Application of Mutation at K568 Site of Ku80 Protein in Regulating Tumor Cell Proliferation and Radiosensitivity

Abstract

The present invention provides the application of the K568 site mutation of Ku80 protein in regulating tumor cell proliferation and radiosensitivity, belonging to the field of biotechnology. The present invention provides the application of a substance capable of causing site-directed mutation at the K568 site of Ku80 protein in the body or cells in any one of the following: inhibiting tumor cell proliferation; inhibiting DNA damage repair in tumor cells; treating tumors; enhancing tumor radiosensitivity; preparing tumor chemotherapy drugs. The experiments of the present invention prove that the K568 site mutation of Ku80 protein can reduce tumor cell viability, inhibit tumor cell proliferation, promote tumor cell apoptosis, inhibit DNA damage repair in tumor cells after radiotherapy, enhance radiosensitivity, and can be used as a target to study related drugs for treating tumors, having potential clinical application value.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to the application of the K568 site mutation of Ku80 protein in regulating tumor cell proliferation and radiosensitivity. Background Art

[0002] Ku80 protein is a protein with important functions in cells. It usually forms a heterodimer with Ku70 protein to jointly form Ku protein. Ku protein has the ability to recognize and bind DNA and regulate immune responses, and is related to the occurrence and development of tumors. Ku80 protein may also be involved in other physiological processes of cells, such as cell cycle regulation and maintenance of chromosome stability. However, at present, the specific mechanism is not fully understood.

[0003] Tumor is one of the major diseases seriously threatening human health. During the occurrence and development of tumors, numerous intracellular molecular mechanisms are disordered. At present, the field of tumor treatment still faces many challenges, such as the generation of drug resistance in tumor cells during treatment and the side effects of treatment means on normal cells. There is still much room for improvement in the effectiveness and specificity of existing tumor treatment methods. Therefore, exploring new tumor treatment strategies based on Ku80 protein has important scientific significance and clinical application prospects. Summary of the Invention

[0004] In order to solve the problems existing in the prior art, the purpose of the present invention is to provide the application of the K568 site mutation of Ku80 protein in regulating tumor cell proliferation and radiosensitivity.

[0005] In order to achieve the above invention purpose, the present invention provides the following technical solutions:

[0006] The present invention provides the application of a substance capable of causing site-directed mutation at the K568 site of Ku80 protein in the body or cells in any of the following:

[0007] (1) Preparing a product for inhibiting tumor cell proliferation;

[0008] (2) Preparing a product for inhibiting DNA damage repair in tumor cells;

[0009] (3) Preparing a product for treating tumors;

[0010] (4) Preparing a product for enhancing the radiosensitivity of tumors;

[0011] (5) Preparing tumor chemotherapy drugs.

[0012] Preferably, the site-directed mutation at the K568 site is: the K at the 568th position of Ku80 protein is mutated to R.

[0013] Preferably, the substance includes any one or more of shRNA, siRNA, dsRNA, miRNA, cDNA, antisense RNA or antisense DNA, low molecular compounds, peptides, and antibodies.

[0014] The present invention also provides the application of the K568 site of Ku80 protein in the body or cells as a target in the development of any of the following products:

[0015] (1) Preparing a product for inhibiting the proliferation of tumor cells;

[0016] (2) Preparing a product for inhibiting DNA damage repair in tumor cells;

[0017] (3) Preparing a product for treating tumors;

[0018] (4) Preparing a product for enhancing the radiosensitivity of tumors;

[0019] (5) Preparing tumor chemotherapy drugs.

[0020] Preferably, the tumor is a tumor expressing Ku80 protein; the tumor cells are tumor cells expressing Ku80 protein.

[0021] The present invention also provides a method for inhibiting the proliferation of tumor cells for non-disease diagnosis or treatment purposes, including the following: making a site-directed mutation at the K568 site of Ku80 protein in tumor cells.

[0022] The present invention also provides a method for inhibiting DNA damage repair of tumor cells for non-disease diagnosis or treatment purposes, including the following: making a site-directed mutation at the K568 site of Ku80 protein in tumor cells.

[0023] The present invention also provides a method for enhancing the radiosensitivity of tumor cells for non-disease diagnosis or treatment purposes, including the following: making a site-directed mutation at the K568 site of Ku80 protein in tumor cells.

[0024] Preferably, the site-directed mutation at the K568 site is: the K at the 568th position of Ku80 protein is mutated to R.

[0025] Preferably, the tumor cells are tumor cells expressing Ku80 protein.

[0026] Compared with the prior art, the beneficial effects of the technical solution of the present invention are as follows:

[0027] Experimental results of this invention show that the mutation of K at the 568th position of Ku80 protein to R can reduce the viability of tumor cells, inhibit the proliferation of tumor cells, promote the apoptosis of tumor cells, inhibit the DNA damage repair of tumor cells after radiotherapy, improve the radiosensitivity, and can be used as a target to study related drugs for treating tumors, with potential clinical application value. Brief Description of the Drawings

[0028] Figure 1 : Sequencing results of Ku80 (WT)-GFP-Flag DNA products;

[0029] Figure 2 : Sequencing results of Ku80 (K568R)-GFP-Flag DNA products;

[0030] Figure 3 : Western blot was used to detect the knockout effect and exogenous expression level of the target protein Ku80 in cells;

[0031] Figure 4 : Sequencing results of Ku80 (K568R)-GFP-Flag positive cells;

[0032] Figure 5 : Sequencing results of the PCR products of Ku80 (K568R)-GFP-Flag positive cells compared with the original sequence;

[0033] Figure 6 : Western blot was used to detect the knockout effect and exogenous expression level of the target protein Ku80;

[0034] Figure 7 : Sequencing results of Ku80 (WT)-GFP-Flag positive cells;

[0035] Figure 8 : Sequencing results of the PCR products of Ku80 (WT)-GFP-Flag positive cells compared with the original sequence;

[0036] Figure 9 : Western blot was used to detect the knockout effect and exogenous expression level of the target protein Ku80 in Ku80 (WT)-GFP-Flag positive cells;

[0037] Figure 10 : Western blot was used to detect the knockout effect and exogenous expression level of the target protein Ku80 in normal HELA cells, GFP-Flag-Ku80(K568R) cell line and GFP-Flag-Ku80(WT) cell line;

[0038] Figure 11: Effect of Ku80 K568R mutation on cell viability;

[0039] Figure 12 : Effect of Ku80 K568R mutation on cell growth;

[0040] Figure 13 : Effect of Ku80 K568R mutation on cells under different drug treatments;

[0041] Figure 14 : Effect of Ku80 K568R mutation on the change of γ-H2AX foci in cells;

[0042] Figure 15 : Effect of Ku80 K568R mutation on apoptosis;

[0043] Figure 16 : Effect of Ku80 K568R mutation on the tumor volume and weight of nude mice. Detailed implementation mode

[0044] The present invention provides the application of a substance capable of site-specific mutation of the K568 site of Ku80 protein in the body or cells in any of the following:

[0045] (1) Preparation of a product for inhibiting the proliferation of tumor cells;

[0046] (2) Preparation of a product for inhibiting DNA damage repair in tumor cells;

[0047] (3) Preparation of a product for treating tumors;

[0048] (4) Preparation of a product for improving the radiosensitivity of tumors;

[0049] (5) Preparation of tumor chemotherapy drugs.

[0050] In the present invention, the inhibition of DNA damage repair in tumor cells preferably refers to enhancing the DNA damage sensitivity of tumor cells, more preferably enhancing the DNA damage sensitivity of tumor cells after irradiation, and inhibiting DNA damage repair in tumor cells; the irradiation is preferably 60 Co γ-ray irradiation.

[0051] The tumors in the present invention are tumors expressing Ku80 protein, preferably cervical cancer and breast cancer; the tumor cells are tumor cells expressing Ku80 protein, preferably cervical cancer cells and breast cancer cells.

[0052] The site-directed mutation at the K568 site in the present invention is as follows: the 568th K (lysine, Lys) of the Ku80 protein is mutated to R (arginine, Arg). The site-directed mutation does not cause frameshift mutation, that is, the substance can mutate the 568th K of the Ku80 protein in the organism or cell to R, and the other amino acid residues of the Ku80 protein remain unchanged.

[0053] The substance in the present invention includes any one or several of shRNA, siRNA, dsRNA, miRNA, cDNA, antisense RNA or antisense DNA, low molecular compounds, peptides and antibodies, but is not limited thereto.

[0054] The present invention also provides the application of the K568 site of the Ku80 protein in the organism or cell as a target in the development of any of the following products:

[0055] (1) Preparing a product for inhibiting the proliferation of tumor cells;

[0056] (2) Preparing a product for inhibiting DNA damage repair in tumor cells;

[0057] (3) Preparing a product for treating tumors;

[0058] (4) Preparing a product for enhancing the radiosensitivity of tumors;

[0059] (5) Preparing tumor chemotherapy drugs.

[0060] The inhibition of DNA damage repair in tumor cells in the present invention preferably refers to enhancing the DNA damage sensitivity of tumor cells, more preferably enhancing the DNA damage sensitivity of tumor cells after irradiation, and inhibiting DNA damage repair in tumor cells; the irradiation is preferably 60 Co γ-ray irradiation.

[0061] The tumor in the present invention is a tumor expressing the Ku80 protein, preferably cervical cancer and breast cancer; the tumor cells are tumor cells expressing the Ku80 protein, preferably cervical cancer cells and breast cancer cells.

[0062] The site-directed mutation at the K568 site in the present invention is as follows: the 568th K of the Ku80 protein is mutated to R. The site-directed mutation does not cause frameshift mutation, that is, the substance can mutate the 568th K of the Ku80 protein in the organism or cell to R, and the other amino acid residues of the Ku80 protein remain unchanged.

[0063] The present invention also provides a method for inhibiting the proliferation of tumor cells or inhibiting the DNA damage repair of tumor cells or enhancing the radiosensitivity of tumor cells, including the following: making a site-directed mutation at the K568 site of the Ku80 protein in tumor cells.

[0064] The site-directed mutation at K568 in the present invention is as follows: the K at the 568th position of the Ku80 protein is mutated to R. The site-directed mutation does not cause a frameshift mutation, that is, the substance can mutate the K at the 568th position of the Ku80 protein in the body or cells to R, and the other amino acid residues of the Ku80 protein remain unchanged. The tumor cells in the present invention are tumor cells expressing the Ku80 protein, preferably cervical cancer and breast cancer cells.

[0065] The above method of the present invention is a method for non-diagnostic or therapeutic purposes. As a non-diagnostic or therapeutic method, it can be used for simple research on tumor cell proliferation or as a positive control when screening drugs that can inhibit tumor cell proliferation.

[0066] Next, the technical solutions of the present invention will be clearly and completely described in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the protection scope of the present invention.

[0067] In the embodiments of the present invention, nude mice were purchased from Beijing SPF Biotechnology Co., Ltd., and the animal production license number is SCXK (Jing) 2019-0010; Lenti-HG Mix was purchased from Genomeditech / GMLCP (1 mg / mL).

[0068] In the specific embodiments of the present invention, the GFP-Flag-Ku80(K568R) cell line and the GFP-Flag-Ku80(WT) cell line were constructed by entrusting GeneCreate Biotechnology Co., Ltd. (Shanghai). The specific construction method is as follows:

[0069] (1) Construction of the CRISPR / Cas9 vector: Synthesize single-stranded DNA oligos of the gRNA sequence (TCTTCCTTGCCAAGTGAGAA, SEQ ID No.1, denoted as Human XRCC5), anneal and pair to generate double-stranded DNA oligos, and directly ligate them into the digested CRISPR / Cas9 vector (GM-31871: LentiGuide-CMV-Neo (stuffer), purchased from Genomeditech Co., Ltd.) through the restriction enzyme sites contained at both ends. The ligation product was transferred into the prepared bacterial competent cells, and the grown monoclonal colonies were identified by sequencing. The clones with correct alignment were the successfully constructed H_XRCC5 sgRNA-Neo (lenti-SpCas9) plasmid.

[0070] (2) Lentivirus packaging of H_XRCC5 sgRNA-Neo

[0071] When the 293T cells grow to 70% - 80%, perform plasmid co - transfection. Transfection system: 850 μL of DMEM, 10 μg of plasmid, 10 μL (10 μg) of Lenti - HG Mix, and 60 μg of HG transgene reagent. Place at room temperature for 20 min, then evenly drop it into the culture dish ready for transfection, and then place it in a CO₂ incubator for culture. After 12 h of transfection, evenly add 100×Enhancing buffer to promote transfection. After 20 h of transfection, carefully aspirate the cell culture medium and discard it into the waste liquid cup containing disinfectant, then add 12 mL of DMEM cell culture medium containing 1% serum and continue to culture. After changing the medium 48 h later, aspirate the cell supernatant into a 50 mL centrifuge tube, centrifuge at 4°C and 4000 g for 5 min. Filter the supernatant through a 0.22 μm filter and transfer it to a new centrifuge tube. Finally, transfer the filtrate to the concentration device in batches, centrifuge at 4°C and 3500 g for 10 min, discard the lower - layer liquid into the waste liquid cup containing disinfectant, and centrifuge at 4°C and 3500 g for 20 min for the last time. At this time, the liquid on the upper layer of the filter is the virus concentrate.

[0072] (3)Construction of lentivirus for over - expression of H_XRCC5

[0073] According to the requirements of the K568R site mutation of the Human XRCC5 gene, construct the codon - optimized target gene sequence / point - mutation sequence into the GM - 8077: PGMLV - CMV - MCS - eGFP - 3×Flag - PGK - Puro (purchased from Genomeditech Co., Ltd.) vector. First, design and synthesize primers, amplify the target fragment, and then ligate it into the digested vector. Transfer the ligation product into the prepared bacterial competent cells, send the grown monoclonal colonies to a sequencing company for sequencing. The correctly aligned clones are the successfully constructed vectors, obtaining the over - expression plasmids PGMLV - CMV - H_XRCC5(p.K568R)(Condon opt)-eGFP - 3×Flag - PGK - Puro and PGMLV - CMV - H_XRCC5(Condon opt)-Egfp - 3×Flag - PGK - Puro.

[0074] The lentivirus packaging process is the same as that in step (2). Use HG transgene reagent to co - transfect the constructed lentivirus vector and its auxiliary packaging element vector plasmid into 293T cells. Add Enhancing buffer 10 - 12 h after transfection, then change to fresh medium 8 h later, continue to culture for 48 h, collect the cell supernatant rich in lentivirus particles, concentrate it to obtain a high - titer lentivirus concentrate, and measure and calibrate the virus titer in 293T cells.

[0075] (4)Construct Cas9-blast HELA cells

[0076] Infect HELA cells with lenti Cas9-Blasticidin (GM-0220LV03, purchased from Genomeditech Co., Ltd.) lentivirus to obtain a stable Cas9-Blast HELA cell line.

[0077] The experimental method is as follows: On the first day, seed 5E4 HELA cells in a 24-well plate. Before infection, take out the virus stock solution from the -80°C refrigerator and thaw it in an ice bath. Dilute the virus stock solution with 500 μL of complete medium at an MOI of 100. Aspirate the original medium from the treatment group, and add 300 μL of medium containing the diluted lentivirus solution to the cells in the treatment group. Replace the culture medium, and after 16 h of infection, completely replace the culture medium containing the lentivirus with 500 μL of complete culture medium. Select appropriate resistant screening cells (the full lethal concentration of Blasticidin is 30 μg / mL, and the maintenance concentration is 15 μg / mL), and perform drug screening for two rounds (3 days for one round). The cells can be stabilized, and after stabilization, use DMEM + 10% FBS + 1% Pen / Strep + 15 μg / mL Blasticidin complete medium to maintain the cells.

[0078] (5)Construct Ku80(K568R)-GFP-Flag cell line and Ku80(WT)-GFP-Flag cell line

[0079] Use the packaged H_XRCC5(p.K568R)(Condon opt), H_XRCC5(Condon opt) lentiviruses and the H_XRCC5 sgRNA6 lentivirus to infect Cas9-blast HELA cells at a ratio of 1:1 to obtain the Ku80(K568R)-GFP-Flag cell line and the Ku80(WT)-GFP-Flag cell line.

[0080] The experimental method is as follows: Inoculate 1E5 Cas9-blast HELA cells into a 12-well plate. Before infection, take out the virus stock solution from the -80°C refrigerator and melt it in an ice bath. Dilute the virus stock solution with 800 μL of complete medium according to MOI = 100. Aspirate the original medium in the treatment group, and add 500 μL of medium containing the diluted lentivirus solution to the cells in the treatment group. Replace the culture medium, and after 16 h of infection, completely replace the culture medium containing the lentivirus with 1 mL of complete medium. For the detection of infection efficiency, observe the fluorescence under an inverted fluorescence microscope to estimate the efficiency of lentivirus infecting the target cells. Select appropriate eukaryotic resistance screening cells (the full lethal concentration of Puromycin is 1 μg / mL, and the maintenance concentration is 0.5 μg / mL). After two rounds of drug screening, the cells can be stabilized. After stabilization, use DMEM + 10% FBS + 1% P.S + 0.5 μg / mL Puromycin complete medium to maintain the cells.

[0081] (6)Mix the clone pool for sequencing and detect the expression effect by WB

[0082] Extract DNA using the DNA extraction kit from Beyotime. The specific operation method can be found in the kit instruction manual. Synthesize PCR amplification primers (56939CF2: CCTGCCCTTTCAGTTACTTGG (SEQ ID No.2); 56939CR2: TGACTAATTAGAGAGTGGCCCAGA (SEQ ID No.3); 75400CF1: AAGGTTGATGAGGAACAGATGAAA (SEQ ID No.4); 75400CR1: CTCGTCATCTCTAGCGGCA (SEQ IDNo.5); 71713CF1: GCCAAGAAGCTGAGAACCG (SEQ ID No.6); 71713CR1: CTCGAAGCTGGCCTTCTTC (SEQ ID No.7)) designed in advance for the codon-optimized sequence of H_XRCC5 for PCR.

[0083] PCR amplification system: 100 ng of template, 2 μL of Test-F, 2 μL of Test-R, 25 μL of PCR mix, and make up to 50 μL with ddH2O.

[0084] Add the above materials into a thin-walled tube, mix well and centrifuge briefly, then put it into a PCR instrument. Select appropriate annealing temperature and extension temperature, and then start PCR amplification. After PCR, perform agarose gel electrophoresis and recover the target gene. Send the recovered PCR product for sequencing.

[0085] The sequencing results of the Ku80 (WT)-GFP-Flag DNA product are as Figure 1; Sequencing accessory name: 0719_32723051603212_(75400-A1-3)_[56939CF2-75541]; 0194_32723052100165_(75400-A4-1A)_[75400CF1-86314]; 0195_32723052100165_(75400-A4-1A)_[75400CR1-86315]. The sequencing results of the Ku80 (K568R)-GFP-Flag DNA product are as follows Figure 2 ; 0695_32723051603200_(71713-A1-2)_[56939CF2-75541]; 0696_32723051603200_(71713-A1-2)_[56939CR2-75542]; 0253_32723051800716_(71713-A1-3)_[71713CF1-86305]; 0254_32723051800716_(71713-A1-3)_[71713CR1-86313].

[0086] Western blot was used to detect the knockout effect and exogenous expression level of the Ku80 target protein in cells, and the results are as follows Figure 3 . Among them, lane S2 is the HELA group overexpressing the H_XRCC5 plasmid, lane S3 is the Ku80 (WT)-GFP-Flag stable transfection group, and lane S6 is the Ku80 (K568R)-GFP-Flag group (the other lanes are the other experimental results of the same group and are retained because they cannot be removed).

[0087] (7) Single-cell separation by limiting dilution method

[0088] The Ku80 (K568R)-GFP-Flag and Ku80 (WT)-GFP-Flag stable transfection strains were diluted with cell culture medium of DMEM + 20% FBS + 1% Pen / Stre + 0.5 μg / mL Puromycin. After 2 - 3 days of culture, the positive wells with single clone growth were marked. After one week, observe the growth of single clones, replenish the liquid in time. After about three weeks, transfer the grown single clones to 48-well plates for expansion culture. When the cell amount reaches that of the 24-well plate, collect samples for subsequent detection.

[0089] (8) Single clone sequencing, TA cloning, and WB verification

[0090] Extract DNA using a DNA extraction kit. Perform PCR amplification using gRNA primers and verify by gel extraction and sequencing. For positive clones with different mutation situations in two alleles, re-perform TA cloning and send for sequencing, and compare with the wild type to determine the mutation situation of each allele.

[0091] According to the sequencing results of the PCR products, Ku80 (K568R)-GFP-Flag identified cell #4 as positive, and the sequencing results are shown in Figure 4 (71713D-A1-primer-71715CF1-88843_H03; 0005_32723061300656_(71713H-B5)_[56939CF2-75541]); Compared with the original sequence, there is only one situation in total for the sequencing results of the PCR products of #4 (except for the empty vector), and the specific sequencing results are shown in Figure 5 . Compared with the parent, 13 bp is deleted and translation is prematurely terminated (including missense). Western blot was used to detect the knockout effect of the target Ku80 protein and the exogenous expression level in Ku80 (K568R)-GFP-Flag positive cells, as shown in Figure 6 . In the figure, lane S2 shows the identification result of Ku80 (K568R)-GFP-Flag (the other lanes are the results of other experiments in the same group and are retained because they cannot be removed).

[0092] According to the sequencing results of the PCR products, Ku80 (WT)-GFP-Flag identified cell #24 as positive, and the sequencing results are shown in Figure 7 (75400MY-2C-primer-75400CF1A-95789_C04; 75400MY-2C-primer-75400CR1A-95790_D04; 56940CD-D7-primer-56939CF2-75541_D07); Compared with the original sequence, there is only one situation in total for the sequencing results of the PCR products of #4 (except for the empty vector), and the specific sequencing results are shown in Figure 8 . Compared with the parent, 1 bp is added and translation is prematurely terminated (including missense). Western blot was used to detect the knockout effect of the target Ku80 protein and the exogenous expression level in Ku80 (WT)-GFP-Flag positive cells, as shown in Figure 9 . In the figure, lane S4 shows the identification result of Ku80 (WT)-GFP-Flag (the other lanes are the results of other experiments in the same group and are retained because they cannot be removed).

[0093] Figure 10Among them, shNC is the normal HELA cell line, and K568R and WT are the GFP-Flag-Ku80(K568R) cell line and the GFP-Flag-Ku80(WT) cell line.

[0094] From the above results, it can be seen that compared with the shNC cell line, the GFP-Flag-Ku80(K568R) cell line and the GFP-Flag-Ku80(WT) cell line have almost knocked out Ku80, and obvious Ku80 expression can be seen at the fused GFP-Flag position. This indicates that the cell lines are successfully constructed, and the GFP-Flag-Ku80(K568R) cell line and the GFP-Flag-Ku80(WT) cell line can be used for verification in the examples.

[0095] In the following examples, unless otherwise specified, all are conventional methods.

[0096] The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0097] Example 1

[0098] Prepare cells (GFP-Flag-Ku80(K568R) cell line and GFP-Flag-Ku80(WT) cell line), and give different doses of 60 Co γ-ray treatment, with a dose rate of 66.49 cGy / min, and collect cells for corresponding detection.

[0099] (1) Colony formation assay

[0100] Under the microscope, the cell growth state is observed to be good. After washing once with 1×PBS, add trypsin for digestion and centrifugation, and then add complete medium to make a single-cell suspension for cell counting. During this period, prepare a 6-well plate and label the corresponding group names. Then calculate the volume of the cell suspension to be inoculated according to the number of cells inoculated in Table 1, and set 3 replicates for each group:

[0101] Table 1 Cell inoculation number table for colony formation assay

[0102]

[0103] After the cells to be inoculated adhere to the wall, irradiate the cells with different doses of 60 Co γ-rays;

[0104] After the irradiation was completed, the 6-well plate was placed in the cell culture incubator for continued culture. During this period, the cells were refreshed with fresh complete medium every 3 days. The growth of the cells was observed under a microscope. After each cell clone contained more than 50 cells (around 14 days), the medium in the 6-well plate was discarded, and the cells were washed once with pre-cooled 1×PBS. Then, 2 mL of absolute methanol was added to each well and fixed for 1 h. After that, the absolute methanol was removed, and 2 mL of Giemsa staining solution was added to each well and stained at room temperature for 3 h.

[0105] After staining was completed, the Giemsa staining solution was recovered, and the 6-well plate was washed three times with water. Then, the cells were observed under a microscope, and the cell clones with more than 50 cells were selected for counting. Finally, statistical analysis was performed using GraphPad Prism 9. Three independent repeated experiments were conducted, and the data were expressed as mean ± standard deviation. * indicates P value < 0.1, ** indicates P value < 0.01, *** indicates P value < 0.001.

[0106] The results are as Figure 11 shown. In the figure, WT-Ku80 is the GFP-Flag-Ku80(WT) cell group, and K568R-Ku80 is the GFP-Flag-Ku80(K568R) cell group. The results show that the Ku80 K568R mutation significantly affects the colony formation ability and colony size of cells, and the cell survival rate is significantly reduced. The Ku80 K568R mutation has a significant impact on the cell proliferation ability and radiation sensitivity.

[0107] (2)Cell Proliferation and Viability Value Detection Experiment

[0108] When the cells were observed to be in good growth state under the microscope, they were washed once with 1×PBS, then trypsin was added for digestion and centrifugation, and then complete medium was added to make a single-cell suspension for cell counting. During this period, an E-Plate detection plate was prepared, and 50 μL of complete medium was added to each culture well. The plate was placed in a multi-functional real-time label-free cell function analyzer (RTCA) in the cell culture incubator, and parameters were set for blank background detection. 100 μL of cell suspension containing 2000 cells was added to each well. First, it was placed in a laminar flow hood at room temperature for 30 min, and then placed in the RTCA instrument for culture. Each group was repeated 3 times.

[0109] After the cells adhered to the plate, the E-Plate detection plate was taken out and given 60 Co γ-ray irradiation (8 Gy). After irradiation, the cell proliferation was detected in real time and dynamically. The cells without 60 Co γ-ray irradiation were used as the control group. After the detection was completed, the program was closed, the data was saved, and the instrument was used for image processing and data analysis. The results are as Figure 12As shown, in the figure, K568R NC is the GFP-Flag-Ku80(K568R) cell group without 60 Co γ-ray irradiation, and WT NC is the GFP-Flag-Ku80(WT) cell group without 60 Co γ-ray irradiation. WT IR is the GFP-Flag-Ku80(WT) cell group after 60 Co γ-ray irradiation, and K568R IR is the GFP-Flag-Ku80(K568R) cell group 60 after Co γ-ray irradiation. It can be seen from Figure 12 this that the Ku80 K568R mutation inhibits cell growth, indicating that the Ku80 K568R mutation has a significant impact on cell proliferation ability and radiation sensitivity.

[0110] After the cells adhered to the wall, the E-Plate detection plate was taken out, the culture medium in the culture wells was sucked off with a vacuum pump, and then the cells were treated with CPT (1 μM), HU (1 mM), ETO (100 nM), and MMC (5 μM) in each culture well respectively. The control group was given an equal volume of DMSO; and real-time dynamic detection was continued; after the detection was completed, the program was closed, the data was saved, and image processing and data analysis were performed with this instrument. The results are as Figure 13 shown. In the figure, WT DMSO, WT CPT, WT HU, WT ETO, and WT MMC respectively represent the groups of GFP-Flag-Ku80(WT) cells after treatment with DMSO, CPT, HU, ETO, and MMC; K568R DMSO, K568R CPT, K568R HU, K568R ETO, and K568R MMC respectively represent the groups of GFP-Flag-Ku80(K568R) cells after treatment with DMSO, CPT, HU, ETO, and MMC. It can be seen that compared with GFP-Flag-Ku80-WT cells, the viability values of GFP-Flag-Ku80-K568R cells decreased significantly after treatment with these drugs, indicating that the Ku80 K568R mutation has a significant impact on cell proliferation ability and drug sensitivity.

[0111] (3) Immunofluorescence experiment

[0112] Pre-soak the cover slips in absolute ethanol. Before cell plating, place the cover slips in a 6-well plate, and then add 2 mL of complete culture medium. Then, the cells were evenly inoculated in the 6-well plate according to the normal cell passage method and placed in a cell culture incubator for culture;

[0113] After the cells adhered to the wall, different doses of 60Treat the cells by Co γ-ray irradiation and sample them at different times (0h, 1h, 2h, 4h, 8h, 12h) after irradiation: First, use a vacuum pump to suck out the old culture medium in the 6-well plate, and then wash it 3 times with ice-cold 1×PBS. Finally, add 2 mL of 4% paraformaldehyde to each well, fix it at room temperature for 30 min, and then store it in a refrigerator at 4°C. After the cells at all time points are fixed, the subsequent steps can be uniformly processed.

[0114] After fixation, first use a vacuum pump to suck out the 4% paraformaldehyde in the 6-well plate, and then wash it 2 times with 1×PBS; then add 2 mL of 0.3% Triton-100 to each well and permeabilize the membrane at room temperature for 20 min; after permeabilization, wash it 2 times with 1×PBS first, and then add 2 mL of 3% BSA to each well and block it at room temperature for 30 min. During this period, prepare the primary antibody by diluting it with 3% BSA according to the dilution ratio in the antibody instruction manual (γH2AX 1:200); after blocking, first use a vacuum pump to suck out and dry the blocking solution, then add the primary antibody (50 μL) dropwise on the coverslip and incubate it overnight in a refrigerator at 4°C, or incubate it at room temperature for 2 h; after the incubation of the primary antibody, add 2 mL of ice-cold 1×PBS to each well, wash the primary antibody at medium speed on a shaker, and repeat 3 times. During this period, prepare the secondary antibody by diluting it with 3% BSA in the dark according to the dilution ratio in the antibody instruction manual (goat anti-rabbit 1:400); after washing the primary antibody, drop the secondary antibody on the surface of the coverslip (50 μL) and incubate it in the dark at room temperature for 1 h; after the incubation of the secondary antibody, add 2 mL of ice-cold 1×PBS to each well, wash the secondary antibody at high speed in the dark on a shaker, and repeat 3 times. During the washing of the secondary antibody, prepare a new glass slide, label the corresponding sample name, and add an anti-quenching mounting medium containing DAPI dropwise on the glass slide. After washing, pick out the coverslip from the 6-well plate, and then cover the side with cells on the glass slide with the mounting medium dropped on it, trying not to generate bubbles as much as possible. Finally, wrap the glass slide with tin foil and store it in a wet box at 4°C;

[0115] Take pictures on a laser confocal microscope 1 day later and perform subsequent analysis and processing. Three independent repeated experiments are carried out, and the data are expressed as mean ± standard deviation, and *** indicates P value < 0.001.

[0116] The results are as Figure 14As shown in the figure. In the figure, A shows the results of immunofluorescence detection of γ-H2AX foci in GFP-Flag-Ku80-WT and GFP-Flag-Ku80-K568R cells irradiated at different time points; B is the statistical chart of γ-H2AX foci. γ-H2AX is a DNA damage marker. When DNA is damaged, γ-H2AX will be phosphorylated, thus marking the damaged DNA site and promoting the repair of DNA damage. The results show that compared with GFP-Flag-Ku80-WT cells, the formation of γ-H2AX foci in GFP-Flag-Ku80(K568R) cells increased significantly, especially at 8 h and 12 h after ionizing radiation, indicating that DNA damage still exists in the late stage after radiation. The Ku80 K568R mutation has a greater impact on cell damage and inhibits cell repair.

[0117] (4)Flow cytometry for detecting cell apoptosis

[0118] The cells were observed to grow well under the microscope. After washing once with 1×PBS, trypsin was added for digestion and centrifugation. Then the cells were seeded in a 12-well plate at a density of 1×10 4 cells / well and cultured in an incubator for 12 h;

[0119] Before the cells were irradiated with 60 Co γ-rays, fresh complete medium was changed. 48 h after 8 Gy irradiation, first use a pipette to transfer the old medium in the 12-well plate to a 1.5 mL centrifuge tube. Then add 300 μL of trypsin to each well of the 12-well plate to digest the cells, and terminate the digestion with the corresponding old medium. Finally, use a pipette to transfer the cell suspension to a 1.5 mL centrifuge tube, centrifuge at 4°C and 1500 rpm for 3 min; after centrifugation, add 1 mL of ice-cold 1×PBS to each well, resuspend and wash with a pipette, and then centrifuge at 4°C and 1500 rpm for 3 min. This step was repeated 2 times. After the last centrifugation, discard the supernatant, and add 100 μL of 1×Annexin V Binding Buffer to gently resuspend the cells. Then, add 2.5 μL of Annexin V-APC and 2.5 μL of 7-AAD staining solution to the cell suspension in the dark, gently mix with a pipette, and incubate at room temperature in the dark for 20 min; after the incubation, add 400 μL of diluted 1×Annexin V Binding Buffer, gently mix with a pipette; immediately perform on-machine detection. The group without 60 Co γ-ray irradiation was used as the control.

[0120] The results are as Figure 15As shown in the figure. In the figure, A is the detection of cell apoptosis rate by flow cytometry; B is the statistical chart of cell apoptosis rate, NR represents the control group, and IR-48h represents the irradiation group. Three independent repeated experiments were conducted, and the data were expressed as mean ± standard deviation. ns indicates no statistical significance, and ** indicates P value < 0.01. The results showed that compared with GFP-Flag-Ku80(WT) cells, the apoptosis rate of GFP-Flag-Ku80(K568R) cells increased significantly after ionizing radiation treatment, further indicating that the Ku80 K568R mutation would increase DNA damage in cells.

[0121] (5) Tumorigenicity experiment in nude mice

[0122] The experiment was divided into 4 groups: Ku80 WT NC group, injected with GFP-Flag-Ku80(WT) cells and not given 60 Co γ-ray irradiation group; Ku80 WT IR group, injected with GFP-Flag-Ku80(WT) cells and given 60 Co γ-ray irradiation group; Ku80 K568R NC group, injected with GFP-Flag-Ku80(K568R) cells and not given 60 Co γ-ray irradiation group; Ku80 K568R IR group, injected with GFP-Flag-Ku80(K568R) cells and not given 60 Co γ-ray irradiation group. There were 5 nude mice in each group.

[0123] Prepare cells in advance, observe the cell growth and cell density under the microscope. The cell growth state was observed to be good under the microscope. Then digest the cells with trypsin. After centrifuging the cells (900 r / min, 3 min), discard the supernatant, add 1×PBS to wash twice, and finally aspirate a part of the cell suspension for cell counting in the last wash, so that there are 1×10 6 cells in every 100 μL of cell suspension, and place the cell suspension on ice for use;

[0124] Take the nude mice out of the SPF-level culture environment to the laminar flow hood. Before inoculation, blow and disperse the cell suspension with a pipette, then use a 1 mL syringe to aspirate 100 μL of cell suspension and subcutaneously inject it into the middle and posterior part of the right axilla of the nude mice. During the inoculation process, pay attention to inserting the needle deeper subcutaneously (1 cm), and slide it left and right several times after insertion to ensure accurate inoculation. After injection, slowly withdraw the needle to prevent the cell suspension from overflowing from the needle hole. The inoculation speed should be slightly rapid to ensure cell viability. Observe the tumor growth situation daily after inoculation;

[0125] Three days after injection, tumors could be observed macroscopically, and 8 Gy was given 60The tumor sites of nude mice were locally irradiated with Co γ-rays. After irradiation, the longest and shortest parts of the tumor were regularly measured with vernier calipers, and the relative tumor volume was calculated. The tumor should not grow too large. When it was observed that the tumor in the nude mice grew to 1000 mm 3 , the tumorigenesis experiment was terminated. Subsequently, the nude mice were sacrificed by cervical dislocation, the tumors were removed, and the tumor weights were measured and photographed at the same time.

[0126] The results are as Figure 16 shown. In the figure, A is the photograph of tumors in each group, B is the tumor weight in each group, and C is the relative tumor volume in each group; NR represents the control group, and IR represents the irradiation group. ** indicates P value < 0.01. The results showed that the therapeutic effect on tumors with Ku80K568R mutation after ionizing radiation treatment was significantly better than that of the GFP-Flag-Ku80(WT) cell group, manifested by the significant reduction in the weight and volume of tumors after Ku80 K568R mutation, indicating that Ku80 K568R mutation inhibited tumor growth and promoted tumor radiosensitivity.

[0127] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. Use of a substance capable of causing site-directed mutation at the K568 site of Ku80 protein in an organism or cell in any of the following: (1) Preparation of products for treating tumors; (2) Preparation of products that improve tumor radiosensitivity; The site-directed mutation of the K568 site is: the 568th K of the Ku80 protein is mutated to R; The substance is the gRNA of sequence number SEQ ID No.1; The tumor is cervical cancer.

2. A method for inhibiting tumor cell proliferation for non-disease diagnosis or treatment purposes, characterized in that: The method comprises the following steps: using gRNA with sequence number SEQ ID No. 1 to cause a site-directed mutation at the K568 site of the Ku80 protein in tumor cells, wherein the site-directed mutation at the K568 site is: the 568th position K of the Ku80 protein is mutated to R; and the tumor cells are cervical cancer cells.

3. A method for inhibiting tumor cell DNA damage repair for non-disease diagnosis or treatment purposes, characterized in that: The method comprises the following steps: using gRNA with sequence number SEQ ID No. 1 to cause a site-directed mutation at the K568 site of the Ku80 protein in tumor cells, wherein the site-directed mutation at the K568 site is: the 568th position K of the Ku80 protein is mutated to R; and the tumor cells are cervical cancer cells.

4. A method for improving the radiotherapy sensitivity of tumor cells for non-disease diagnosis or treatment purposes, characterized in that: The method comprises the following steps: using gRNA with sequence number SEQ ID No. 1 to cause a site-directed mutation at the K568 site of the Ku80 protein in tumor cells, wherein the site-directed mutation at the K568 site is: the 568th position K of the Ku80 protein is mutated to R; and the tumor cells are cervical cancer cells.

Images