Method for biosynthesis of human structural material collagen type vi

Abstract

Methods of providing biologically synthesized human structural material Type VI collagen are provided. The collagen of the present application comprises an amino acid sequence set forth in SEQ ID NO: 2 or a variant amino acid sequence that is mutated from the amino acid sequence set forth in SEQ ID NO: 2, the variant amino acid sequence retaining the function of the amino acid sequence set forth in SEQ ID NO: 2. The collagen of the present application is capable of promoting cell adhesion and has a triple helix structure.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of proteins or polypeptides, in particular to collagen, methods of making and uses thereof. BACKGROUND

[0002] Collagen is a kind of protein widely distributed in human connective tissue, and is also the most abundant protein in the human body, which can account for 25% to 35% of the total amount of protein. Its main functions are reflected in maintaining the extracellular environment, maintaining the normal physiological functions of tissues and organs, repairing body damage, etc. Collagen is a natural biological resource, which has biological tissue compatibility that other high molecular materials cannot match, cell supporting elasticity and degradability. Therefore, collagen can be widely used in the pharmaceutical and cosmetic industries.

[0003] In recent years, with the wide application of genetic engineering technology, researchers have created various types of recombinant collagen. For example, a recombinant collagen can be constructed by selecting a short amino acid sequence from natural human collagen. The recombinant collagen thus constructed has advantages such as low immunogenicity, high biological activity, and good stability. In theory, the shorter the amino acid sequence of the recombinant collagen, the better the transdermal absorption performance. However, the shorter the amino acid sequence is not necessarily better. How to design a short amino acid sequence to make the constructed recombinant collagen have better transdermal absorption performance, there is no theory in the prior art to guide.

[0004] Type VI collagen is a component of the extracellular matrix of almost all connective tissues, including cartilage, bone, tendon, muscle, and cornea, where it forms abundant and uniquely structured microfibrils organized into distinct structural modules. Absence of type VI collagen affects the organization of fibronectin in the extracellular matrix. Non-triple-helical forms of collagen alpha 1 chain type IV inhibit vascular endothelial-cadherin-mediated cell-cell junctions.

[0005] There is a need in the art for new type VI collagen proteins and methods of making the same. SUMMARY

[0006] In response to the current need, the inventors provide new type VI collagen proteins. The type VI collagen proteins herein can be expressed using engineered bacteria. The present application also provides methods of biosynthesizing human structural material type VI collagen.

[0007] In a first aspect, there is provided a collagen comprising a plurality of repeating units, the repeating unit comprising an amino acid sequence set forth in SEQ ID NO: 1 or an amino acid sequence that is a mutation of one or more amino acid residues in the amino acid sequence set forth in SEQ ID NO: 1 or an amino acid sequence that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 1; the number of repeating units is 10-20, 12-18, or 13-16.

[0008] In one embodiment, the number of repeating units is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20.

[0009] In one embodiment, each repeating unit is directly connected or connected through a linker of one amino acid or a plurality of amino acid residues. In one embodiment, the linker comprises 2, 3, 4, 5, 6, 7, or 8 amino acid residues.

[0010] In one embodiment, the mutation is a substitution, an insertion, a deletion, or an addition. In one embodiment, the substitution is a conservative amino acid substitution.

[0011] In one embodiment, the collagen is derived from human. In one embodiment, the collagen has a triple helix structure. In one embodiment, the collagen has cell adhesion efficacy. In one embodiment, the collagen is a recombinant collagen, a recombinant humanized collagen, or a recombinant humanized collagen type VI.

[0012] In one embodiment, the collagen comprises an amino acid sequence of:

[0013] (1) an amino acid sequence set forth in any one of SEQ ID NOs: 2 and 4-7;

[0014] (2) an amino acid sequence that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to an amino acid sequence set forth in any one of SEQ ID NOs: 2 and 4-7; or

[0015] (3) an amino acid sequence that is a mutation of one or more amino acid residues in an amino acid sequence set forth in any one of SEQ ID NOs: 2 and 4-7.

[0016] In one embodiment, the mutation is a substitution, an insertion, a deletion, or an addition. In one embodiment, the substitution is a conservative amino acid substitution.

[0017] In a second aspect, there is provided a nucleic acid encoding a collagen as described herein.

[0018] In one embodiment, the nucleic acid has a nucleotide sequence as set forth in SEQ ID NO: 3.

[0019] In a third aspect, there is provided a vector comprising a nucleic acid as described herein. In one embodiment, the vector comprises a nucleotide encoding a purification tag, a nucleotide encoding a leader, and / or a regulatory element.

[0020] In one embodiment, the purification tag is selected from a His tag, a GST tag, a MBP tag, a SUMO tag, or a NusA tag.

[0021] In one embodiment, the regulatory element is selected from a promoter, a terminator, and / or an enhancer.

[0022] In a fourth aspect, there is provided a host cell comprising a nucleic acid as described herein or a vector as described herein.

[0023] In one embodiment, the host cell is a eukaryotic cell or a prokaryotic cell. In one embodiment, the eukaryotic cell is a yeast cell, an animal cell, and / or an insect cell, and / or the prokaryotic cell is an E. coli cell, for example, E. coli BL21.

[0024] In a fifth aspect, there is provided a method of producing a collagen, comprising:

[0025] (1) culturing a host cell as described herein under suitable culture conditions;

[0026] (2) harvesting the host cell and / or the culture medium comprising the collagen; and

[0027] (3) purifying the collagen, for example, comprising (1) crude purification of the collagen on a Ni affinity column; (2) addition of collagen tool enzymes cleavage; and / or (3) ion exchange column fine purification of the collagen.

[0028] In a sixth aspect, there is provided a composition comprising a collagen, a nucleic acid, a vector, and / or a host cell as described herein.

[0029] In one embodiment, the composition is a pharmaceutical composition or a cosmetic composition.

[0030] In one embodiment, the composition is one or more of a biological dressing, a human bionics material, an orthopedic and cosmetic material, an organoid culture material, a cardiovascular stent material, a coating material, a tissue injection filling material, an ophthalmic material, a gynecological biomaterial, a nerve repair and regeneration material, a liver tissue material, and a blood vessel repair and regeneration material, a 3D printing artificial organ biomaterial, a cosmetic raw material, a pharmaceutical excipient, and a food additive.

[0031] In one embodiment, the composition comprises a pharmaceutically and / or cosmetically acceptable carrier.

[0032] In one embodiment, the composition is a solid, liquid or gel composition.

[0033] In one embodiment, the composition is a composition for oral and / or topical administration, preferably a composition for application.

[0034] In one embodiment, the composition is a kit.

[0035] In one embodiment, the composition is a liquid formulation comprising the collagen described herein and a pharmaceutically and / or cosmetically acceptable carrier.

[0036] In one embodiment, the carrier is a buffer, such as a D-PBS buffer or a PBS buffer.

[0037] In a seventh aspect, there is provided a method of promoting cell adhesion or attachment, the method comprising contacting a cell with the collagen and / or composition herein.

[0038] In an eighth aspect, there is provided use of the collagen, nucleic acid, vector, host cell and / or composition described herein in a biological dressing, a human bionic material, a plastic and aesthetic material, an organoid culture material, a cardiovascular stent material, a coating material, a tissue injection filling material, an ophthalmic material, a gynecological biological material, a nerve repair and regeneration material, a liver tissue material, and a blood vessel repair and regeneration material, or a 3D printing artificial organ biological material.

[0039] In a ninth aspect, there is provided use of the collagen and / or composition described herein in the preparation of a medicament or a kit for promoting cell adhesion or attachment.

[0040] Advantages of the present application include that the collagen described herein is a new humanized collagen type VI which has the efficacy of promoting cell adhesion and has a triple helix structure; the recombinant humanized collagen C6A1 herein has a cell adhesion activity more than 2 times higher than that of bovine collagen type I, achieving an unexpected technical effect. BRIEF DESCRIPTION OF DRAWINGS

[0041] Figure 1 Electrophoretograms of the recombinant humanized collagen type VI are shown.

[0042] Figure 2 Cell adhesion activity of the recombinant humanized collagen type VI is shown. DETAILED DESCRIPTION

[0043] In order to make the objects, technical solutions and advantages of the present application clearer, the following will combine embodiments of the present application to make a clear and complete description of the technical solutions in the embodiments of the present application. Obviously, the described embodiments are part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without creative work fall within the protection scope of the present application.

[0044] As used herein, recombinant humanized collagen is a full-length or partial amino acid sequence fragment of a specific gender gene of human collagen prepared by DNA recombination technology, or a combination containing a functional fragment of human collagen. In this document, the recombinant humanized collagen is a recombinant humanized collagen type VI, which is a peptide or polypeptide of multiple amino acid residues connected by a peptide bond.

[0045] As used herein, the term "and / or" should be considered as a specific disclosure of each of the two specified features or components, including or excluding the other. Thus, the term "and / or" as used herein in a phrase such as "A and / or B" is intended to cover A and B, A or B, A (alone), and B (alone). Likewise, the term "and / or" as used in a phrase such as "A, B, and / or C" is intended to cover each of the following aspects: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).

[0046] As used herein, "one or more" can be any suitable integer. In the case of collagen mutations (e.g., substitutions, deletions, insertions, or additions), "one or more" is a number readily determined by those of skill in the art, such as 1-90 and any integer and range therebetween, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, or 39, etc.

[0047] As used herein, "nucleic acid" refers to a plurality of nucleotides connected by internucleotide linkages. The internucleotide linkages can be, for example, phosphodiester bonds. The nucleic acid herein can comprise a polynucleotide encoding a polypeptide of the present application. For the subsequent processing of the polypeptide, the nucleic acid of the present application can also comprise nucleotides encoding a purification tag, such as a His tag, a GST tag, an MBP tag, a SUMO tag, or a NusA tag, and a nucleotide sequence encoding a leader sequence when needed.

[0048] As used herein, the term "vector" is a nucleic acid vehicle into which a polynucleotide can be inserted. When the vector is capable of directing the expression of a polynucleotide inserted into it, the vector is referred to as an expression vector. A vector can be introduced into a host cell by transformation, transduction or transfection, so that the host cell takes up (and replicates) the genetic material carried by the vector. Vectors are well known to those skilled in the art and include, but are not limited to, plasmids; phagemids; cosmids; artificial chromosomes, such as yeast artificial chromosomes (YAC), bacterial artificial chromosomes (BAC) or P1 -derived artificial chromosomes (PAC); bacteriophages such as lambda phage or M13 phage; and animal viruses. Vectors can contain a variety of elements that control expression, including but not limited to promoter sequences, transcriptional start sequences, enhancer sequences, selection elements and reporter genes. In addition, vectors can contain a replication origin. A vector can comprise a nucleic acid of the application to facilitate introduction into a cell for expression. A vector can comprise expression control elements operably linked to the nucleic acid, such as a promoter, terminator and / or enhancer.

[0049] As used herein, the term "host cell" is a cell into which a nucleic acid molecule has been introduced by molecular biology techniques. These techniques include transfection with viral vectors, transformation with plasmid vectors, and introduction of naked DNA by electroporation, lipofection, and particle gun acceleration. The host cell can be a eukaryotic cell or a prokaryotic cell. For example, the eukaryotic cell is a yeast cell, an animal cell and / or an insect cell. The prokaryotic cell can be an E. coli cell.

[0050] As used herein, "biological dressing" is a new type of medical dressing that can be used for the repair and treatment of wounds. It is a special medical material made by professional manufacturers from biological materials and combined with drugs or other therapeutic substances. The collagen in the biological dressing forms a protective layer on the wound surface, promotes cell proliferation and regeneration, and accelerates wound healing.

[0051] As used herein, "biomimetic material" refers to a material developed by imitating various characteristics or properties of living organisms. Artificial materials designed and manufactured by imitating the operating mode of life systems and the structural rules of biological materials are generally referred to as biomimetic materials. "Human biomimetic material" refers to a material developed by imitating various characteristics or properties of the human body. Artificial materials designed and manufactured by imitating the operating mode of life systems and the structural rules of biological materials are generally referred to as biomimetic materials.

[0052] As used herein, "organoid culture material" refers to an artificial material used to culture and construct artificial organs with organoid functions to meet the needs of organ transplantation and replacement.

[0053] As used herein, "biomaterial" refers to a material that is compatible with living tissue, which is typically used to make artificial organs or replacement tissues. "3D-printed artificial organ biomaterial" refers to a biomaterial employed in a 3D-printed artificial organ.

[0054] As used herein, the relatedness between two amino acid sequences or between two nucleotide sequences is described by the parameter "sequence identity". For the purposes of the present application, sequence identity between two amino acid sequences is determined using the Needleman-Wunsch algorithm as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277), preferably version 5.0.0 or later. The parameters used are a gap open penalty of 10 and a gap extension penalty of 0.5, and the EBLOSUM62 (EMBOSS version of BLOSUM62) substitution matrix. The output of Needle labeled "longest identity" (obtained using the -nlp option) is used as the percent sequence identity, and is calculated as follows:

[0055] (identical residues x 100) / (length of alignment - total number of gaps in the alignment)

[0056] For the purposes of the present application, sequence identity between two deoxynucleotide sequences is determined using the Needleman-Wunsch algorithm as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, ibid) (preferably version 5.0.0 or later). The parameters used are a gap open penalty of 10 and a gap extension penalty of 0.5, and the EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix. The output of Needle labeled "longest identity" (obtained using the -nlp option) is used as the percent sequence identity, and is calculated as follows:

[0057] (identical deoxyribonucleotides x 100) / (length of alignment - total number of gaps in the alignment)

[0058] In the context of the present application, a conservative amino acid substitution or conservative substitution can be defined by a substitution within an amino acid class reflected in one or more of the following tables:

[0059] Amino acid residues of conservative class:

[0060] Acidic residues D and E Basic residues K, R, and H Hydrophilic uncharged residues S, T, N and Q Aliphatic uncharged residues G, A, V, L and I Nonpolar uncharged residues C, M and P Aromatic residues F, Y and W

[0061] Alternative physical and functional classification of amino acid residues:

[0062] Alcohol-containing residues S and T Aliphatic residues I, L, V and M Cycloalkenyl-related residues F, H, W and Y Hydrophobic residues A, C, F, G, H, I, L, M, R, T, V, W and Y Negatively charged residues D and E Polar residues C, D, E, H, K, N, Q, R, S and T Positively charged residues H, K and R Small residues A, C, D, G, N, P, S, T and V Very small residues A, G and S Residues involved in the formation of turns A, C, D, E, G, H, K, N, Q, R, S, P and T Flexible residues Q, T, K, S, G, P, D, E and R

[0063] As used herein, the term "triple helix" protein is understood to refer to a homotrimeric or heterotrimeric protein comprising at least one "triple helix domain". The term encompasses variants and fragments of triple helix proteins and functional equivalents and derivatives thereof, preferably retaining the (Gly-X-Y)n sequence. The term "triple helix structure" refers to a protein comprising the general formula (Gly-X-Y)n, wherein Gly is glycine, X and Y represent the same or different amino acids (which can vary in particular in the range of different Gly-X-Y triplets), and wherein n can be between 2 and 300. A triple helix domain consists of three strands, the strands being characterized by a repeating (Gly-X-Y)n motif folded into a triple helix protein conformation.

[0064] Recombinant humanized collagen type VI

[0065] In this context, the recombinant humanized collagen type VI of the present application can present certain mutations. For example, the amino acid sequence of one or more of these portions can present substitutions, deletions, additions or insertions of amino acid residues. That is, variants can be used by the present application, as long as the variants retain the activity of promoting cell adhesion and / or proliferation. In particular, the variants can have a certain percentage of identity with the specified sequence, for example at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identity, or any numerical range therebetween. The specified sequence can be any sequence of the present application, for example any one of SEQ ID NO: 1 or 2 or 4-7, but preferably these variants retain the function of the recombinant humanized collagen type VI of the present application. The recombinant humanized collagen type VI of the present application can have good cell adhesion efficacy and have a triple helix structure.

[0066] The recombinant humanized collagen type VI of the present application can be prepared by any suitable means, for example it can be prepared by synthesis. Preferably, the recombinant humanized collagen type VI of the present application can be prepared by recombinant means.

[0067] The collagen of the present application can have a triple helix structure region, i.e., collagen in the form of a triple helix structure, i.e., having three identical collagen strands. For example, the collagen has a flexible triple helix structure region. The collagen of the present application can form a triple helix structure. It has been determined that the recombinant humanized collagen type VI C6A1 of the present application can form a triple helix structure. The triple helix structure of collagen is formed by three polypeptide chains intertwined with each other. Each polypeptide chain is formed by a number of amino acids, among which glycine, proline and hydroxyproline are particularly important in the structure of collagen. Each of these amino acids is capable of forming a hydrogen bond, which can link the three polypeptide chains into a triple helix structure. In this process, each polypeptide chain is interwoven with the other two polypeptide chains in the same way. Studies have shown that the triple helix structure of collagen plays a crucial role in its thermal stability. The three-dimensional structure formed by the polypeptide chains intertwined by hydrogen bonds is very stable. A large number of experimental results show that a very high temperature or pH is required to destroy the triple helix structure of collagen. In the body, the thermal stability of collagen can bring many benefits. For example, due to the high thermal stability, collagen can remain stable in the human body for a long time and play its own role. This stability also provides collagen with resistance, which can withstand the pressure generated by daily physical movement and metabolic processes without breaking or decomposing.

[0068] As used herein, a recombinant humanized collagen is a full-length or partial amino acid sequence fragment of a human collagen of a specific gender gene encoded by DNA recombination technology, or a combination containing a functional fragment of a human collagen. In this context, a recombinant humanized collagen is a recombinant humanized collagen type VI, which is a peptide or polypeptide of a plurality of amino acid residues connected by a peptide bond. The recombinant humanized collagen can be a recombinant humanized collagen formed by tandem repeats of a plurality of repeat units. Methods for preparing a recombinant humanized collagen by a tandem repeat strategy are known to those skilled in the art. The selection of the number of repeat units is routine to those skilled in the art. For example, the recombinant humanized collagen can have 2-50 repeat units, for example, 2-10. It should be understood that the recombinant humanized collagen formed by repeat units within this range has similar functions. Prior art documents report that a recombinant collagen can be constructed by tandem repeats of repeat units. The number of repeat units can vary. For example, Chen Hua et al. Biochemical and Biophysical Research Communications 508 (2019) 1018e1023 discloses that both GERGAPGFRGPAGPNGIPGEKGPAGERGAP repeat units and T16, which is a 16 tandem repeat of the repeat units, have cell adhesion activity, and it is believed that a recombinant protein containing a triple helix fragment with a plurality of tandem repeats can have a more stable helical conformation or a more favorable ligand binding configuration to facilitate cell membrane attachment and adhesion. R. Strawn et al., Biopolymers 109 (2018), e23226 demonstrates that a recombinant collagen-like protein with a plurality of identical triple helix peptide units arranged in a tandem repeat manner can self-assemble into microfibers for use in the fields of biopharmaceuticals and industry. J. Yao et al., J. Biochem. 136 (2004) 643e649 reports that a recombinant collagen-like protein containing a tandem repeat of collagen peptide type I shows high cell adhesion activity.

[0069] Composition

[0070] The recombinant humanized type VI collagen of the present application can be prepared as a composition. The composition can comprise the recombinant humanized type VI collagen, nucleic acid, vector and / or host cell described herein. The composition can further comprise a pharmaceutically and / or cosmetically acceptable carrier or solvent. The composition can be a pharmaceutical composition or a cosmetic composition for the purpose of a drug and / or a cosmetic. For example, the composition is one or more of a biological dressing, a human body bionics material, a plastic and cosmetic material, an organoid culture material, a cardiovascular stent material, a coating material, a tissue injection filling material, an ophthalmic material, a gynecological biomaterial, a nerve repair and regeneration material, a liver tissue material and a blood vessel repair and regeneration material, a 3D printing artificial organ biomaterial, a cosmetic raw material, a pharmaceutical excipient, and a food additive.

[0071] The part to which the cosmetic composition is applied is not particularly limited, and can be the face, hands, legs, torso, etc. The form of the composition is not particularly limited, as long as the intended function can be achieved. For example, the composition is a solid, liquid or gel composition.

[0072] The composition can be applied in any suitable manner, for example as a composition for oral and / or topical administration. The composition can also be prepared as a kit. The kit can comprise additional ingredients, for example auxiliary ingredients such as a buffer, and instructions for use. In particular, the composition can be formulated into a suitable formulation, such as a liquid formulation. The formulation can comprise a buffer, for example a D-PBS buffer or a PBS buffer.

[0073] Methods and uses

[0074] Provided herein are methods of adhering or anchoring cells, the method comprising contacting the cells with the recombinant humanized type VI collagen, composition and / or liquid formulation described herein. The methods of the present application can be performed in vitro to increase cell adhesion to a culture vessel. Alternatively, the methods of the present application can also be performed in vivo. The present application also provides the use of the recombinant humanized type VI collagen, composition and / or liquid formulation described herein in the manufacture of a medicament and / or a kit for increasing cell adhesion. In addition to the collagen described herein, the kit can also comprise a suitable carrier, diluent or excipient, etc., and instructions for use of the collagen.

[0075] Examples

[0076] The following examples are provided to illustrate the present application. Those skilled in the art will appreciate that the examples are illustrative only, and are not meant as limitations on the scope of the application, which is defined only by the claims appended hereto.

[0077] Example 1: Construction, expression and screening of humanized type VI collagen fragments

[0078] 1. Large-scale functional region screening was performed to obtain the following functional regions of the target gene of humanized type VI collagen.

[0079] C6A1 amino acid sequence: ENLYFQ

[0080] Gppgekgeagdegnpgpdgapgerggpger

[0081] Gppgekgeagdegnpgpdgapgerggpger

[0082] Gppgekgeagdegnpgpdgapgerggpger

[0083] Gppgekgeagdegnpgpdgapgerggpger

[0084] (SEQ ID NO: 2; the repeat unit is Gppgekgeagdegnpgpdgapgerggpger, SEQ ID NO: 1).

[0085] The inventors designed the C6A1 nucleotide sequence for the C6A1 amino acid sequence.

[0086] C6A1 nucleotide sequence:

[0087] GGATCCGAAAATCTGTATTTTCAGGGTCCGCCGGGTGAAAAAGGTGAAGCAGGTGATGAAGGTAATCCGGGTCCGGATGGTGCACCGGGTGAACGTGGTGGTCCTGGTGAACGTGGTCCGCCTGGTGAAAAAGGTGAAGCAGGTGATGAAGGTAATCCGGGTCCGGATGGTGCACCGGGTGAACGTGGTGGTCCTGGTGAACGTGGTCCGCCTGGTGAAAAAGGTGAAGCAGGTGATGAAGGTAATCCGGGTCCGGATGGTGCACCGGGTGAACGTGGTGGTCCTGGTGAACGTGGTCCGCCTGGTGAAAAAGGTGAAGCAGGTGATGAAGGTAATCCGGGTCCGGATGGTGCACCGGGTGAACGTGGTGGTCCTGGTGAACGTTAAAAGCTT (SEQ ID NO: 3).

[0088] 2. Construction of E. coli genetically engineered bacteria

[0089] The C6A1 nucleotide sequence is cloned into an expression vector, and then the expression vector is transformed into an E. coli expression strain, and an E. coli genetically engineered bacterium is screened.

[0090] Specifically, according to the amino acid sequence of C6A1 (SEQ ID NO: 2), the codon gene of SEQ ID NO: 3 preferred by E. coli is optimized and selected. The nucleotide sequence of SEQ ID NO: 3 is synthesized. The C6A1 gene fragment is inserted into the pET-32a expression vector (Beijing Lihe Huada Gene Technology Co., Ltd.) through the enzyme digestion sites of Kpn I (NEB, Catalog No.: R0136L) and Xho I (NEB, Catalog No.: R0146L), and the pET-32a-C6A1 expression vector is constructed. The expression vector is introduced into E. coli BL21 (DE3), and a positive E. coli genetically engineered bacterium is screened. The above operations are entrusted to Beijing Lihe Huada Gene Technology Co., Ltd.

[0091] 3. Fermentation culture of the E. coli genetically engineered bacterium

[0092] The successfully constructed expression plasmid is transformed into the E. coli competent cell BL21 (DE3). The specific process is as follows:

[0093] (1). The E. coli competent cell BL21 (DE3) is taken out from the ultra-low temperature refrigerator and placed on ice, 2 μl of the to-be-transformed plasmid is added into the competent cell BL21 (DE3), and it is mixed for 2-3 times.

[0094] (2). The mixture is placed in an ice bath for 30 min, and then it is heat shocked at 42℃ for 45-90 s, and then it is placed in an ice bath for 2 min after being taken out.

[0095] (3). It is transferred to a biosafety cabinet, 700 μl of liquid LB medium is added, and then it is cultured at 37℃ and 220 rpm for 60 min.

[0096] (4). 200 μl of the bacterial solution is uniformly coated on an LB plate containing ampicillin sodium.

[0097] (5). The plate is cultured in a 37℃ incubator for 15-17 h, and then uniform-sized colonies are grown.

[0098] (6). 5-6 single colonies are picked from the transformed LB plate and placed in a shake flask containing an antibiotic stock solution, and then it is cultured in a 37℃ constant-temperature shaker at 220 rpm for 7 h. After the culture, the shake flask is cooled to 16℃, IPTG is added to induce expression for a period of time, the bacterial solution is then divided into centrifuge bottles, centrifuged at 8000 rpm and 4℃ for 10 min, the bacterial body is collected, and the bacterial body weight is recorded. The sample is taken for electrophoresis detection.

[0099] (7). The collected bacteria were resuspended with the equilibration working solution (200 mM sodium chloride, 25 mM Tris, 20 mM imidazole, pH 8.0), and the bacterial solution was cooled to ≤ 15 °C, homogenized, and high-pressure homogenized twice. After completion, the bacterial solution was collected. The homogenized bacterial solution was divided into centrifuge bottles and centrifuged at 17,000 rpm and 4 °C for 30 min. The supernatant was collected, and the supernatant and precipitate were subjected to electrophoresis detection.

[0100] (8). C6A1 was purified and subjected to enzyme digestion, and the specific process was as follows: (1) crude purification: a. Water washing column material (Ni6FF, Cytiva), 5 CV. b. Equilibrium liquid (200 mM sodium chloride, 25 mM Tris, 20 mM imidazole, pH 8.0) was used to equilibrate the column material, 5 CV. c. Sample loading: the supernatant after centrifugation was added to the column material, and after the liquid flow was completed, the flow-through was taken for electrophoresis detection. d. Cleaning of impurities: 25 mL of impurity cleaning liquid (200 mM sodium chloride, 25 mM Tris, 20 mM imidazole) was added until the liquid flow was completed, and the flow-through was taken for electrophoresis detection. e. Collection of target protein: 20 mL of eluent (200 mM sodium chloride, 25 mM Tris, 250 mM imidazole, pH 8.0) was added, and the flow-through liquid was collected. The protein concentration was detected and the protein amount was calculated, and electrophoresis detection was performed. f. The column material was washed with 1 M imidazole working solution. g. The column material was washed with purified water. (2) Enzymatic digestion: the total amount of protein was 50:1 compared with the total amount of TEV enzyme, and the TEV enzyme was added. Enzymatic digestion was performed at 16 °C for 4 h, and the sample was subjected to electrophoresis detection. The protein solution after enzyme digestion was placed in a dialysis bag and dialyzed at 4 °C for 2 h. Then it was transferred to a new dialysis solution and dialyzed at 4 °C overnight. (3) Fine purification: a. Equilibrium column material (Ni6FF, Cytiva): A liquid (20 mM Tris, 20 mM sodium chloride, pH 8.0) was used to equilibrate the column material at a flow rate of 10 ml / min. b. Sample loading: the flow rate was 5 ml / min, the sample was loaded and the flow-through was collected, and electrophoresis detection was performed. c. Gradient elution: 0-15% B liquid (20 mM Tris, 1 M sodium chloride, pH 8.0) was set for 2 min, then maintained for 3 CV, 15-30% B liquid for 2 min, then maintained for 3 CV, 30-50% B liquid for 2 min, then maintained for 3 CV, 50-100% B liquid for 2 min, then maintained for 3 CV, and the peak was collected and subjected to electrophoresis detection (as fine purified protein). d. Cleaning of the column material. The protein was stored in a 4 °C environment.

[0101] Concentration detection: an appropriate amount of sample was taken, diluted 10-50 times with eluent, and thoroughly stirred with a glass rod. The absorbance was measured at 280 nm using a UV-visible spectrophotometer, and the protein concentration was calculated according to the formula C (mg / ml) = A280 x absorbance coefficient x dilution factor (note: the absorbance value should be between 0.1 and 1).

[0102] The electrophoretic detection process is as follows: 40 μl of sample liquid is taken, 10 μl of 5x protein loading buffer (250 mM Tris-HCl (pH: 6.8), 10% SDS, 0.5% bromophenol blue, 50% glycerol, 5% β-mercaptoethanol) is added, and it is placed in boiling water at 100°C for 10 min, then 10 μl per well is added to the SDS-PAGE protein gel, and after running at 80V for 2 h, protein staining is performed with Coomassie brilliant blue staining solution (0.1% Coomassie brilliant blue R-250, 25% isopropanol, 10% glacial acetic acid) for 20 min, and then decolorization is performed with protein decolorizing solution (10% acetic acid, 5% ethanol). The experimental results are shown in Figure 1 . According to Figure 1 It can be seen that a protein with a molecular weight of 29.6 kDa is separated, which is consistent with the predicted molecular weight of humanized type VI collagen C6A1 (29647.20), indicating that C6A1 is correctly expressed.

[0103] By the same method as the above method, the following recombinant collagens are constructed:

[0104] C6A2: Gppgekgeagdegnpgpdgapgerggpger (SEQ ID NO: 4)

[0105] C6A3: Gppgekgeagdegnpgpdgapgerggpger Gppgekgeagdegnpgpdgapgerggpger (SEQ ID NO: 5)

[0106] C6A4: Gppgekgeagdegnpgpdgapgerggpger Gppgekgeagdegnpgpdgapgerggpger

[0107] Gppgekgeagdegnpgpdgapgerggpger (SEQ ID NO: 6)

[0108] C6A5: Gppgekgeagdegnpgpdgapgerggpger Gppgekgeagdegnpgpdgapgerggpger Gppgekgeagdegnpgpdgapgerggpger Gppgekgeagdegnpgpdgapgerggpger Gppgekgeagdegnpgpdgapgerggpger Gppgekgeagdegnpgpdgapgerggpger Gppgekgeagdegnpgpdgapgerggpger Gppgekgeagdegnpgpdgapgerggpger Gppgekgeagdegnpgpdgapgerggpger Gppgekgeagdegnpgpdgapgerggpger (SEQ ID NO: 7). The actual molecular weight of C6A2-C6A5 was consistent with the expected molecular weight by separation and electrophoretic detection of C6A2-C6A5 by the above method, and it was proved that these recombinant collagens were correctly expressed.

[0109] Example 2: Detection of biological activity of recombinant humanized collagen

[0110] The method for detecting the adhesion activity of the recombinant humanized collagen can refer to the literature Juming Yao, Satoshi Yanagisawa, Tetsuo Asakura, Design, Expression and Characterization of Collagen-Like Proteins Based on the Cell Adhesive and Crosslinking Sequences Derived from Native Collagens, J Biochem. 136, 643-649 (2004). The specific implementation method is as follows:

[0111] (1) The concentration of the protein sample to be detected is detected by ultraviolet absorption method, including bovine collagen type I (China Food and Drug Inspection Research Institute, No. 380002) and the recombinant humanized collagen C6A1 provided by the application. Specifically, the ultraviolet light absorption of the sample at 215 nm and 225 nm is detected respectively, and the protein concentration is calculated by using the empirical formula C (μg / mL) = 144 x (A215-A225), and it is noted that the detection should be performed under the condition of A215<1.5. The principle of the method is that the characteristic absorption of the peptide bond under far ultraviolet light is determined, which is not affected by the content of chromophore, has few interfering substances, is simple to operate, and is suitable for detecting human collagen and its analogues which are not colored by coomassie brilliant blue. (Reference: Walker JM. The Protein Protocols Handbook, second edition. Humana Press. 43-45). After detecting the protein concentration, the concentration of all the protein samples to be detected is adjusted to 0.5 mg / mL by using PBS.

[0112] (2) 100 μL of various protein solutions (bovine collagen type I or recombinant humanized collagen C17T15) or D-PBS solution (blank control group) is added to a 96-well plate.

[0113] (3) 10 5 μL of well-cultured 3T3 cells is added to each well, and incubated at 37°C for 60 min.

[0114] (4) Each well is washed with PBS for 4 times.

[0115] (5) The absorbance at OD492nm is detected by using an LDH detection kit (Roche, 04744926001). According to the value of the blank control, the cell adhesion rate can be calculated. The calculation formula is as follows

[0116]

[0117] In the formula,

[0118] P: relative cell adhesion ratio;

[0119] OD1: the average absorbance at OD492nm of each duplicate well of the test collagen sample;

[0120] OD2: the average absorbance at OD492nm of each duplicate well of the control collagen sample;

[0121] OD0: the average absorbance at OD492nm of each duplicate well of the blank control group.

[0122] The adhesion rate of the cells can reflect the adhesion activity of each protein. The higher the activity of the protein, the better external environment can be provided for the cells in a short time, and the cells can be helped to adhere.

[0123] Figure 2 The experimental results show that, compared with bovine type I collagen (PC group, 0.5 mg / ml), the recombinant collagen C6A1 has more excellent biological adhesion activity. Similarly, it can be expected that C6A2-C6A5 also have biological adhesion activity.

[0124] The above examples are the preferred embodiments of the present application, but the embodiments of the present application are not limited to the above examples, and any changes, modifications, substitutions, combinations, simplifications made without departing from the spirit and principles of the present application should be equivalent replacement methods, and are all included in the protection scope of the present application.

Claims

1. Collagen, which consists of four repeating units of the amino acid sequence shown in SEQ ID NO: 1, with each repeating unit directly connected; or the amino acid sequence of collagen is SEQ ID NO:

2.

2. The collagen according to claim 1, wherein the collagen has a triple helix structure or is in the form of a triple helix structure.

3. Nucleic acid, which encodes collagen according to any one of claims 1-2.

4. The nucleic acid according to claim 3, wherein the nucleotide sequence of the nucleic acid is SEQ ID NO:

3.

5. A vector comprising the nucleic acid according to claim 3 or 4.

6. The vector according to claim 5, wherein the vector comprises a polynucleotide encoding a purification tag, a polynucleotide encoding a leader, and / or a regulatory element.

7. The vector according to claim 6, wherein the purification tag is selected from His tag, GST tag, MBP tag, SUMO tag or NusA tag; and the regulatory element is selected from promoter, terminator and / or enhancer.

8. A host cell comprising the nucleic acid according to claim 3 or 4 or the vector according to any one of claims 5-7.

9. The host cell according to claim 8, wherein the host cell is a eukaryotic cell or a prokaryotic cell.

10. The host cell according to claim 9, wherein the eukaryotic cell is a yeast cell, an animal cell, and / or an insect cell, and / or the prokaryotic cell is an Escherichia coli cell.

11. The host cell of claim 10, wherein the Escherichia coli is Escherichia coli BL21.

12. A method for producing collagen, comprising: (1) Culture the host cell according to any one of claims 8-11 under suitable culture conditions; (2) Harvesting host cells and / or culture medium containing collagen; and (3) Purify collagen.

13. The method according to claim 12, comprising (1) crudely purifying collagen on a Ni affinity chromatography column; (2) adding collagen-enzymatic digestion; and / or (3) purifying collagen using an ion exchange column.

14. A composition comprising collagen according to any one of claims 1-2, nucleic acid according to claim 3 or 4, a carrier according to any one of claims 5-7, and / or a host cell according to any one of claims 8-11.

15. The composition according to claim 14, wherein the composition is a pharmaceutical composition, a food composition, or a cosmetic composition.

16. The composition according to claim 14 or 15, wherein the composition is a human biomimetic material.

17. The composition according to claim 14 or 15, wherein the composition is one or more of the following: biological dressings, plastic and cosmetic materials, organoid culture materials, cardiovascular stent materials, coating materials, tissue injection filling materials, ophthalmic materials, obstetric and gynecological biomaterials, nerve repair and regeneration materials, liver tissue materials and vascular repair and regeneration materials, 3D printed artificial organ biomaterials, cosmetic raw materials, pharmaceutical excipients and food additives.

18. The composition of claim 15, wherein the composition comprises a pharmaceutically and / or cosmetically acceptable carrier.

19. The composition according to claim 14 or 15, wherein the composition is a solid, liquid, or gel composition.

20. The composition according to claim 14 or 15, wherein the composition is an oral and / or topical composition.

21. The composition according to claim 20, wherein it is a topical composition.

22. The composition according to claim 14 or 15, wherein the composition is a kit.

23. The composition according to claim 14 or 15, wherein the composition is a liquid formulation comprising the collagen and a pharmaceutically and / or cosmetically acceptable carrier.

24. The composition of claim 23, wherein the carrier is a buffer.

25. The composition of claim 24, wherein the buffer is a D-PBS buffer or a PBS buffer.

26. An in vitro method for promoting cell adhesion or cell fixation, the method comprising contacting cells with collagen according to any one of claims 1-2 and / or a composition according to any one of claims 14-25.

27. Use of the collagen according to any one of claims 1-2, the nucleic acid according to claim 3 or 4, the carrier according to any one of claims 5-7, the host cell according to any one of claims 8-11, and / or the composition according to any one of claims 14-25 in the preparation of human biomimetic materials.

28. Use of the collagen according to any one of claims 1-2, the nucleic acid according to claim 3 or 4, the carrier according to any one of claims 5-7, the host cell according to any one of claims 8-11, and / or the composition according to any one of claims 14-25 in the preparation of bio-dressings, coating materials, organoid culture materials, 3D printed artificial organ biomaterials, plastic and cosmetic materials, cardiovascular stent materials, tissue injection filling materials, ophthalmic materials, obstetric and gynecological biomaterials, nerve repair and regeneration materials, liver tissue materials, or vascular repair and regeneration materials.

29. Use of the collagen according to any one of claims 1-2 and / or the composition according to any one of claims 14-25 in the preparation of a kit for promoting cell adhesion or cell fixation.

Images