRNA molecule having at least 1 and no more than 6 nucleotide substitutions relative to SEQ ID NO: 1, provided that the X at the position corresponding to position 19 of SEQ ID NO: 1 of the variant siRNA molecule M The nucleotides are not substituted and are therefore selected from nucleotides A and C.

[0055] In one embodiment of this aspect, the invention provides an siRNA molecule comprising a sequence selected from the group consisting of GCAGGCAUCCUCAGCUACX M GGGUGGGCUUC UUCCUGU (SEQ ID NO: 1), wherein X M selected from nucleotides A and C, wherein the consecutive nucleotides selected from SEQ ID NO: 1 must include X found at position 19 of SEQ ID NO: 1 M nucleotide; or a variant of the siRNA molecule having at least 1 and no more than 6 nucleotide substitutions relative to SEQ ID NO: 1, provided that the X at the position corresponding to position 19 of SEQ ID NO: 1 of the variant siRNA molecule M The nucleotides are not substituted and are thus selected from nucleotides A and C, and wherein the siRNA molecule is not a siRNA having a length of 19 nucleotides having the sequence GAAGGCAUCCUCAGCUACA.

[0056] In one embodiment of this aspect, a siRNA molecule is provided, the siRNA molecule comprising a sequence selected from GCAGGCAUCCUCAGCUACX M GGGUGGGCUUCU UCCUGU (SEQ ID NO: 1), wherein X M selected from nucleotides A and C, wherein the consecutive nucleotides selected from SEQ ID NO: 1 must include X found at position 19 of SEQ ID NO: 1 M nucleotide; or a variant of the siRNA molecule having at least 1 and no more than 6 nucleotide substitutions relative to SEQ ID NO: 1, provided that the X at the position corresponding to position 19 of SEQ ID NO: 1 of the variant siRNA molecule M The nucleotides are not substituted and are thus selected from nucleotides A and C, and wherein the siRNA molecule does not consist of the sequence GAAGGCAUCCUCAGCUACA.

[0057] In one embodiment of this aspect, a siRNA molecule is provided, the siRNA molecule comprising a sequence selected from GCAGGCAUCCUCAGCUACX M GGGUGGGCUUCUUCCUGU (SEQ ID NO: 1), wherein X M selected from nucleotides A and C, wherein the consecutive nucleotides selected from SEQ ID NO: 1 must include X found at position 19 of SEQ ID NO: 1M nucleotide; or a variant of the siRNA molecule having at least 1 and no more than 6 nucleotide substitutions relative to SEQ ID NO: 1, provided that the X at the position corresponding to position 19 of SEQ ID NO: 1 of the variant siRNA molecule M The nucleotides are not substituted, and are thus selected from nucleotides A and C, and wherein the siRNA molecule does not comprise the sequence GAAGGCAUCCUCAGCUACA.

[0058] In one embodiment of this aspect, the siRNA molecule or variant thereof comprises at least 18 or at least 19 consecutive nucleotides of a sequence selected from SEQ ID NO: 1. In another embodiment of this aspect, the siRNA molecule or variant thereof comprises at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, or at least 30 consecutive nucleotides of a sequence selected from SEQ ID NO: 1.

[0059] In one embodiment of this aspect, the maximum length of the siRNA molecule or variant thereof is 30, 29, 28, 27, 26 or fewer nucleotides, e.g., 25 or fewer nucleotides.

[0060] In one embodiment of this aspect, the siRNA molecule or variant thereof is 17 to 25 nucleotides in length, preferably 19 to 23 nucleotides in length. In another embodiment of this aspect, the siRNA molecule or variant thereof is 20 to 23 nucleotides in length. In another embodiment of this aspect, the siRNA molecule or variant thereof is 19 to 22 nucleotides, 19 to 21 nucleotides, or 19 to 20 nucleotides in length. In another embodiment of this aspect, the siRNA molecule is 19 nucleotides in length.

[0061] In one embodiment of this aspect, the variant of the siRNA molecule has at least 1 and no more than 5 nucleotide substitutions relative to SEQ ID NO.1, provided that the X at the position corresponding to position 19 of SEQ ID NO:1 of the variant siRNA molecule is M The nucleotide is not substituted and is therefore selected from nucleotides A and C. In another embodiment of this aspect, the variant of the siRNA molecule has at least 1 and no more than 4 nucleotide substitutions relative to SEQ ID NO.1, provided that the X at the position corresponding to position 19 of SEQ ID NO:1 of the variant siRNA molecule is MThe nucleotide is not substituted and is therefore selected from nucleotides A and C. In another embodiment of this aspect, the variant of the siRNA molecule has at least 1 and no more than 3 nucleotide substitutions relative to SEQ ID NO.1, provided that the X at the position corresponding to position 19 of SEQ ID NO:1 of the variant siRNA molecule is M The nucleotide is not substituted and is therefore selected from nucleotides A and C. In another embodiment of this aspect, the variant of the siRNA molecule has at least 1 and no more than 2 nucleotide substitutions relative to SEQ ID NO.1, provided that the X at the position corresponding to position 19 of SEQ ID NO:1 of the variant siRNA molecule is M The nucleotide is not substituted and is therefore selected from nucleotides A and C. In another embodiment of this aspect, the variant of the siRNA molecule has only one nucleotide substitution relative to SEQ ID NO.1, provided that the X at the position corresponding to position 19 of SEQ ID NO:1 of the variant siRNA molecule is M The nucleotides are not substituted and are therefore selected from nucleotides A and C.

[0062] In an embodiment of this aspect, the siRNA molecule or variant thereof is at least partially double-stranded, i.e., comprises a second strand that is substantially or completely complementary to the siRNA sequence disclosed herein. In another embodiment of this aspect, the siRNA molecule or variant thereof is double-stranded along its entire length, i.e., comprises a second strand that is completely complementary to the siRNA sequence disclosed herein. The siRNA molecule of the present invention or variant thereof may have an overhang of a single-stranded sequence at one or both 3' ends of the double-stranded segment of the molecule. For example, the siRNA of the present invention or variant thereof may have a single-stranded overhang at one or both 3' ends of 1, 2, 3 or 4 nucleotides (e.g., two nucleotides). Advantageously, the siRNA molecule of the present invention or variant thereof has a single-stranded overhang at both 3' ends of the double-stranded molecule (e.g., two 3' ends of two nucleotides). Advantageously, the overhanging nucleotides do not include G nucleotides. In another embodiment of this aspect, the overhanging nucleotides of the siRNA molecule or variant thereof are an extension of a sequence complementary to the target mRNA, or the overhanging nucleotides are non-complementary sequences, e.g., UU or deoxythymidine dinucleotide (dTdT).

[0063] In one embodiment of this aspect, X in the siRNA molecule or variant thereof M is nucleotide A. In another embodiment of this aspect, X in the siRNA molecule or variant thereof M It is nucleotide C.

[0064] In one embodiment of this aspect, the siRNA molecule or variant thereof is at least 19 nucleotides in length, and the A of the siRNA molecule or variant thereof corresponding to position 19 of SEQ ID NO: 1 can be found at any position of the position of the siRNA molecule or variant thereof. In another embodiment of this aspect, the siRNA molecule or variant thereof is 19 to 25 nucleotides in length, and the A of the siRNA molecule or variant thereof corresponding to position 19 of SEQ ID NO: 1 can be found at position 1, position 6, position 9, position 15, or position 19 of the siRNA molecule or variant thereof. In another embodiment of this aspect, the siRNA molecule or variant thereof is 19 to 25 nucleotides in length, and the A of the siRNA molecule or variant thereof corresponding to position 19 of SEQ ID NO: 1 can be found at position 1, position 6, or position 9 of the siRNA molecule or variant thereof. In another embodiment of this aspect, the siRNA molecule or variant thereof is 19 to 25 nucleotides in length, and the A of the siRNA molecule or variant thereof corresponding to position 19 of SEQ ID NO: 1 can be found at position 6 of the siRNA molecule or variant thereof. In one embodiment of this aspect, the siRNA molecule or variant thereof comprises the sequence X1X2UAX3X M GGGUGGX4CX5UCUU (SEQ ID NO: 2), wherein X M Selected from the group consisting of: A and C, and wherein X1, X2, X3, X4 and X5 are each independently selected from the group consisting of: A, G, C and U. In another embodiment of this aspect, the siRNA molecule or variant thereof comprises SEQ ID NO: 2, wherein X1 is selected from G and U, X2 is selected from C and U, X3 is selected from C and U, X4 is selected from G and C, and X5 is selected from A and U. In another embodiment of this aspect, the siRNA molecule or variant thereof comprises SEQ ID NO: 2, wherein X4 is G. In another embodiment of this aspect, the siRNA molecule or variant thereof comprises SEQ ID NO: 2, wherein X1 is G, X2 is C, X3 is selected from C and U, X4 is G, and X5 is selected from A and U. In another embodiment of this aspect, the siRNA is selected from the group consisting of: GCUAUAGGGUGGGCUUCUU (SEQ ID NO: 3) and GCUACAGGGUGGGCAUCUU (SEQ ID NO: 4). In one embodiment of this aspect, the siRNA molecule or variant thereof comprises the sequence X M X1X2GUGGGCUUCX3UX4CUGU (SEQ ID NO: 5), wherein X MSelected from the group consisting of: A and C, and wherein X1, X2, X3 and X4 are each independently selected from the group consisting of: A, G, C and U. In another embodiment of this aspect, the siRNA molecule or variant thereof comprises SEQ ID NO: 5, wherein X1 is selected from G and A, X2 is selected from G and U, X3 is selected from A and U, and X4 is selected from C and U. In another embodiment of this aspect, the siRNA molecule or variant thereof comprises SEQ ID NO: 5, and X3 is U. In another embodiment of this aspect, the siRNA molecule or variant thereof comprises SEQ ID NO: 5, wherein X1 is selected from A and G, X2 is G, X3 is U, and X4 is selected from C and U. In another embodiment of this aspect, the siRNA molecule is selected from the group consisting of: AAGGUGGGCUUCUUCCUGU (SEQ ID NO: 6) and AGGGUGGGCUUCUUUCUGU (SEQ ID NO: 7).

[0065] In one embodiment of this aspect, the siRNA molecule or variant thereof comprises the sequence X1CAGCUAX2X M X3GGX4X5GGCUU (SEQ ID NO: 8), wherein X M In another embodiment of this aspect, the siRNA molecule or variant thereof comprises SEQ ID NO: 8, wherein X1 is selected from A and U, X2 is selected from C and U, X3 is selected from G and U, X4 is selected from A and U, and X5 is selected from C and G. In another embodiment of this aspect, the siRNA molecule or variant thereof comprises SEQ ID NO: 8, and X2 is C. In another embodiment of this aspect, the siRNA molecule is selected from the group consisting of UCAGCUACAGGGUCGGCUU (SEQ ID NO: 9) and UCAGCUACAGGGAGGGC UU (SEQ ID NO: 10).

[0066] In one embodiment of this aspect, the siRNA molecule or variant thereof comprises the sequence X1CAUCCUCAGCX2X3X4X M X 5G X6U (SEQ ID NO: 11), wherein X MSelected from the group consisting of: A and C, and wherein X1, X2, X3, X4, X5 and X6 are each independently selected from the group consisting of: A, G, C and U. In another embodiment of this aspect, the siRNA molecule or variant thereof comprises SEQ ID NO: 8, wherein X1 is selected from G and U, X2 is selected from C and U, X3 is selected from A and U, X4 is selected from C and U, X5 is selected from G and U, and X6 is selected from G and A. In another embodiment of this aspect, the siRNA molecule has the sequence GCAUCCUCAGCUAUAGGGU (SEQ ID NO: 12).

[0067] In one embodiment of this aspect, the siRNA molecule or variant thereof comprises the sequence GX1AGGX2AUCCUCX3GX4UAX5X m (SEQ ID NO: 13), wherein X M is selected from the group consisting of: A and C, and wherein X1, X2, X3, X4 and X5 are each independently selected from the group consisting of: A, G, C and U. In another embodiment of this aspect, the siRNA molecule or variant thereof comprises SEQ ID NO: 13, wherein X1 is selected from C and U, X2 is selected from C and U, X3 is selected from A and U, X4 is selected from G and C, and X5 is selected from C and U.

[0068] In one embodiment of this aspect, the siRNA molecule or variant thereof comprises a sequence falling within the definition of SEQ ID NO: 2, SEQ ID NO: 5, SEQ ID NO: 8, SEQ ID NO: 11 or SEQ ID NO: 13, wherein in each of SEQ ID NO: 2, SEQ ID NO: 5, SEQ ID NO: 8, SEQ ID NO: 11 and SEQ ID NO: 13, X M is A. In this context, reference to a sequence falling within the definition of SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO:8, SEQ ID NO:11 or SEQ ID NO:13 refers to a sequence having the full length of SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO:8, SEQ ID NO:11 or SEQ ID NO:13, i.e. 19 nucleotides.

[0069] In one embodiment of this aspect, the siRNA molecule comprises a sequence selected from the group consisting of:

[0070]

[0071]

[0072] In another embodiment of this aspect, the invention comprises a siRNA molecule selected from the above table, wherein the A nucleotides indicated in bold have been replaced with C nucleotides.

[0073] Additional siRNA molecules can be designed or the siRNA molecules described herein can be modified based on one or more of the following principles: (i) targeting a GC content in the range of 30% to 50%; (ii) avoiding target sequences that have more than 16 to 17 consecutive base pairs of homology to other coding sequences, as determined by BLAST ( http: / / blast.ncbi.nlm.nih.gov / Blast.cgi ) identified; and (iii) including a UU dinucleotide overhang at the 3' end.

[0074] According to a second aspect of the present invention, a siRNA molecule is provided, wherein the siRNA molecule comprises a sequence selected from GX1AGX2X3AUCCX 4C X5X6X 7U X8X9X M X 10 X 11 X 12 X 13 X 14 GX 15 CX 16 UCX 17 UX 18 CU GU (SEQ ID NO: 14), wherein X M selected from nucleotides A and C, wherein the consecutive nucleotides selected from SEQ ID NO: 14 must include X found at position 19 of SEQ ID NO: 14 M Nucleotide; wherein X1 is selected from C and U, X2 is selected from G and U, X3 is selected from C and U, X4 is selected from A and U, X5 is selected from A and U, X6 is selected from G and U, X7 is selected from C, G and U, X8 is selected from A and U, X9 is selected from C and U, X 10 Selected from G, A and U, X 11 Selected from G and U, X 12 Selected from G and A, X 13 Selected from A and U, X 14 Selected from G and C, X 15 Selected from G and C, X 16 Selected from A and U, X 17 Selected from A and U, and X 18 Selected from C and U.

[0075] In one embodiment of this aspect, the siRNA molecule or variant thereof comprises at least 18 or at least 19 consecutive nucleotides of a sequence selected from SEQ ID NO: 14. In another embodiment of this aspect, the siRNA molecule or variant thereof comprises at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, or at least 30 consecutive nucleotides of a sequence selected from SEQ ID NO: 14.

[0076] In one embodiment of this aspect, the maximum length of the siRNA molecule or its variant is 30 or less, 29 or less, 28 or less, 27 or less, 26 or less or 25 or less nucleotides. In another embodiment of this aspect, the length of the siRNA molecule or its variant is 17 to 25 nucleotides, 18 to 24 nucleotides or 19 to 23 nucleotides. In another embodiment of this aspect, the length of the siRNA molecule or its variant is 19 to 22 nucleotides, 19 to 21 nucleotides or 19 to 20 nucleotides. In another embodiment of this aspect, the length of the siRNA molecule is 19 nucleotides.

[0077] In one embodiment of this aspect, the siRNA molecule is at least partially double-stranded. In another embodiment of this aspect, the siRNA molecule or its variant is double-stranded along its full length. In another embodiment of this aspect, the siRNA molecule or its variant has an overhang of a single-stranded sequence at one or both ends of the molecule. In another embodiment of this aspect, the siRNA or its variant has a single-stranded overhang at the 3' end of 1, 2, 3 or 4 nucleotides. Advantageously, the overhanging nucleotides do not include G nucleotides. In another embodiment of this aspect, the siRNA molecule or its variant comprises a 3' overhang with the sequence UU.

[0078] In one embodiment of this aspect, X in the siRNA molecule or variant thereof M is nucleotide A. In another embodiment of this aspect, X in the siRNA molecule or variant thereof M It is nucleotide C.

[0079] In one embodiment of this aspect, X in the siRNA molecule or variant thereof 15 is the nucleotide G, and X 17 It is the nucleotide U.

[0080] In one embodiment of this aspect, the siRNA molecule comprises a sequence selected from the group consisting of:

[0081]

[0082] In another embodiment of this aspect, the invention comprises a siRNA molecule selected from the above table, wherein the A nucleotides indicated in bold have been replaced with C nucleotides.

[0083] Methods for siRNA Synthesis

[0084] According to a third aspect of the present invention, there is provided a method for producing a siRNA molecule or a variant thereof as disclosed herein, the method comprising the step of synthesizing the siRNA molecule or a variant thereof.

[0085] Methods of siRNA synthesis are known in the art, and the skilled person will be able to select an appropriate method for synthesizing the siRNA molecules disclosed herein or variants thereof. The synthesis method may involve in vitro methods, including: chemical synthesis (e.g., via GeneAssist provided by ThermoFisher TM Custom siRNA Builder commercial service) or in vitro transcription of a suitable DNA template (e.g., using Ambion TM Silencer TM Alternatively, the siRNA can be expressed by introducing a DNA-based expression system (e.g., a siRNA expression plasmid such as pSilencer from Thermofisher). TM In one embodiment of the third aspect, the siRNA expression cassette generated by siRNA expression vector, viral vector or PCR, such as, in Castanotto D., (2002), RNA 8: those siRNA expression cassettes described in 1454-60) are introduced into cells to realize the synthesis of siRNA. Such systems allow siRNA molecules to be directly expressed in vivo without the need for transfection of siRNA molecules into cells. Therefore, in one embodiment of the third aspect, chemical synthesis, in vitro transcription or cell-based siRNA expression systems (e.g., siRNA expression plasmids, viral vectors or PCR siRNA expression cassettes) can be used to synthesize the steps of the siRNA molecules or their variants. In one embodiment of this aspect, chemical synthesis or in vitro transcription is used to synthesize the steps of the siRNA molecules or their variants. In one embodiment of this aspect, chemical synthesis is used to synthesize the steps of the siRNA molecules or their variants.

[0086] Pharmaceutical composition

[0087] According to a fourth aspect of the present invention, a pharmaceutical composition is provided, comprising the siRNA molecule or variant thereof as disclosed herein and a pharmaceutically acceptable carrier.

[0088] Pharmaceutically acceptable carriers and formulations thereof suitable for use according to the fourth aspect of the present invention are known in the art and are described in standard formulation papers, such as Remington's Pharmaceutical Sciences, Journal of Parenteral Science and Technology, Technical Report No. 10, Supplement 42: 2S, 1988 by EW Martin or Wang, YJ or Hanson, MA. Additional examples of such carriers are listed in, for example, 2019 European Pharmacopeia (Ph. Eur.) and Handbook of Pharmaceutical Excipients (9th Edition, 2020; Pharmaceutical Press (UK) and American Pharmaceutical Association (US)). A skilled person will be able to select an appropriate carrier for a pharmaceutical composition comprising an siRNA molecule or variant thereof as disclosed herein.

[0089] In one embodiment of this aspect, the pharmaceutical composition comprises a polymer selected from the group consisting of hydroxypropyl methylcellulose (HPMC), hydroxypropyl cellulose, methylcellulose, carbomer, hyaluronic acid, chitosan, N-trimethyl chitosan, N-carboxymethyl chitosan, sodium carboxymethylcellulose, polygalacturonic acid, sodium alginate, xanthan gum, xylan gum, scleroglucan, polyvinyl alcohol and polyvinyl pyrrolidone.

[0090] In one embodiment of this aspect, the pharmaceutical composition comprises a complex as described herein.

[0091] Particles comprising silicon complexed with siRNA

[0092] Advantageously, lipid particles comprising hydrolyzable silicon are used, for example, to deliver the siRNA molecules of the invention or variants thereof in vivo. Therefore, according to a fifth aspect of the invention, there is provided a complex comprising:

[0093] (i) lipid particles comprising hydrolyzable silicon;

[0094] (ii) an siRNA or variant thereof as disclosed herein associated with the lipid particle.

[0095] As explained below, the term "lipid particle comprising hydrolyzable silicon" refers to a particle comprising hydrolyzable silicon and one or more lipids.

[0096] In one embodiment of this aspect, the hydrolyzable silicon-containing lipid particles comprise hydrolyzable elemental silicon.

[0097] In a sixth aspect of the present invention, a composite is provided, comprising:

[0098] (i) particles comprising hydrolyzable silicon;

[0099] (ii) optionally, one or more lipids; and

[0100] (iii) an siRNA or variant thereof as disclosed herein associated with the particle.

[0101] In one embodiment of this aspect, the particles comprising hydrolyzable silicon comprise hydrolyzable elemental silicon.

[0102] In one embodiment of these fifth and sixth aspects, the siRNA or variant thereof is associated with said particle in that it is bound to said particle, for example, in that it is electrostatically bound to said particle.

[0103] In one embodiment of these fifth and sixth aspects, the particle comprising hydrolyzable silicon in the complex is a nanoparticle, for example, a silicon-stabilized hybrid lipid nanoparticle (sshLNP) manufactured by SiSaf Ltd (Guildford, UK). TM ).

[0104] As used herein, the term "silicon-stabilized hybrid lipid nanoparticles" refers to nanoparticles comprising silicon and at least some lipids, which nanoparticles have at least some micellar properties. Thus, the lipid molecules present tend to arrange themselves into micelles or micelle-like structures (i.e., structures having at least some micellar properties). Micelles or micelle-like lipid particles are different from liposomes comprising a lipid bilayer, but the term "micelles or micelle-like lipid particles" as used herein allows for at least some liposomal-type structures within the particles, and for this reason, they can be referred to as "hybrid" particles.

[0105] Silicon-stabilized hybrid lipid nanoparticles are generally disclosed in GB2210794.0 (which is incorporated herein by reference and can be obtained when published or from publicly available documents when other patent applications (e.g., international patent applications claiming priority to this document) are published). Advantageous methods for making silicon-stabilized hybrid lipid nanoparticles are generally disclosed in GB2300914.5 (which is also incorporated herein by reference and can also be obtained when published or from publicly available documents when other patent applications (e.g., international patent applications claiming priority to this document) are published).

[0106] Conventional lipid particles (including lipid nanoparticles (LNPs)) have shown some prospects as carriers for delivering therapeutic nucleic acids, particularly delivering therapeutic RNA. RNA is particularly susceptible to degradation during preparation and storage. Various pharmaceutical compositions seeking to limit the degree of RNA degradation have been proposed. One way to limit RNA degradation is to seek to encapsulate RNA in protective micellar lipids. For example, EP3677567A1 discloses lipid particles with mRNA molecules encapsulated in the particle.

[0107] However, various challenges are associated with the use of LNPs for RNA delivery. Among these challenges, micelles or micelle-like lipid particles need to be formed at elevated temperatures. The precise temperature required depends on the lipid used, but a temperature of about 60°C is generally required. Such elevated temperatures lead to significant degradation of RNA and other fragile active ingredients. This can be counteracted to some extent by using modified active ingredients, such as modified RNA. Notably, US 9504651 B2 discloses a method for forming micellar lipid particles "around" mRNA, wherein at least 70% of the mRNA is encapsulated. Of the 30% that is not encapsulated, much appears to be degraded.

[0108] In keeping micelle or micelle-like lipid granule " stable " aspect, also there is relevant challenge.As discussed in GB2210794.0 and GB2300914.5, small lipid granule may have the tendency of coalescing into larger particle.Therefore, improving " stability " comprises resisting the tendency that small micelle or micelle-like lipid granule coalesce into larger particle and resisting the tendency that they lose the electric charge of the charged lipid as the part of micelle or micelle-like lipid granule.In this field, the preparation of the novel lipid with favorable characteristics and the development of multiple lipid has been carried out a large amount of work, and this preparation has favorable characteristics aspect the ability that they form stable micelle or micelle-like particle.

[0109] In the silica-stabilized hybrid lipid nanoparticles, the silica particles, which are themselves smaller than micelles or micelle-like structures, can be "sprinkled" onto the surface of micelles or micelle-like structures and / or "enter" the surface of the lipid particles (i.e., partially penetrate into the lipid particles, but a portion of the silica particles can be touched on the surface), thereby inhibiting the tendency of the lipid particles to aggregate with each other, as well as aligning with any charged lipid components of the lipid particles to protect any charged lipid components of the lipid particles, and also providing the lipid particles with excellent ability to complex with RNA.

[0110] Silica-stabilized hybrid lipid nanoparticles, especially sshLNPs TM The complex of the present invention can advantageously allow electrostatic binding of a large amount of tightly condensed RNA, thereby protecting the RNA from hydrolysis and prolonging its survival in vivo. In addition, silicon-stabilized hybrid lipid nanoparticles, particularly sshLNPs, TM Positive charge and high zeta potential can be provided to improve electrostatic binding of RNA, which can prevent premature dissociation of RNA from the complex.

[0111] In summary, one advantage of silica-stabilized hybrid lipid nanoparticles is the improved stability of micelles or micelle-like lipid particles.

[0112] Silica-stabilized hybrid lipid nanoparticles, especially sshLNPs TM Another advantage resides in the provision of methods for improving the stability of micelles or micelle-like particles that are less dependent on the use of specific novel lipids, particularly cationic or ionizable lipids, whose use may be subject to technical challenges, supply constraints, and intellectual property restrictions.

[0113] By using silicon-stabilized hybrid lipid nanoparticles, sufficiently stable delivery vehicles for RNA can be formed that have a wider range of lipids, including lipids that are lower cost and more readily available than some of the specialized lipids that may be required for use in prior art methods and products to obtain micelles or micelle-like lipid particles with adequate performance.

[0114] Conversely, silicon-stabilized hybrid lipid nanoparticles can also be used with advantageous prior art "high performance" specialty lipids to achieve even superior performance.

[0115] Thus, silicon-stabilized hybrid lipid nanoparticles exploit the discovery that silicon particles (particularly particles containing hydrolyzable silicon) can be used to stabilize micelles or micelle-like lipid particles, inhibit their aggregation, assist cationic lipids and ionizable lipids in maintaining their charge, and promote the ability of micelles or micelle-like lipid particles to protect nucleic acids not by encapsulating but by stabilizing nucleic acids on the surface of micelles or micelle-like lipid particles.

[0116] As described in GB2210794.0 and GB2300914.5, such an arrangement advantageously allows the preparation of micelles or micelle-like lipid particles in the absence of nucleic acids, and nucleic acids can be added to the particles only after the particles have been fully formed and any process involving elevated temperatures has been completed. TM Advantageously, the sshLNP is prepared, stored, and delivered to the clinic, and then the sshLNP is administered to the patient prior to administering the RNA. TM Complexed with RNA (e.g., siRNA or variants thereof as disclosed herein). The delivery vehicle can be stored separately from the RNA until close to the time when the RNA is administered to the patient. Since the delivery vehicle does not contain RNA when stored, it does not need to be stored at a particularly low temperature (such as, below 4° C.) in order to particularly stabilize the RNA.

[0117] It is noteworthy that silica-stabilized hybrid lipid nanoparticles, especially sshLNP TM The complexes are highly versatile because the silica-stabilized hybrid lipid nanoparticles (especially sshLNP TM ) provides very high surface area (>700m 2 / g)、>1cm 3 / g pore volume, stable nanostructure, tunable pore size (2nm to 10nm), two functional surfaces (external and internal), control of particle size and shape, and modifiable particle surface.

[0118] sshLNPs suitable for use in the complexes of the present invention TM Examples of silicon-stabilized hybrid lipid nanoparticles include SIS0012 (with undoped silicon), SIS0012 2LBS (with doped silicon), SIS0013 (with doped silicon), and modified forms thereof (e.g., -N variant, -T variant, and -Q variant, which can be prepared by adding 0.2 mg of NAD, tyrosine, or quercetin, respectively, as additional components).

[0119] This type of sshLNP TM The composition and production of silica-stabilized hybrid lipid nanoparticles (including SIS0012, SIS0013, and SIS00122LBS) are described elsewhere herein. TMThe composition and production of silicon-stabilized hybrid lipid nanoparticles and SIS0013-N, SIS0013-T and SIS0013-Q are also described in UK patent application number 2300912.9, the disclosure of which is hereby incorporated by reference in its entirety (and which may also be obtained upon publication or from publicly available documents upon publication of other patent applications (e.g., international patent applications claiming priority from which).

[0120] The complexes according to these fifth and sixth aspects of the present invention can be prepared in the following manner: siRNA molecules or variants thereof are mixed with suitable solvents (such as water), particles containing hydrolyzable silicon and one or more lipids. The composition may also optionally contain one or more amino acids (e.g., glycine or a mixture of amino acids containing glycine) and optionally one or more non-reducing disaccharides, such as trehalose. Suitable preparation methods may include dispersing the lipid component in a solvent (such as methanol); producing a lipid film by, for example, evaporating the solvent in a rotary evaporator; and hydrating the lipid with an aqueous solution containing activated hydrolyzable silicon particles (e.g., particles with an average particle size of less than 100nm), non-reducing disaccharides (such as trehalose) and one or more amino acids (e.g., glycine). The composition may optionally pass through a filter (e.g., a 0.4pm filter and a 0.1pm filter) to achieve compounding and dispersion of the particles. If further compounding is required to occur, the composition may optionally be stored at 4°C. The carrier thus prepared can then be complexed with an aqueous solution of siRNA or variants thereof in a ratio ranging from 1:6 to 1:16, where 1 represents the nucleic acid. A preferred ratio is 1:8-1:12, where 1:8 generally allows for a small excess of the biological product and 1:12 allows for a small excess of the carrier.

[0121] The hydrolyzable silicon of the lipid particles of the fifth aspect can be in the form of silicon particles. Silicon particles can be pure silicon or substantially pure silicon (or pure doped silicon or substantially pure doped silicon), or another hydrolyzable silicon-containing material (or another hydrolyzable doped silicon-containing material). If the silicon particles are not pure silicon, they contain at least 50% by weight of silicon, that is, they contain at least 50% by weight of silicon atoms by the total mass of atoms in the particles. For example, silicon particles can contain at least 60%, 70%, 80%, 90% or 95% silicon. Silicon particles preferably show their hydrolysis rate, for example, at room temperature in PBS buffer, at least 10% of the hydrolysis rate of pure silicon particles of the same size. Determination for hydrolysis of silicon-containing materials is well known in the art (see, for example, WO2011 / 001456, which is incorporated herein by reference). Although the silicon particles of the present invention may contain some silicon dioxide, silicon dioxide is not hydrolyzable silicon, and at least half of the silicon atoms in the particles are in the form of elemental silicon (or doped elemental silicon).

[0122] The particles containing hydrolyzable silicon of the sixth aspect of the present invention can be pure silicon or substantially pure silicon (or pure doped silicon or substantially pure doped silicon), or another hydrolyzable silicon-containing material (or another hydrolyzable doped silicon-containing material). If the silicon is not pure silicon, it contains at least 50% by weight of silicon, that is, it contains at least 50% by weight of silicon atoms based on the total mass of atoms in the particles. For example, the silicon may contain at least 60%, 70%, 80%, 90% or 95% silicon. Silicon preferably shows its hydrolysis rate, for example, at room temperature in PBS buffer, at least 10% of the hydrolysis rate of pure silicon particles of the same size. Determinations for hydrolyzing silicon-containing materials are well known in the art (see, for example, WO2011 / 001456, which is incorporated herein by reference). Although the silicon of the present invention may contain some silicon dioxide, silicon dioxide is not hydrolyzable silicon, and at least half of the silicon atoms are in the form of elemental silicon (or doped elemental silicon).

[0123] The particles comprising hydrolyzable silicon can be nanoparticles. The nominal diameter of the nanoparticles is between about 1nm and about 500nm, for example, about 1nm to about 250nm, for example, about 1nm to about 100nm (for example, about 30nm), or for example, about 5nm to about 400nm, for example, about 50nm to about 350nm, for example, about 80nm to about 310nm, for example, about 100nm to about 250nm, for example, about 120nm to about 240nm, for example, about 150nm to about 220nm, for example, about 200nm. These particles can be made of pure silicon or hydrolyzable silicon-containing materials. These particles are preferably porous, especially mesoporous. The nominal diameter mentioned above can refer to the average diameter, and at least 90% of the total mass of the particles in the particle sample can fall within the specified particle size range. Particle size can be determined or confirmed by transmission electron microscopy (TEM): for example, using the NIST-NCL Joint Measurement Protocol, PCC-X, Version 1.1, "Measuring the size of nanoparticles using TEM", revised February 2010: https: / / tsapps.nist.gov / publication / get_pdf.cfm?pub_id=854083

[0124] The particles containing hydrolyzable silicon can be made porous by standard techniques (such as, contacting the particles with hydrofluoric acid (HF) / ethanol mixture and applying electric current). By changing the HF concentration and current density and exposure time, the density of the pores and their size can be controlled, and the density of the pores and their size can be monitored by scanning electron microscopy and / or nitrogen adsorption desorption volume isothermal measurement. If the particles are porous, the total surface area of ​​these particles will increase due to their porosity. For example, compared with the surface area of ​​the corresponding non-porous particles, the surface area of ​​these particles can increase by at least about 50% or at least about 100%. According to certain embodiments, the porosity is at least 30%, 40%, 50% or 60%. This means that 30%, 40%, 50% or 60% of the particle volume is pore space, respectively. The preferred pore size is in the range of about 1nm to about 50nm, such as about 5nm to about 25nm, such as about 1nm to about 5nm.

[0125] The hydrolyzable silicon of the fifth aspect or the sixth aspect may be hydrolyzable doped silicon or include hydrolyzable doped silicon. As used herein, the term "doped silicon" may refer to silicon that behaves as an epitaxial semiconductor due to the presence of dopant atoms. The dopant atoms may be substituted dopant atoms or include substituted dopant atoms (replacing Si atoms). Additionally or alternatively, the dopant atoms may be interstitial dopant atoms or include interstitial dopant atoms (wherein Si atoms are not replaced).

[0126] Silicon may optionally be n-doped or p-doped. The present invention includes embodiments in which silicon is doped with one or more elements selected from B, P, Mg, Ca, Cu, Ga, Al, In, Bi, Ge, Li, Xe, N, Au, and Pt. The dopant may be an n-type dopant, for example, phosphorus. Most preferably, the dopant is a p-type dopant. Most preferably, the dopant is boron. The use of a p-type dopant is particularly suitable for stabilizing negatively charged nucleic acids.

[0127] The manufacture of doped silicon is well known in the semiconductor industry and includes ion implantation and diffusion methods. Alternatively, silicon can be doped using a diffusion method to increase the amount of dopant present in the silicon. As an example of a diffusion method, silicon powder and a doping agent (e.g., B2O3 for boron doping) are placed in a bowl, the two are mixed and placed under a N2 atmosphere, and acted at a temperature between 1050°C and 1175°C for a few minutes to allow the dopant (e.g., boron) to diffuse into the silicon.

[0128] According to certain embodiments, the doping of silicon is heavy. Heavy boron doping is particularly preferred. Heavy doping is understood to mean silicon with a doping ratio of 100% boron per cm 3 Doping at least 1×10 15 dopant atoms per cm. The doping level corresponds to a specific resistivity. For example, when boron is used as the dopant, as is preferred, 3 1×10 20 A doping level of 10 dopant atoms corresponds to a resistivity of about 1 mohm-cm. For example, boron can be present at 100 dopant atoms per cm. 3 At least about 1×10 16 boron atoms and cm 3 At most about 1×10 20 The presence of boron atoms.

[0129] Advantageously, doping with hydrolyzable silicon can have a beneficial effect on the electrostatic behavior of silicon. Doping can improve the loading of siRNA or its variants into the complex as disclosed herein. Without being bound by theory, it is believed that this may help to stabilize RNA when RNA circulates in vivo, thereby increasing the in vivo half-life of RNA until RNA reaches the target cell, and then RNA is released in the target cell. Therefore, compared with when using undoped particles, more RNA can reach the target cell within a given time period after administration, resulting in more effective RNA delivery. It should be understood that, as used herein, the term "in vivo half-life of RNA" can refer to the in vivo elimination half-life of RNA, that is, once administered, the time period required for the amount of RNA is shortened by about half. It should also be understood that the term "amount of RNA" can refer to the amount of RNA or its derivatives having the same or substantially the same expected drug effect.

[0130] Doping with p-type dopants (eg, boron) can result in improved binding to negatively charged RNAs, particularly RNAs having a net negative charge at a pH of about 7.4 (as this is a typical physiological pH), such as siRNAs or variants thereof as disclosed herein.

[0131] Where silicon is referred to herein as "undoped" (such as the particles making up SIS0012), this may mean that no or only a few dopant atoms are present, e.g., 3 Up to about 1x10 2 Additionally or alternatively, "undoped" silicon may refer to silicon that does not behave as an epitaxial semiconductor.

[0132] Preferably, the ratio of silicon to nucleic acid is between 0.01:1 and 1:8, for example, between 1:1 and 1:6, between 1:1 and 1:5, between 1:1 and 1:4 or between 1:1 and 1:3. Preferably, the ratio of silicon to nucleic acid is between 1:1 and 1:3. Advantageously, this ratio of silicon to nucleic acid further affects the release rate of the nucleic acid transported by the particle and stabilizes the nucleic acid.

[0133] At least 30% by weight, such as at least 50% by weight, such as at least 80% by weight, such as at least 90% by weight of the nucleic acids (e.g., mRNA or pDNA or siRNA as disclosed herein or variants thereof) present by weight are associated with the silicon particles. This means that the nucleic acids are non-covalently associated with the silicon. Without being bound by theory, it is assumed that when this occurs, the random movement (Brownian motion) of the nucleic acids is reduced and their chances of being degraded are reduced.

[0134] As used herein, the term "lipid" is understood to include fatty acids and fatty acid derivatives, glycerolipids, glycerophospholipids, sphingolipids, glycolipids and polyketides. The term "lipid" can encompass lipidated oligopeptides (a term that can be used interchangeably with the term lipopeptide in this article), wherein a short peptide sequence is conjugated to one or more fatty acid chains. Therefore, one or more lipids may include one or more lipidated oligopeptides.

[0135] The one or more lipids may include an ionizable lipid, a cationic lipid (e.g., DOTAP); an auxiliary lipid, e.g., a phospholipid (e.g., DOPE); a structural lipid, e.g., a cholesterol-based lipid; and / or a polyethylene glycol (PEG) lipid (e.g., DSPE-PEG 2000 ).

[0136] The one or more lipids may contain one or more of the following: phosphatidylcholine (PC); hydrogenated PC; stearylamine (SA); dioleoylphosphatidylethanolamine (DOPE); cholesteryl 3β-N-(dimethylaminoethyl)carbamate hydrochloride (DC-chol); 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP); PEGylated 1,2-distearoyl-sn-glycero-3-phosphoethanolamine (DSPE), such as DSPE-PEG 2000 ; And any of them derivatives. In certain embodiments, the lipid comprises DOTAP, DOPE and DSPE-PEG 2000 Or DOTAP, DOPE and DSPE-PEG 2000 composition.

[0137] It has been found that surface treatment of particles with lipids helps control the release rate of nucleic acids. The type of lipid used to handle the surface of nanoparticles can affect the release rate of nucleic acids. Specifically, surface treatment of silicon particles with lipids has a beneficial effect on the surface charge of the silicon particles, thereby providing the silicon particles with necessary zeta potential to allow the loading of nucleic acids to be improved, and controlling the release rate of nucleic acids at the target site. The presence of at least one lipid allows controlling the hydrolysis rate of silicon so that silicon is hydrolyzed into bioavailable orthosilicic acid (OSA) degradation products, rather than insoluble polymeric hydrolyzates. Controlling the nucleic acid release rate can advantageously regulate the length of the time period of the continuous protection nucleic acid, particularly relates to the protection in vivo in the presence of various body fluids. For example, more nucleic acids rather than otherwise identical compositions can be delivered to target cells in a given time period.

[0138] In certain embodiments, the average molecular weight of one or more lipids may be in the range of 500 to 1000 (for example, when the lipid contains a cationic lipid (for example, DTDTMA (ditetradecyltrimethylammonium), DOTMA (2,3-dioleoyloxypropyl-1-trimethylammonium), DHDTMA (dihexadecyltrimethylammonium), DOTAP (1,2-dioleoyl-3-trimethylammonium-propane), one or more of an auxiliary lipid, a structural lipid, and a PEG lipid, or one or more selected from PC, hydrogenated PC, SA, DOPE, DOTAP, DTDTMA, DHDTMA, DC cholesterol, and their derivatives). During the filtration process Prior to any extrusion of the, the ratio of lipid (i.e., total lipid component) to silicon can be between 1:1 and 40:1, e.g., between 1:1 and 20:1, e.g., between 1:1 and 18:1, 1:1 and 16:1, 1:1 and 11:1, 1:1 and 10:1, 1:1 and 9:1, 1:1 and 8:1, 1:1 and 13:1, 2:1 and 12:1, 2:1 and 11:1, 2:1 and 10:1, 2:1 and 9:1, 2:1 and 8:1, e.g., between 1:1 and 7:1, 2:1 and 7:1, 3:1 and 6:1, 4:1 and 5:1.

[0139] As described herein, one or more lipids can be one or more structured lipids or include one or more structured lipids (e.g., cholesterol-based lipids). However, one or more lipids can optionally exclude structured lipids. Therefore, one or more lipids can exclude sterols; in particular, they can exclude cholesterol. It has been found that the currently disclosed compositions do not need to rely on these types of lipids, while traditional RNA delivery systems generally rely on these types of lipids. Therefore, the compositions disclosed herein have the potential to provide alternatives for RNA delivery systems that rely on these types of lipids, particularly cholesterol. This may be advantageous in the case where cholesterol is not available or (e.g., due to the role of cholesterol in the body) cholesterol cannot be used.

[0140] As described herein, one or more lipids may comprise one or more lipidated oligopeptides. Preferably, one or more lipidated oligopeptides each comprise a fatty acid chain having carbon atoms in the range of about 12 to about 18. Preferably, one or more lipidated oligopeptides each comprise 3 to 20 amino acid residues. Therefore, the lipidated oligopeptide can be a lipidated tetrapeptide, a lipidated pentapeptide or a lipidated hexapeptide.

[0141] In some embodiments, the lipid or lipid component can be a phospholipid or include a phospholipid. The term "phospholipid" refers to a lipid comprising a fatty acid chain and a phosphate group. Particularly suitable phospholipids are glycerophospholipids. Particularly suitable phospholipids are phospholipids in which a polar head group is connected to a quaternary ammonium moiety, such as phosphatidylcholine (PC) or hydrogenated phosphatidylcholine. Another example of a phospholipid is DOPE (phosphatidylethanolamine or 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine).

[0142] Preferably, the side chain of the phospholipid is an aliphatic side chain with 15 or more carbon atoms, or an ether side chain with 6 or more repeating ether units, such as a polyethylene glycol chain or a polypropylene glycol chain. Lipids with ether side chains may be referred to as "PEG-lipids" or "PEGylated" lipids. PEG-lipids may be phospholipids, such as 1,2-distearoyl-sn-glycero-3-phosphoethanolamine (DSPE) with a PEG side chain, for example, DSPE-mPEG2000.

[0143] The lipid component may include one or more of phosphatidylcholine (PC), hydrogenated PC, stearylamine (SA), dioleoylphosphatidylethanolamine (DOPE), DOTAP, cholesteryl 3β-N-(dimethylaminoethyl) carbamate hydrochloride (DC)-cholesterol and derivatives thereof. In certain embodiments, the lipid component may consist essentially of phosphatidylcholine, hydrogenated phosphatidylcholine, stearylamine or a combination thereof.

[0144] A molar ratio of lipid to boron-doped silicon of between 0.8:1 and 20:1 has been found to be particularly advantageous, for example 1:1, 6:1, 8:1 or 10:1 or 12:1 or 16:1.

[0145] In some embodiments, lipid or lipid component can be ionizable lipid or comprise ionizable lipid.Term " ionizable lipid " refers to lipid with the charge that changes according to lipid pKa and environmental pH, for example, keeps uncharged at physiological pH, but becomes protonated (positively charged) at low pH.However, one or more lipids can optionally exclude ionizable lipid.Therefore, as described above, compositions as disclosed herein can advantageously be less dependent on the use of specific novel lipids (including ionizable lipids), which may be subject to technical challenges, supply constraints and intellectual property restrictions in their use.

[0146] In some embodiments, the lipid or lipid component can be a cationic lipid or include a cationic lipid. The term "cationic lipid" refers to a positively charged molecule having a cationic head group attached to a hydrophobic tail via a suitable spacer. Examples include DTDTMA (ditetradecyl trimethylammonium), DOTMA (2,3-dioleoyloxypropyl-1-trimethylammonium), DOTAP, DHDTMA (dihexadecyl trimethylammonium) and stearylamine (SA). The positive charge is usually stabilized by a negative counterion. In certain embodiments, particularly with respect to vaccine compositions, the cationic lipid is DOTAP or includes DOTAP. DOTAP exists in the form of an S enantiomer and an R enantiomer, and can exist in the form of an S form, an R form or in the form of a racemate. Optionally, in the total DOTAP present by weight, the R form and the S form can be approximately equal amounts (i.e., no more than about 60% of the total DOTAP present by weight in either form). For example, at least about 80%, 90%, 95%, 98% or 99% of the total DOTAP is an R form. For example, at least about 80%, 90%, 95%, 98% or 99% of the total DOTAP is in the S form.

[0147] In certain embodiments, the one or more lipids may optionally comprise or consist essentially of a combination of DOTAP, DOPE, and PEG-lipids (particularly DSPE-PEG 2000 ). In certain embodiments, the one or more lipids may optionally comprise or consist essentially of a combination of DOTAP and DOPE. The weight ratio of DOTAP:DOPE may be in the range of about 1:2 to about 2:1 (such as, for example, about 1:1). The weight ratio of DOTAP:PEG-lipid may be in the range of about 10:1 to about 5:1 (such as, for example, about 7:1). The weight ratio of DOPE:PEG-lipid may be in the range of about 10:1 to about 5:1 (such as, for example, about 7:1).

[0148] Nevertheless, as described herein, doping with silicon can enable the use of less cationic lipids, such as DOTAP, compared to conventional compositions for RNA delivery (such as lipid nanoparticles, LNPs comprising cationic lipids). Although cationic lipids may be suitable for electrostatic loading of polyanionic nucleic acids (including various forms of RNA), their amine-rich properties may cause cytotoxicity, immunogenicity, and nonspecific tissue accumulation.

[0149] Thus, in one embodiment, the one or more lipids may optionally exclude a cationic lipid.As described herein, a cationic lipid may not be necessary, particularly when doped silicon, more particularly p-doped silicon, is used.

[0150] In general, the compositions disclosed herein provide the possibility of using less lipids (especially less cationic lipids, such as, less DOTAP and / or less ionizable lipids) in RNA delivery vehicles compared to conventional RNA delivery vehicles (e.g., conventional liposomal nucleic acid delivery vehicles, such as, vehicles commonly used for in vivo mRNA delivery) that do not contain hydrolyzable silicon particles. Additionally or alternatively, hydrolyzable silicon particles can provide RNA delivery vehicles with the possibility of being formulated with a wider range of lipids while still providing transfection efficiency, storage stability and / or targeted delivery to specific types of tissues or to specific types of cells. In turn, this can lead to a reduction in the reliance of the art on specific lipids, particularly cationic lipids, especially cationic lipids that are specifically formulated for RNA delivery purposes and therefore may not be cost-effective or readily available.

[0151] As described herein, the presence of one or more lipids in the complex according to the sixth aspect of the invention is optional. Thus, in some embodiments, there are no lipids in the complex according to the sixth aspect of the invention. As described above, the compositions disclosed herein provide the possibility of using less lipids, and therefore may provide the possibility of not using lipids at all in siRNA delivery.

[0152] Optionally, in addition to or instead of one or more lipids, the particles of the complex according to the sixth aspect of the invention may comprise one or more non-lipid stabilizers for siRNA, for example, quercetin, tyrosine, nicotinamide adenine dinucleotide (NAD) or their derivatives.

[0153] Optionally, in addition to or in place of one or more lipids, the particles of the complex according to the sixth aspect of the invention may contain a peptide containing a cell surface receptor (e.g., integrin) recognition sequence that confers a degree of cell specificity to the in vivo delivery of siRNA. The peptide may have a "head group" containing a cell surface receptor recognition sequence and an additional "tail" that can non-covalently bind to the siRNA and / or silicon.

[0154] Optionally, in addition to one or more lipids or in place of one or more lipids, the particles of the complex according to the sixth aspect of the present invention may include a polycationic nucleic acid binding component. The term "polycationic nucleic acid binding component" is well known in the art and may refer to a polymer having at least 3 repeated cationic amino acid residues or other cationic units with a positively charged group, such polymers being able to compound with nucleic acid under physiological conditions. The example of nucleic acid binding polycationic molecules is an oligopeptide comprising one or more cationic amino acids. The polycationic nucleic acid binding component may be, for example, an oligolysine molecule, an oligohistidine molecule, an oligoarginine molecule, an oligoornithine molecule, an oligodiaminopropionic acid molecule, an oligodiaminobutyric acid molecule, or a combination oligomer comprising any combination of histidine residues, arginine residues, lysine residues, ornithine residues, diaminopropionic acid residues and diaminobutyric acid residues or any combination of these residues. Other examples of polycationic components include dendrimers and polyethyleneimine.

[0155] Treatment of lipid-treated silicon particles with amino acids can also provide a beneficial stabilization effect on nucleic acids. Treatment of lipid-treated silicon particles with amino acids has been shown to stabilize nucleic acids in biological fluids, for example, ocular interstitial fluid and plasma and interstitial fluid. Lipid-treated particles formulated with amino acids in this manner can be particularly useful for delivery to the body, for example, by transdermal injection.

[0156] In one embodiment, the complex according to the sixth aspect of the invention may further comprise one or more amino acids.

[0157] In its broadest sense, the term "amino acid" encompasses any artificial or naturally occurring organic compound containing an amine (-NH2) and a carboxyl (-COOH) functional group. Amino acids include alpha amino acids, beta amino acids, gamma amino acids and delta amino acids. Amino acids include amino acids in any chiral configuration. Amino acids may especially be naturally occurring amino acids. Amino acids may be proteinogenic amino acids or non-proteinogenic amino acids (such as carnitine, levothyroxine, hydroxyproline, ornithine or citrulline).

[0158] One or more amino acids can help stabilize the silicon particles themselves. In vivo, one or more amino acids can help regulate the hydrolysis rate of doped silicon so that silicon is hydrolyzed into bioavailable orthosilicic acid (OSA) degradation products rather than insoluble polymeric hydrolysis products. In this way, one or more amino acids can complement the function of one or more lipids of the present disclosure. Controlling the hydrolysis rate of silicon can affect the release rate of API associated with silicon (e.g., siRNA or variants thereof as disclosed herein). Controlling the API release rate can regulate the length of the time period for sustained protection of the API, particularly in relation to in vivo protection in the presence of various body fluids. Therefore, more API can be delivered to target cells in a given time period rather than an otherwise identical composition.

[0159] In one embodiment, the amino acid is glycine.

[0160] Additionally or alternatively, amino acids that are neutral or positively charged at physiological pH (about pH 7.4) (such as tyrosine or arginine) can stabilize negatively charged APIs (e.g., nucleic acids, such as siRNA or derivatives thereof as disclosed herein). At the same time, amino acids that are neutral or negatively charged at physiological pH (about pH 7.4) can stabilize positively charged APIs. Nevertheless, the mutual influence of charge-based interactions and / or other interactions (e.g., steric interactions) generated by the combination of doped Si, lipids, and amino acids can make it possible for positively charged amino acids at physiological pH to help stabilize positively charged APIs, or for negatively charged amino acids at physiological pH to help stabilize negatively charged APIs.

[0161] The weight ratio of one or more lipids (ie, the total lipid component) to amino acids can range from about 40:1 to about 1:1 (such as, for example, about 32:1).

[0162] Additionally or alternatively, the complex according to the fifth or sixth aspect of the invention may comprise one or more non-reducing disaccharides, particularly trehalose. The weight ratio of one or more lipids (i.e., the total lipid component) to the non-reducing disaccharide may be in the range of about 20:1 to about 1:1 (such as, for example, about 16:1).

[0163] In a seventh aspect of the present invention, a composite is provided, comprising:

[0164] (i) particles comprising hydrolyzable silicon;

[0165] (ii) optionally, one or more lipids; and

[0166] (iii) an siRNA that targets an mRNA encoding a mutant FGFR3 protein, wherein the siRNA targets a portion of the mRNA sequence that includes nucleotides encoding a Gly to Arg mutation at position 380 of the protein, and wherein the siRNA is associated with the particle.

[0167] In one embodiment of this aspect, the sequence of the siRNA corresponds exactly to the portion of the mRNA sequence comprising the nucleotide encoding the Gly to Arg mutation at position 380 of the protein, or the sequence of the siRNA contains one nucleotide difference from the portion of the mRNA sequence comprising the nucleotide encoding the Gly to Arg mutation at position 380 of the protein, as long as the one nucleotide difference is not one of the nucleotides in the nucleotide encoding the Gly to Arg mutation at position 380 of the protein.

[0168] In further embodiments of this aspect, the siRNA, the particle comprising hydrolyzable silicon and the lipid (if present) are as defined elsewhere herein.

[0169] Medical Uses

[0170] The siRNA molecules, pharmaceutical compositions and complexes as disclosed herein are used in the medical field to treat and / or prevent diseases or conditions associated with the G380R mutation in FGFR3, particularly diseases or conditions caused by mutations that result in expression of abnormal gain-of-function mutant FGFR3 proteins. Therefore, in an eighth aspect of the present invention, siRNA molecules or variants thereof, pharmaceutical compositions or complexes as disclosed herein are provided for use as drugs.

[0171] According to a ninth aspect of the present invention, there is provided an siRNA molecule or variant thereof, a pharmaceutical composition or a complex as disclosed herein for use in treating achondroplasia.

[0172] In one embodiment of this aspect, the siRNA molecules or variants thereof, pharmaceutical compositions or complexes as disclosed herein for use are administered to a human subject, e.g., a human between 1 and 12 years of age (e.g., 1 to 10 years of age, 1 to 9 years of age, 2 to 8 years of age, or 2 to 7 years of age) before puberty. In another embodiment of this aspect, a human subject (e.g., a human between 1 and 12 years of age) is treated with the siRNA molecules or variants thereof, pharmaceutical compositions or complexes for a total duration of 1 month to 7 years (e.g., 2 months to 6 years, e.g., 3 months to 5 years, e.g., 4 months to 3 years, e.g., 6 months, 1 year, 2 years, or 3 years). For example, a human subject as defined herein may be administered a siRNA or variant thereof as disclosed herein once a month, e.g., 6 months or 1 year, 2 years, 3 years, 4 years, 5 years, 6 years, 7 years, 8 years, 9 years, 10 years, 11 years, or 12 years, over a period of months or years.

[0173] According to a tenth aspect of the present invention, there is provided an siRNA molecule or variant thereof, a pharmaceutical composition or a complex as disclosed herein for use in downregulating the expression of a FGFR3 protein carrying a Gly to Arg mutation at position 380 (G380R).

[0174] In one embodiment of this aspect, the siRNA molecules or variants thereof, pharmaceutical compositions or complexes as disclosed herein for use are administered to a human subject, e.g., a human between 1 and 12 years of age (e.g., 1 to 10 years of age, 1 to 9 years of age, 2 to 8 years of age, or 2 to 7 years of age) before puberty. In another embodiment of this aspect, a human subject (e.g., a human between 1 and 12 years of age) is treated with the siRNA molecules or variants thereof, pharmaceutical compositions or complexes for a total duration of 0.5 to 7 years (e.g., 1 to 6 years, e.g., 1 to 5 years, e.g., 1 to 3 years, e.g., 1 year, 2 years, or 3 years).

[0175] According to an eleventh aspect of the present invention, there is provided a method for treating achondroplasia in a mammal in need thereof, the method comprising administering to the mammal a pharmaceutically effective dose of an siRNA molecule or variant thereof, a pharmaceutical composition or a complex as disclosed herein.

[0176] In one embodiment of this aspect, the mammal is a human being. In another embodiment of this aspect, the mammal is before puberty, for example, a human being between the ages of 1 to 12 years old (e.g., 1 to 10 years old, 1 to 9 years old, 2 to 8 years old, or 2 to 7 years old). In another embodiment of this aspect, a human being (e.g., a human being between the ages of 1 to 12 years old) is treated with the siRNA molecule or its variant, pharmaceutical composition, or complex for a total duration of 0.5 to 7 years (e.g., 1 to 6 years, e.g., 1 to 5 years, e.g., 1 to 3 years, e.g., 1 year, 2 years, or 3 years).

[0177] The amount of siRNA molecules or variants thereof, pharmaceutical compositions or complexes as disclosed herein required to achieve a therapeutic effect will vary with the specific route of administration and the characteristics of the subject being treated (e.g., age, weight, sex or other concurrent medical conditions), and can be readily determined and administered by an ordinarily skilled physician.

[0178] As disclosed herein, siRNA molecules or variants thereof, pharmaceutical compositions or complexes can be administered, for example, to a mucosa by systemic injection or by topical administration. Advantageously, siRNA molecules or variants thereof, pharmaceutical compositions or complexes are administered systemically, for example, parenterally, for example, intravenously.

[0179] Optimization of siRNA molecules

[0180] The siRNA molecules as described herein can be further optimized for in vivo use via various chemical modifications. Such chemical modifications can, for example, improve the stability of RNA duplexes, further reduce the possibility of off-target effects, improve pharmacodynamics and / or reduce immunogenicity. Therefore, it can be modified, for example, via 2'-alkoxy, 2'-methoxy, 2'-ethoxy, 2'-fluoro, 2'-O-(2-methoxyethyl), 2'-O-benzyl, 2'-O-methyl-4-pyridyl, 2'-amino, 2'-aminoethyl or 2'-guanidinopropyl, for example, at the position 2' of the ribose ring, one or more nucleotides in the nucleotides in the siRNA molecules as disclosed herein or variants thereof are chemically modified.

[0181] siRNA or its variants as disclosed herein can also be combined with a carrier such as a polymer carrier to optimize the siRNA delivery to target cells. Therefore, siRNA molecules as disclosed herein or their variants can be bound to or compounded with a carrier, such as a polymer carrier, for example, polyethyleneimine (PEI) or its derivatives (such as polyethyleneimine-polyethylene glycol-N-acetylgalactosamine (PEI-PEG-GAL or polyethyleneimine-polyethylene glycol-tri-N-acetylgalactosamine (PEI-PEG-triGAL)).

[0182] The phosphate backbone of the siRNA or variants thereof as disclosed herein may be modified to increase resistance to nuclease degradation. This may occur at the 5' or 3' end (to increase resistance to exonucleases) or throughout the entire siRNA molecule (to increase resistance to endonucleases). Such modifications include phosphorothioate bonds, which replace the non-bridging oxygen in the phosphate backbone with a sulfur atom. Thus, the siRNA molecules or variants thereof as disclosed herein may contain one or more phosphorothioate bonds.

[0183] As disclosed herein, siRNA or variants thereof may contain different types of modified nucleotides. As disclosed herein, siRNA molecules or variants thereof may contain one or more modified nucleotides, for example, independently selected from the group consisting of one or more modified nucleotides of the following items: 2'-fluoro modified ribonucleotides, 2'-amino modified ribonucleotides, 2'-sulfur modified ribonucleotides and 2'-deoxy modified ribonucleotides. The one or more modified nucleotides may be present in the sense strand or antisense strand, for example, 2'-fluoro modified ribonucleotides present in the sense strand.

[0184] The siRNA molecules or variants thereof as disclosed herein may, for example, comprise one or more modified nucleotides, e.g., one or more modified nucleotides independently selected from the group consisting of 2'-fluoro-cytidine, 2'-fluoro-uridine, 2'-fluoro-adenosine, 2'-fluoro-guanosine, 2'-amino-cytidine, 2'-amino-uridine, 2'-amino-adenosine, 2'-amino-guanosine and 2'-amino-butyryl-pyrene-uridine.

[0185] The siRNA molecules or variants thereof as disclosed herein may, for example, comprise modified nucleotides selected from the group consisting of 5-bromo-uridine, 5-iodo-uridine, 5-methyl-cytidine, ribo-thymidine, 2-aminopurine, 5-fluoro-cytidine and 5-fluoro-uridine, 2,6-diaminopurine, 4-thio-uridine; and 5-amino-allyl-uridine.

[0186] As disclosed herein, siRNA molecules or variants thereof may, for example, comprise one or more 2'-O-methyl (2'OMe) modifications, wherein a methyl group is added to the 2' hydroxyl of the ribose moiety, thereby forming 2'OMe-guanosine, 2'OMe-uridine, 2'OMe-adenosine or 2'OMe cytosine. Such modifications may occur independently at one or more positions in the position of the siRNA molecule.

[0187] The siRNA molecules can also be modified by replacing ribose with different sugar moieties (e.g., 6-carbon moieties, such as glucose). Thus, the siRNA molecules disclosed herein or variants thereof can be modified by replacing ribose with different moieties (e.g., galactose moieties, mannose moieties, dextrose moieties, glucose moieties, sucrose moieties, or trehalose moieties).

[0188] siRNA can be conjugated to various moieties via terminal or non-terminal nucleotides. Thus, siRNA molecules or variants thereof as disclosed herein can be conjugated to moieties such as N-acetylgalactosamine, N-acetylcysteine, N-acetylaspartic acid, N-acetyltyrosine or N-acetylprocainamide via any terminal or non-terminal nucleotides.

[0189] The present invention will now be further described with reference to the following experimental examples.

[0190] Example

[0191] Example 1: FGFR3 G380R In silico design of specific siRNA and primer pairs.

[0192] Identification of mutant FGFR3 G380R The candidate siRNA sequences were then analyzed using analytical in silico techniques for specific mRNAs. The coding DNA sequences used as the basis for the analysis of siRNA sequences are shown in Table 1 below.

[0193] Table 1

[0194]

[0195]

[0196] The first sequence in the table is a modified NM_000142 sequence with a single G1138A mutation inserted. The column named "Set" indicates that the wild-type transcript is grouped into a set in which a homology analysis is performed. The wild-type NM_000142 sequence is placed in a separate "Hum_wt1" set so that the sequence can be directly compared with the mutant transcript pattern. The remaining people's NM sequences are grouped into a separate set, and all mouse NM sequences in the mouse NM sequence are grouped into the fourth set.

[0197] From mutant FGFR3 G380R Starting from the coding DNA sequence, various siRNAs are designed to supplement the point mutation zone in the mRNA of the mutant human FGFR3 gene. All siRNAs include the single nucleotide replacement (i.e. the G1138A mutation in the human FGFR3 gene) responsible for the ACH phenotype. In order to increase siRNA specificity, the siRNA design strategy optionally includes the additional nucleotide mispairing (i.e., up to 2 mispairings compared with the corresponding target sequence of mutant FGFR3 mRNA) .

[0198] Then the designed siRNA molecules are subjected to computer simulation analysis. The key criteria for analysis include calculating the average adjusted number of mismatches between all alternative transcripts in the specific sequence set (see Table 1 and the paragraph after Table 1) in the core (center) 8nt of the sequence, and calculating the maximum net free energy difference between the siRNA antisense sequences that are combined to all expected target background sequences (usually human genes) compared with the sequence set (mouse NM, etc.), all of which are carried out under standard physiological salt conditions. There is the maximum Δ G difference between the Hummut set and the Humwtl set or the siRNA molecules with >=0.5 mismatches between these two sets in the central 8nt core of the siRNA are considered to have favorable characteristics. Additional criteria for analyzing potential siRNA sequences include:

[0199] Oligomer ΔG: calculated folding free energy for siRNA self-folding;

[0200] Target monomer ΔG: the calculated folding free energy of the target background sequence against its own folding;

[0201] Oligohomodimer ΔG: calculated binding free energy for siRNA binding to another copy of itself;

[0202] Heterodimer net ΔG: the net binding free energy for the binding of the antisense siRNA to the target background sequence taking into account competition with other folded structures;

[0203] The number of mismatches between the sense siRNA (excluding TT overhangs) and the closest matching human wild-type sequence, without considering bulges and frameshifts;

[0204] The percentage of the full-length siRNA sequence that is G or C;

[0205] - Predict binding to homologous sequences in mutant and wild-type genes from human and wild-type mouse transcripts (preferably with good homology to the mutant, but poor homology to other sequences).

[0206] Thirty candidate siRNA sequences were identified and are shown in Table 2 below. G380R mRNA-specific primer pairs (Table 3) were used for gene expression analysis (an essential tool for monitoring gene downregulation induced by siRNA treatment) while removing the confounding effects of wild-type FGFR3 expression.

[0207] Table 2. Candidate siRNA sequences. Bold nucleotides indicate G1138A mutation; underlined nucleotides indicate Additional mismatches in the FGFR3 sequence.

[0208]

[0209]

[0210] Table 3. FGFR3 G380R Candidate primer pairs specific for mutant mRNA.

[0211]

[0212]

[0213] Example 2: FGFR3 WT HEK293 cells and FGFR3 expression G380R Generation of HEK293 expressing cells

[0214] FGFR3 was generated for in vitro screening by WT Expressing cells and FGFR3 G380R Expression cells: Use cells carrying either wild-type (FGFR3 WT ) or G380R mutant (FGFR3 G380R HEK293 cells were stably transfected with GFP-tagged expression vectors of ) FGFR3 gene variants. Briefly, the expression vector ( Figure 1A ). Mutant FGFR3 was obtained by site-directed mutagenesis of wild-type FGFR3 CDS G380R Expression vector. The presence of the target mutation was confirmed by Sanger sequencing ( Figure 1B ). After it is generated, use The expression vector was transfected into HEK293 cells with 3000 reagent, and the transfected cells were positively selected by applying the antibiotic Geneticin (G-418) for 4 weeks. At the end of the selection step, the expression vector was positively selected by real-time RT-PCR ( Figure 2 A) and fluorescence microscopy ( Figure 2 B) GFP expression was confirmed at the mRNA and protein levels. The results showed that HEK-FGFR3 WT Cells and HEK-FGFR3G380R The cells all expressed high levels of GFP, further confirming that the transfection was successful. Since the expression vector used produces FGFR3-GFP fusion protein, the expression of GFP is directly related to the expression of FGFR3 and can be used to monitor gene and protein expression, thus providing a reference for FGFR3. G380R Screening of specific siRNAs presents a reliable readout.

[0215] Example 3: In FGFR3 WT HEK293 cells and FGFR3 expression G380R In vitro screening of candidate proteins in HEK293 cells FGFR3 G380R Specific siRNA

[0216] A preliminary siRNA screen was performed using the transfected HEK cells generated in Example 2. This screen considered the potential of candidate siRNAs in downregulating mutant FGFR3 G380R mRNA without affecting wild-type FGFR3 (FGFR3 WT ) expression. From the 30 FGFR3 identified by the computer simulation design process of Example 1, G380R A first subset of 10 siRNAs were selected from the specific candidate siRNAs for preliminary screening (Table 4).

[0217] Table 4. 10 FGFR3 proteins screened in vitro G380R Sequence of siRNA. The bold nucleotides indicate the G1138A mutation; Underlined nucleotides indicate additional mismatches relative to the wild-type FGFR3 sequence.

[0218]

[0219] Briefly, HEK-FGFR3 WT Cells and HEK-FGFR3 G380R Cells were treated with 100 nM of the selected siRNA combined with Dharmafect transfection reagent for 48 hours. Vehicle (Dharmafect) treated HEK cells were used as controls. At the end of the experiment, RNA was isolated and the efficacy and specificity of the candidate siRNAs were evaluated via RT-PCR analysis of GFP mRNA expression. The results are shown below. Figure 3 and Table 5. The results showed that FGFR3 No. 6 and 8 G380R -siRNA (SEQ ID NO.3 and SEQ ID NO.4, respectively) downregulates mutant FGFR3 G380R mRNA (-50% and -40%, respectively) Figure 3 A) without affecting the wild-type counterpart ( Figure 3 B) is particularly effective in terms of expression.

[0220] Table 5. Targeting candidate FGFR3 G380R Preliminary in vitro screening results of specific siRNA. HEK-FGFR3 G380R Representation table HEK293 cells expressing mutant FGFR3 gene, HEK-FGFR3 WT represents HEK293 cells expressing wild-type FGFR3. Expression is expressed as fold change compared to vehicle control and normalized to human GAPDH. Each value in the table represents Independent experiments and p values ​​were calculated using multiple comparison ANOVA (MC-ANOVA) without any correction.

[0221]

[0222] Example 4: In FGFR3 G380R In vitro testing of HEK293 cells expressing the complex with nanoparticles containing hydrolyzable silica FGFR3 candidate G380R Specific siRNA.

[0223] This selects FGFR3 numbers 6 and 8 G380R -siRNA (SEQ ID NO.3 and SEQ ID NO.4, respectively) for further in vitro screening: FGFR3 generated in Example 2 was used G380R HEK293 cells and FGFR3 expression WT HEK293 cells were used to express siRNA. siRNA was co-expressed with silica-stabilized hybrid lipid nanoparticles (sshLNP) manufactured by SiSa Ltd (Guildford, UK). TM )('BioCouriers') compound.

[0224] The nanoparticles used were SIS0013 and SIS0012 2LBS (formulated with doping materials) and undoped SIS0012. Nanoparticles and siRNA complexes were produced using the protocol described in UK patent application number 2300912.9 and as outlined below. In brief, the composition of the nanoparticles was as follows:

[0225] ·SIS0012 (undoped Si) preparation

[0226] οDOTAP: 7.25mg

[0227] οDOPE: 7.30mg

[0228] οmPEG 2000 -DSPE: 1.45 mg

[0229] οSi (undoped): 1mg

[0230] Glycine: 0.5 mg

[0231] ο Trehalose: 1mg

[0232] οNuclease-free water: up to 10 mL

[0233] ·SIS0013 (doped Si) preparation

[0234] οDOTAP: 7.25mg

[0235] οDOPE: 7.3mg

[0236] οmPEG 2000 -DSPE: 1.45 mg

[0237] ο Boron-doped Si, about 5×10 18 Boron atoms / cm3 :1mg

[0238] Glycine: 0.5 mg

[0239] ο Trehalose: 1mg

[0240] οNuclease-free water: up to 10 mL

[0241] ·SIS0012 2LBS (doped Si) preparation

[0242] οDOTAP: 7.75mg

[0243] οDOPE: 8.25mg

[0244] ο Boron-doped Si, about 5×10 18 Boron atoms / cm 3 :1mg

[0245] Glycine: 0.5 mg

[0246] ο Trehalose: 1mg

[0247] οNuclease-free water: up to 10 mL

[0248] Additional details of the above disclosed components of SIS0012, SIS0013 and SIS0012 2LBS are as follows:

[0249] a) Si (“SiNP”): porous silicon particles with an average diameter of 30 nm. SIS0013 and SIS0012 2LBS were doped (5×10 18 Boron atoms / cm 3 ). Activation by exposure to methanol followed by slow evaporation yields a (dry, solid) powder, i.e., activated SiNPs.

[0250] b) Trehalose ("THR"): solid powder.

[0251] c) Glycine ("GLY"): solid powder.

[0252] d) SiNP+GLY+THR solution: a brown suspension obtained by sonicating a suspension containing the following components in 50 ml of nuclease-free water for 60 minutes: 50 mg activated SiNPs; 50 mg THR; and 25 mg GLY.

[0253] e) DOTAP-Cl solution: a solution obtained by mixing 50 mg of DOTAP in 10 ml of methanol, followed by ultrasonic treatment at 40° C. for 30 minutes until complete dissolution.

[0254] f) DOPE solution: a solution obtained by mixing 50 mg of DOPE in 10 ml of methanol, followed by ultrasonic treatment at 40° C. for 30 minutes until complete dissolution.

[0255] g) mPEG 2000 -DSPE solution: 40 mg mPEG 2000 -DSPE was mixed in 8 ml of methanol and then sonicated at 40°C for 30 minutes until it was completely dissolved.

[0256] The method for preparing the SIS0012 complex, the SIS0012-2LBS complex or the SIS0013 complex is as follows:

[0257] Lipid film preparation

[0258] a) All lipids (DOPE, DOTAP and mPEG2000-DSPE for SIS0012 and SIS0013; DOPE and DOTAP for SIS0012 2LBS) were mixed in a glass round bottom flask.

[0259] b) The solvent was evaporated using a rotary evaporator in a water bath at 40°C.

[0260] Membrane rehydration

[0261] a) Add 1 ml of brown suspension containing the following components to the lipid film: SiNPs (SIS0013 and SIS0012 2LBS: doped; SIS0012: undoped) + GLY + THR (1 mg / ml SiNPs; 0.5 mg / ml GLY; 1 mg / ml THR), and 9 ml of nuclease-free water (therefore, the total volume of the brown suspension and nuclease-free water adds up to 10 ml).

[0262] b) The flask was covered with parafilm and then stirred in a water bath at 60°C for 10 minutes to rehydrate the lipid film by 10 ml of liquid.

[0263] c) The resulting suspension was allowed to stand at room temperature for several hours and then stored at 4°C.

[0264] Extrusion

[0265] The suspension obtained in step (c) of "Rehydration of the membrane" was passed through polycarbonate membrane filters having pore sizes of 0.4 μm and 0.1 μm. The suspension was passed through each pore size 10 times at 60° C. In the case of using undoped SiNPs, the resulting product was SIS0012, and in the case of using doped SiNPs, the resulting product was SIS0013 or SIS0012 2LBS.

[0266] Preparation of siRNA complexes

[0267] The required volume of the appropriate SIS0012, SIS0012 2LBS or SIS0013 suspension (nominal total lipid concentration of 1.6 mg / mL) was mixed with the required volume of siRNA stock solution (concentration of 2 mg / mL) and the final concentration of siRNA was adjusted using nuclease-free water before the complex incubation step. The samples were mixed thoroughly by gently pipetting and incubated at room temperature for 60 minutes to allow complexation to complete. After incubation, the samples were stored at 4°C and then used in subsequent experiments.

[0268] The GFP-tagged FGFR3 produced in Example 2 G380R HEK293 cells expressing the GFP gene were seeded at a cell density of 500K, transfected for 24 hours and evaluated after 48 hours. GFP gene expression was evaluated by real-time PCR and expressed as fold change relative to vehicle control and normalized to human GAPDH. G380R When complexed with -siRNA (SEQ ID NO 3 and SEQ ID NO 4) (Table 6), SIS0013 and SIS0012 2LBS (formulated with doping materials) significantly reduced GFP expression.

[0269]

[0270] Example 5: Generation of an in vivo achondroplasia mouse model

[0271] For in vivo testing of siRNA, a humanized knock-in (KI) mouse model of ACH was generated, which carries a mutant human heterozygous FGFR3 gene encoding the G380R mutation. G380RThe wild-type allele in the mouse Fgfr3 gene is replaced by a human mutant FGFR3 cDNA (NM_000142.5) of a protein. This mouse model completely recapitulates human diseases and is the best choice for developing siRNA-based treatment methods (Lee YC, Song IW, Pai YJ et al., (2017), Knock-in (KI) human FGFR3 achondroplasia mutation as a mouse model for human skeletal dysplasia. Sci Rep 7:43220, DOI:10.1038 / srep43220). In order to generate the KI mouse model, a targeting vector is designed to replace the mouse Fgfr3 gene with a human FGFR3 encoding DNA sequence encoding a G380R mutation using homologous recombination. The schematic diagram of vector design and subsequent homologous recombination is shown in Figure 4 middle.

[0272] This vector is then used to generate mouse embryonic stem cells (ESC) (strain 129 / Sv, agouti), which carry the human FGFR3 encoding DNA sequence encoding the G380R mutation. The resulting ESC is injected into the blastocyst of a C57B1 / 6J female mouse. From the chimeras thus obtained, 3 males with the highest mosaic percentage (assessed by coat color) are selected. These 3 males are hybridized with 3 wild-type females (B6-FGFR3WT / WT). From the F1 generation produced by this hybridization, about 6 young mice per litter are obtained, and the transmission of the mutation of these young mice is 40% to 50% (F1 generation). Males with heterozygous genotypes originating from F1 are hybridized with wild-type females until F10 is reached. At each hybridization, the desired genotype is selected by genotyping using a digital biopsy collected after weaning. Candidate siRNAs are tested using this in vivo mouse model of ACH and their effects on the expression of mutant FGFR3 alleles in vivo and their impact on disease are determined.

[0273] Example 6: In vivo achondroplasia mouse model (FGFR3 G380R Generation and genotyping of KI mice result

[0274] In this model, the gene encoding FGFR3 was used G380RThe wild-type allele of mouse Fgfr3 gene is replaced by the human mutant FGFR3 cDNA (NM 000142.5) of protein. Based on the following literature, mouse model is generated (Lee YC, Song IW, Pai YJ et al., (2017), Knock-in human FGFR3achondroplasia mutation as a mouse model forhuman skeletal dysplasia.Sci Rep7:43220, DOI:10.1038 / srep43220), wherein appropriate modifications are made. The overview of the method is listed in Example 5. The model fully reproduces human diseases and is the best choice for developing siRNA-based therapeutic methods.

[0275] Biogem and L'Aquila University (University ofL'Aquila) (UNIVAQ) have designed targeting vectors in cooperation. Design vectors to replace mouse Fgfr3 gene (Fig. 5) with human FGFR3 encoding DNA sequence carrying G380R mutation via homologous recombination. Then use targeting vectors to transfect mouse embryonic stem cells (ESC) via electroporation, and identify two ESC clones (table 7) from hundreds (about 300) ESC clones that can be used to generate appropriate chimeras. Therefore select these clones, be injected into recipient blastocysts and implanted into surrogate mothers.

[0276] Chimeras obtained from ESC KI experiments were subjected to two different mating strategies to optimize the success rate of obtaining the desired animal model:

[0277] Strategy 1: Chimeras are mated with wild-type (WT) animals, then with FlpE-null animals (to remove the neomycin cassette)

[0278] • Strategy 2: mating of chimeras to FlpE null animals All mice resulting from these mating strategies were subjected to tail biopsies and relevant samples were genotyped to select heterozygous (HT) mice for generation of stable ACH colonies.

[0279] Screening of ACH primers on genomic DNA derived from ESC clones and genotyping of mice derived from mating of chimeras with WT animals followed by mating with FlpE (Strategy 1)

[0280] Table 7. ESC clones used for generation of chimeras and subsequent primer screening and genotyping.

[0281] Sample of ESC clones Number of cells Number of cells 1B3 2 vials containing 500,000 cells each <![CDATA[Two vials each containing 1×10 6 cells]]> 3C9 2 vials containing 500,000 cells each <![CDATA[Two vials each containing 1×10 6 cells]]> 22 / S9(WT) <![CDATA[One vial containing 1×10 6 cells]]>

[0282] ES cell clones were digested and genomic DNA was extracted. All extracted DNA samples were resuspended in TE buffer with an initial volume of 20 μL and analyzed by a spectrophotometer (Nanodrop) to evaluate the concentration and purity of genomic DNA. A DNA sample derived from a 1B3 ES cell clone and a sample derived from a 22 / S9 (WT) ES cell clone were selected and normalized (to obtain a DNA concentration of 100 ng / μL for all samples for use in a PCR system) for PCR analysis. The selected DNA samples were analyzed using 10 different reaction mixtures, each containing a pair of specific primers to be tested (Table 8). The results are shown in Figure 6 The actual sequences of all primers tested in the genotyping experiments for identification of heterozygous animals are shown in Table 12 at the end of this Example.

[0283] Table 8. Primers used in the reaction mixture for identification of heterozygous (HT) animals

[0284]

[0285] Table 9 shows samples obtained from offspring of crosses between chimeric and WT animals. Analysis of the tail biopsy samples listed in Table 9 using primer mix 10 (in Table 8) was able to distinguish between cells carrying the neomycin cassette (NEO+HT, i.e., carrying FGFR3 0380R The animals were selected to identify animals with neomycin positive (NEO-WT, i.e., not carrying the desired mutation) and neomycin negative (NEO-WT, i.e., not carrying the desired mutation) ( FIG. 7 ). A total of 24 neomycin positive animals and 33 neomycin negative animals were identified. Neomycin positive animals were selected for further mating with FlpE mice and subsequently generated stable ACH colonies. The primer sequences in primer mixture 10 (in Table 8) were:

[0286] Forward NEO ACH: CCTGCAGCCTGTTGACAATT [SEQ ID NO.69]

[0287] Reverse NEO ACH: CATCAGAGCAGCCGATTGTC [SEQ ID NO.70]

[0288] Table 9. Littermates and samples obtained from offspring of crosses between chimeras and WT animals

[0289]

[0290]

[0291] Genotyping of mice derived from chimeras directly crossed with FlpE animals (Strategy 2)

[0292] Pups generated from the second mating strategy of crossing biopsy samples directly with FlpE mice were also analyzed (listed in Table 10). Analysis of tail biopsy samples listed in Table 10 using primer mix 10 was able to distinguish animals carrying FlpE (FLP-e+, i.e., considered to carry FGFR3 G380R Mutation potential HT) and FlpE negative animals (FLP-e-, ie not carrying the desired mutation) (Figure 8). A total of 9 FlpE positive animals and 24 FlpE negative animals were identified.

[0293] Table 10. Littermates and samples obtained from progeny of crosses between chimeras and FlpE animals

[0294]

[0295] To further differentiate Flp-e mice, additional PCR assays were performed based on the following primers listed in Table 11. The DNA samples derived from biopsies of the selected mice for analysis were sample 16 (FLP-e+ female agouti) and sample 22 (FLP-e+ male agouti). The results are shown in Fig. 9 Primer mixture 4 in Table 11 was selected for further analysis. The primer sequences for primer mixture 4 in Table 11 were:

[0296] Reverse ACH genotype 0: GCTTGGTCTGTGGGACTGTT [SEQ ID NO.60]

[0297] Forward ACH MUT genotype 2: ACGACTCCGTGTTTGCCCAC [SEQ ID NO.66]

[0298] Table 11. Primers tested for identification of HT animals from the second mating strategy

[0299]

[0300] Table 12. Sequences of all primers tested in genotyping experiments for identification of heterozygous (HT) animals

[0301]

[0302]

[0303] In an additional step to identify HT animals without the neomycin cassette, two additional samples (sample 4: NEO+ female agouti; sample 3: NEO- female agouti) were tested. The results for these samples compared to samples 16 and 22 are shown in Fig.10From the presence of the higher molecular weight bands observed in samples 16 and 22, it can be seen that samples 16 and 22 both contain the G380R mutation, while samples 3 and 4 do not. Additional samples (47, 50, 55, 56, 89, 93, 95 and samples 3 and 22 as controls) were also tested using primer mix 4, and the results are shown in Fig.11 Samples 47, 50, 93, and 95 contained the G380R mutation. All G380R positive samples analyzed (16, 22, 47, 50, 93, and 95) were then tested for the presence of the neomycin cassette using sample 4 (NEO+) and sample 3 (NEO-) as reference samples and were found to be neomycin negative ( Fig.12 ).

[0304] Additional testing of samples obtained from the second FlpE mating strategy identified HT neomycin-free individuals that were also positive for ACH pathology. Animals from this second pool were integrated into the current ACH colony that originally originated from the first mating strategy.

[0305] Example 7: In vivo short-term screening of siRNA formulations and assessment of biodistribution in femoral growth plates and visceral organs

[0306] In short, biodistribution studies were performed using Cy5-labeled siRNAs identified by in vitro screening described herein in combination with lipid particles containing hydrolyzable silicon that form complexes described elsewhere herein. Five-day-old or three-month-old C57BL / 6 male wild-type mice (6 mice / group) were injected with selected siRNA / SiS complexes via intraperitoneal (ip) routes. The control group received empty SiS-biocourier. Mice were killed and their organs were harvested at 0 minutes, 30 minutes, 1 hour, 6 hours, 24 hours, and 48 hours after injection to assess the distribution of the complexes by analyzing the Cy5 fluorescence in different organs. Organ extracts were analyzed by fluorimetry, and frozen sections of organs were analyzed by confocal microscopy. siRNA molecules were also directly detected by stem-loop RT-PCR.

[0307] Pharmacokinetic studies were performed using catheterized 3-month-old C57BL / 6 male wild-type mice (6 mice / group). A single injection of fluorescent siRNA / lipid / Si complex was administered as described in the biodistribution study above. Blood was collected in live mice via jugular vein cannulation, with blood sampling time points (predicted t 1 / 2 The serum samples were collected at t = 0, 15, 30, 1, 2, 6, 24 and 48 hours after injection. Fluorescence levels in serum were assessed using fluorimetry and direct detection of siRNA in serum was performed using stem-loop RT-PCR.

[0308] For toxicity studies, both maximum tolerated dose (single dose, ascending) and dose range finding studies (single dose, repeated) were performed. These studies used 3-month-old C57BL / 6 male wild-type mice (6 mice / group) treated with siRNA / lipid / Si complexes (experimental) or 0.9% w / v NaCl solution (control) as described in the biodistribution study above. Blood was collected by jugular vein cannulation. The evaluations performed were:

[0309] Daily clinical observation;

[0310] Body weight measurement (each time the dose level is changed);

[0311] Food consumption analysis (at each dose level change);

[0312] Clinical pathology at sacrifice by hematology, blood chemistry, and inflammatory cytokine ELISA assays;

[0313] ·Necropsy evaluation: organ weights and macroscopic characteristics;

[0314] Necropsy evaluation: tissue preservation and target organ histopathology (liver, heart, lung, spleen, kidney, bone, muscle and brain).

[0315] While the present invention has been described and illustrated with reference to specific embodiments, it will be appreciated by those skilled in the art that the present invention is susceptible to many different variations not specifically described herein.

[0316] In the foregoing description, when reference is made to integers or elements with known, obvious or foreseeable equivalents, such equivalents are incorporated herein as if set forth separately. Reference should be made to the claims to determine the true scope of the invention, which should be interpreted as encompassing any such equivalents. The reader will also understand that integers or features of the invention described as preferred, advantageous, convenient, etc. are optional and do not limit the scope of the independent claims. In addition, it should be understood that although such optional integers or features may have benefits in certain embodiments of the invention, in other embodiments, the optional integers or features may be undesirable and therefore may not exist.

Claims

1. A siRNA molecule comprising a sequence selected from the group consisting of GCAGGCAUCCUCAGCUACX M GGGUGGGCUUCUUCCUGU (SEQ ID NO: 1), wherein X M selected from nucleotides A and C, wherein the consecutive nucleotides selected from SEQ ID NO: 1 must include the X found at position 19 of SEQ ID NO: 1 M nucleotide; or a variant of the siRNA molecule having at least 1 and no more than 6 nucleotide substitutions relative to SEQ ID NO: 1, provided that the X at the position corresponding to position 19 of the variant siRNA molecule is M The nucleotides are not substituted and are thus selected from said nucleotides A and C, and wherein said siRNA molecule is not a siRNA having a length of 19 nucleotides having the sequence GAAGGCAUCCUCAGCUACA.

2. The siRNA molecule according to claim 1, which is selected from the group consisting of GCUACAGGGUGGGCAUCUU (SEQ ID NO: 4) and GCUAUAGGGUGGGCUUCUU (SEQ ID NO: 3).

3. The siRNA molecule or variant thereof according to claim 1 or claim 2, wherein the siRNA molecule or variant thereof comprises at least 18 or at least 19 consecutive nucleotides of a sequence selected from SEQ ID NO:

1.

4. The siRNA molecule or variant thereof according to any preceding claim, wherein the maximum length of the siRNA molecule or variant thereof is 30 nucleotides or less, preferably 25 nucleotides or less.

5. The siRNA molecule or variant thereof according to any preceding claim, wherein the siRNA molecule or variant thereof has a length of 17 to 25 nucleotides, preferably 19 to 23 nucleotides.

6. The siRNA molecule or variant thereof according to any preceding claim, wherein the siRNA molecule or variant thereof is 20 to 23 nucleotides in length.

7. The siRNA molecule or variant thereof according to any preceding claim, wherein the variant has at least 1 and no more than 3 nucleotide substitutions relative to SEQ ID NO: 1, provided that the X at the position corresponding to position 19 of SEQ ID NO: 1 of the variant siRNA molecule is M The nucleotides are not substituted and are therefore selected from said nucleotides A and C.

8. The siRNA molecule or variant thereof according to any preceding claim, wherein the variant has at least 1 and no more than 2 nucleotide substitutions relative to SEQ ID NO: 1, provided that the X at the position corresponding to position 19 of SEQ ID NO: 1 of the variant siRNA molecule is M The nucleotides are not substituted and are therefore selected from said nucleotides A and C.

9. The siRNA molecule or variant thereof according to any preceding claim, wherein the variant has only one nucleotide substitution relative to SEQ ID NO: 1, provided that the X at the position corresponding to position 19 of SEQ ID NO: 1 of the variant siRNA molecule is M The nucleotides are not substituted and are therefore selected from said nucleotides A and C.

10. The siRNA molecule or variant thereof according to any preceding claim, which is at least partially double-stranded, preferably fully double-stranded, eg, double-stranded along the length of the sequence complementary to the target mRNA.

11. The siRNA molecule or variant thereof according to claim 10, further comprising a single-stranded overhang at one or both 3' ends, preferably wherein the one or both single-stranded overhangs have the sequence UU.

12. The siRNA molecule according to any preceding claim, or a variant thereof, wherein X M is the nucleotide A.

13. The siRNA molecule according to any preceding claim, or a variant thereof, wherein X M is the nucleotide C.

14. The siRNA molecule or variant thereof according to any preceding claim, wherein the siRNA molecule or variant thereof is at least 19 nucleotides in length, and wherein the A corresponding to the position 19 of SEQ ID NO: 1 of the siRNA molecule or variant thereof can be found at any position of the position of the siRNA molecule or variant thereof.

15. The siRNA molecule or variant thereof according to any preceding claim, wherein the siRNA molecule or variant thereof is 19 nucleotides in length, and wherein the A corresponding to position 19 of SEQ ID NO: 1 can be found at position 1, position 6, position 9, position 15 or position 19 of the siRNA molecule or variant thereof.

16. The siRNA molecule or variant thereof according to any preceding claim, wherein the siRNA molecule or variant thereof is 19 nucleotides in length, and wherein the A corresponding to the position 19 of SEQ ID NO: 1 of the siRNA molecule or variant thereof can be found at the position 1, the position 6 or the position 9 of the siRNA molecule or variant thereof.

17. The siRNA molecule or variant thereof according to any one of claims 1 to 13, comprising a sequence selected from the group consisting of: M GGGUGGX4CX5UCUU (SEQ ID NO: 2), wherein X M Selected from the group consisting of: A and C, and wherein X1, X2, X3, X4 and X5 are each independently selected from the group consisting of: A, G, C and U.

18. The siRNA molecule or variant thereof according to claim 17, comprising SEQ ID NO: 2, wherein X1 is selected from G and U, X2 is selected from C and U, X3 is selected from C and U, X4 is selected from G and C, and X5 is selected from A and U.

19. The siRNA molecule or variant thereof according to claim 17 or 18, wherein X4 is G.

20. The siRNA molecule or variant thereof according to any one of claims 17 to 19, wherein X1 is G, X2 is C, X3 is selected from C and U, X4 is G, and X5 is selected from A and U.

21. The siRNA molecule according to any one of claims 17 to 20, selected from the group consisting of GCUAUAGGGUGGGCUUCUU (SEQ ID NO: 3) and GCUACAGGGUGGGCAUCUU (SEQ ID NO: 4).

22. The siRNA molecule or variant thereof according to any one of claims 1 to 13, comprising a sequence selected from the group consisting of a consensus sequence X M X1X2GUGGGCUUCX3UX4CUGU (SEQ ID NO: 5), wherein X M Selected from the group consisting of: A and C, and wherein X1, X2, X3 and X4 are each independently selected from the group consisting of: A, G, C and U.

23. The siRNA molecule or variant thereof according to claim 22, comprising SEQ ID NO:5, wherein X1 is selected from G and A, X2 is selected from G and U, X3 is selected from A and U, and X4 is selected from C and U.

24. The siRNA molecule or variant thereof according to claim 22 or 23, wherein X3 is U.

25. The siRNA molecule or variant thereof according to any one of claims 22 to 24, wherein X1 is selected from A and G, X2 is G, X3 is U, and X4 is selected from C and U.

26. The siRNA molecule according to any one of claims 22 to 25, selected from the group consisting of AAGGUGGGCUUCUUCCUGU (SEQ ID NO: 6) and AGGGUGGGCUUCUUUCUGU (SEQ ID NO: 7).

27. The siRNA molecule or variant thereof according to any one of claims 1 to 13, comprising a sequence selected from the group consisting of: X1CAGCUAX2X M X3GGX4X5GGCUU (SEQ ID NO: 8), wherein X M Selected from the group consisting of: A and C, and wherein X1, X2, X3, X4 and X5 are each independently selected from the group consisting of: A, G, C and U.

28. The siRNA molecule or variant thereof according to claim 27, wherein X1 is selected from A and U, X2 is selected from C and U, X3 is selected from G and U, X4 is selected from A and U, and X5 is selected from C and G.

29. The siRNA molecule or variant thereof according to claim 27 or 28, wherein X2 is C.

30. The siRNA molecule according to any one of claims 27 to 29, selected from the group consisting of UCAGCUACAGGGUCGGCUU (SEQ ID NO: 9) and UCAGCUACAGGGAGGGCUU (SEQ ID NO: 10).

31. The siRNA molecule or variant thereof according to any one of claims 1 to 13, comprising a sequence selected from the group of sequences defined by the consensus sequence X1CAUCCUCAGCX2X3X4XMX5GX6U| (SEQ ID NO: 11), wherein X M Selected from the group consisting of: A and C, and wherein X1, X2, X3, X4, X5 and X6 are each independently selected from the group consisting of: A, G, C and U.

32. The siRNA molecule or variant thereof according to claim 31, wherein X1 is selected from G and U, X2 is selected from C and U, X3 is selected from A and U, X4 is selected from C and U, X5 is selected from G and U, and X6 is selected from G and A.

33. The siRNA molecule of claim 31 or 32, having the sequence GCAUCCUCAGCUAUAGGGU (SEQ ID NO: 12).

34. The siRNA molecule or variant thereof according to any one of claims 1 to 13, comprising a siRNA molecule or variant thereof selected from the consensus sequence GX1AGGX2AUCCUCX3GX4UAX5X M (SEQ ID NO: 13), wherein X M Selected from the group consisting of: A and C, and wherein X1, X2, X3, X4 and X5 are each independently selected from the group consisting of: A, G, C and U.

35. The siRNA molecule or variant thereof according to claim 34, wherein X1 is selected from C and U, X2 is selected from C and U, X3 is selected from A and U, X4 is selected from G and C, and X5 is selected from C and U.

36. The siRNA molecule or variant thereof according to any one of claims 17 to 19, claims 22 to 24, claims 27 to 29, claims 31 to 32 or claims 34 to 35, wherein X M It is A.

37. The siRNA molecule according to any one of claims 1 to 12, comprising a sequence selected from the group consisting of:

38. A siRNA molecule comprising a sequence selected from GX1AGX2X3AUCCX4CX5X6X7UX8X9X M X 10 X11X 12 X 13 X 14 GX 15 CX 16 UCX 17 UX 18 CUGU (SEQ ID NO: 14), wherein X M selected from said nucleotides A and C, wherein said consecutive nucleotides selected from SEQ ID NO: 14 must include X found at position 19 of SEQ ID NO: 14 M Nucleotide; wherein X1 is selected from C and U, X2 is selected from G and U, X3 is selected from C and U, X4 is selected from A and U, X5 is selected from A and U, X6 is selected from G and U, X7 is selected from C, G and U, X8 is selected from A and U, X9 is selected from C and U, X 10 Selected from G, A and U, X 11 Selected from G and U, X 12 Selected from G and A, X 13 Selected from A and U, X 14 Selected from G and C, X 15 Selected from G and C, X 16 Selected from A and U, X 17 Selected from A and U, and X 18 Selected from C and U.

39. The siRNA molecule of claim 38, wherein the siRNA molecule comprises at least 18 or at least 19 consecutive nucleotides of a sequence selected from SEQ ID NO:

14.

40. The siRNA molecule according to claim 38 or 39, wherein the maximum length of the siRNA molecule is 30 nucleotides or less, preferably 25 nucleotides or less.

41. The siRNA molecule according to any one of claims 38 to 40, wherein the siRNA molecule has a length of 17 to 25 nucleotides, preferably 19 to 23 nucleotides.

42. The siRNA molecule according to any one of claims 38 to 41, wherein X M It is A.

43. according to the siRNA molecule described in any one of claims 38 to 42, wherein X 15 is G, and X 17 It's U.

44. The siRNA molecule according to any one of claims 38 to 43, comprising a sequence selected from the group consisting of:

45. A method for producing a siRNA molecule or a variant thereof according to any one of claims 1 to 44, said method comprising the step of synthesizing said siRNA molecule or a variant thereof.

46. ​​A pharmaceutical composition comprising the siRNA molecule or variant thereof according to any one of claims 1 to 44 and a pharmaceutically acceptable carrier.

47. The pharmaceutical composition of claim 46, wherein the composition comprises a polymer selected from the group consisting of hydroxypropyl methylcellulose (HPMC), hydroxypropyl cellulose, methylcellulose, carbomer, hyaluronic acid, chitosan, N-trimethyl chitosan, N-carboxymethyl chitosan, sodium carboxymethylcellulose, polygalacturonic acid, sodium alginate, xanthan gum, xylan gum, scleroglucan, polyvinyl alcohol, and polyvinyl pyrrolidone.

48. A composite comprising: (i) lipid particles comprising hydrolyzable silicon; and (ii) The siRNA or variant thereof according to any one of claims 1 to 44, wherein the siRNA or variant thereof is associated with the lipid particle.

49. A composite comprising: (i) particles comprising hydrolyzable silicon; (ii) optionally, one or more lipids; and (iii) The siRNA or variant thereof according to any one of claims 1 to 44, which is associated with the particle.

50. A composite comprising: (i) particles comprising hydrolyzable silicon; (ii) optionally, one or more lipids; and (iii) an siRNA that targets an mRNA encoding a mutant FGFR3 protein, wherein the siRNA targets a portion of the mRNA sequence that includes a nucleotide encoding a Gly to Arg mutation at position 380 of the protein, and wherein the siRNA is associated with the particle.

51. An siRNA molecule or variant thereof according to any one of claims 1 to 44, a pharmaceutical composition according to claim 46 or 47 or a complex according to any one of claims 48 to 50 for use as a medicament.

52. An siRNA molecule or variant thereof according to any one of claims 1 to 44, a pharmaceutical composition according to claim 46 or 47, or a complex according to any one of claims 48 to 50 for use in treating achondroplasia.

53. An siRNA molecule according to any one of claims 1 to 44 or a variant thereof, a pharmaceutical composition according to claim 46 or 47, or a complex according to any one of claims 48 to 50, for use in downregulating the expression of a FGFR3 protein carrying a Gly to Arg mutation at position 380 (G380R).

Images