The Ceratobasidium fungal strain MYYFH20 that promotes the germination of Habenaria mengyuanensis seeds and its application
By isolating and identifying the fungal strain MYYFH20 of the genus Saccharomyces and establishing a symbiotic relationship with Mengyuan Yufenghua seeds, the problem of low germination rate of Mengyuan Yufenghua seeds was solved, and efficient seedling breeding was achieved, which has important significance in species protection and flower resource development.
Patent Information
- Application Number
- CN202411599708.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-11
- Publication Date
- 2025-06-13
- Estimated Expiration
- 2044-11-11
AI Technical Summary
The existing technology has failed to effectively promote the germination of Mengyuan Yufenghua seeds, resulting in a very small number of endangered plant populations and habitat conditions are susceptible to human activities.
MYYFH20, a fungal strain of the genus Saccharomyces, was isolated and identified. This strain can establish a symbiotic relationship with Mengyuan Yufenghua seeds. By co-culturing with the strain on a specially prepared germination medium, the germination of Mengyuan Yufenghua seeds is significantly promoted.
The MYYFH20 strain significantly increased the germination rate of Mengyuan Yufenghua seeds, could form protobulums and grow and develop into seedlings. The seedlings had strong anti-pathogenic ability, high survival rate in the wild, and had no tissue degeneration.
Smart Images

Figure SMS_1 
Figure SMS_2 
Figure SMS_3
Abstract
Description
Technical Field
[0001] This application relates to the field of microorganisms, and particularly to a Ceratobasidium fungal strain MYYFH20 that promotes the germination of Habenaria myriotricha seeds and its application. Background Art
[0002] The seeds of Orchidaceae plants are tiny, consisting of a seed coat and an undifferentiated proembryo. The seed coat is hard and hydrophobic, composed of a single layer of lignified cells; the embryo is poorly developed, consisting of only 80 - 300 cells, and hardly stores any nutrients. Under natural conditions, the germination of seeds requires specific symbiotic fungi to obtain nutrients. If effective symbiotic fungi for promoting the germination of Orchidaceae plant seeds can be obtained, they can be used for orchid seedling breeding, endangered species protection, and even industrialized cultivation. For example, in the Gastrodia elata cultivation industry, the seeds of Gastrodia elata and Mycena symbiotically germinate to form millet-like tubers, and the millet-like tubers then symbiotically develop with Armillaria mellea to form the tubers of Gastrodia elata; the seeds of Cremastra appendiculata (D. Don) Makino and Pseudocoprinus disseminatus can form medicinal pseudobulbs through field direct seeding and seedling raising in one year. Symbiotic fungi are extremely important germplasm resources for the seedling breeding of Orchidaceae plants.
[0003] The symbiotic germination operation process is relatively simple: on the basis of obtaining effective fungi for the germination of seeds of a certain specific Orchidaceae plant, the symbiotic fungi are inoculated while sowing the seeds in an artificial substrate or in the wild, and the symbiosis of the fungi is used to promote the germination of the seeds to form seedlings. The application of the symbiotic germination technology of Orchidaceae plant seeds has great popularization value in aspects such as the return of rare and endangered Orchidaceae plants, etc., can lay a seedling foundation for the return of Orchidaceae plants, and provide new ideas for industrial development.
[0004] Habenaria myriotricha is a terrestrial herbaceous plant that grows in grasslands at an altitude of 400 - 800 meters and is distributed in the lime mountain seasonal rainforest at an altitude of 1000 meters in Mengla County, China. It was first discovered in China in 2012. Its flower shape is unique and has extremely high ornamental value. However, its distribution area is narrow, the habitat conditions are easily affected by human activities, and the population quantity is extremely small (there are only 2 populations in China, with a total of no more than 40 individuals). It is urgent to carry out species protection and resource development and utilization of Habenaria myriotricha. There has been no report on using fungi to promote the breeding of seedlings from the seeds of Habenaria myriotricha. Summary of the Invention
[0005] To solve or partially solve the problems existing in the related technologies, this application provides a Ceratobasidium fungal strain (Ceratobasidium sp.) MYYFH20 that promotes the germination of Habenaria myriotricha seeds. The strain was isolated from the protocorms formed by the wild germination of Habenaria myriotricha seeds and can effectively promote the germination of Habenaria myriotricha seeds to form protocorms and grow and develop into seedlings.
[0006] The present application also provides a method for promoting the germination of Habenaria mengyuanensis seeds.
[0007] The Ceratobasidium sp. strain MYYFH20 for promoting the germination of Habenaria mengyuanensis seeds in the present application was deposited with the China General Microbiological Culture Collection Center on October 21, 2024, under the deposit number CGMCC No. 41580, and its taxonomic name is Ceratobasidium sp.
[0008] Furthermore, the Ceratobasidium sp. strain was isolated from the protocorms formed by the wild germination of Habenaria mengyuanensis seeds.
[0009] Furthermore, in the method for promoting the germination of Habenaria mengyuanensis seeds in the present application, a symbiotic relationship is established between the Ceratobasidium sp. strain and the Habenaria mengyuanensis seeds to promote the germination of the Habenaria mengyuanensis seeds.
[0010] Still further, the method for promoting the germination of Habenaria mengyuanensis seeds in the present application includes the following steps:
[0011] (1) Preparation of inoculation materials: Activate the Ceratobasidium sp. strain on a PDA culture dish. When the mycelium is nearly full of the culture dish, make a mycelium cake from the culture medium with mycelium under sterile conditions for later use;
[0012] (2) Preparation of germination medium: Prepare a germination medium (oat medium) for the germination of Habenaria mengyuanensis seeds;
[0013] (3) Sowing after seed disinfection and sterilization: Disinfect the Habenaria mengyuanensis seeds and then sow them into the germination medium;
[0014] (4) Inoculation: Place the mycelium cake around the Habenaria mengyuanensis seeds to be promoted to germinate that have been sown into the germination medium in step (2);
[0015] (5) Co-culture: Co-culture the Habenaria mengyuanensis seeds to be promoted to germinate with the Ceratobasidium sp. strain.
[0016] Furthermore, the sowing after seed disinfection and sterilization in step (3) is specifically as follows: Place the Habenaria mengyuanensis seeds on a clean bench and soak them in a sodium hypochlorite solution with an effective chlorine concentration of 1% for 5 minutes, then rinse the seeds 3 times with sterile water. Add the seeds to a sterile agar suspension of 1 g·L -1 Shake well to make a seed suspension, and use a pipette to suck up a quantitative seed suspension and evenly sprinkle it on the germination medium.
[0017] Furthermore, the co-culture conditions are as follows: First, culture in a completely dark tissue culture room for 30 days, and then adjust the light cycle to 12 / 12 h L / D light-dark alternation culture with a light intensity of 2000 lx; the culture temperature is 23 ± 1 °C.
[0018] The germination of Orchidaceae plant seeds can be achieved through two methods: asymbiotic germination culture and symbiotic germination culture. Although some Orchidaceae plant species can be germinated through asymbiotic germination culture with a relatively high germination rate, the seedlings obtained by this method grow slowly, have poor resistance to pathogenic microorganisms, and low survival rate when transplanted into the natural environment. At the same time, due to the difficulty in establishing a symbiotic relationship with fungi encountered later, the subsequent growth is severely hindered. The symbiotic germination culture technology refers to sowing orchid seeds and symbiotic fungi simultaneously in a specific substrate (culture medium). This method can improve the germination rate of seeds, the growth rate of seedlings, and the survival rate of seedlings after transplantation into the natural environment.
[0019] Since the symbiotic relationship between Orchidaceae plant seeds and fungi is specific, the symbiotic fungi of different Orchidaceae plant seeds are different. Determining the effective fungi that can form a symbiotic relationship with the seeds of Habenaria mengyuanensis and promote their germination is a key step in breeding the seedlings of Habenaria mengyuanensis. Obtaining symbiotic seedlings is the basis for carrying out the work of returning Habenaria mengyuanensis to its original habitat. The strains of the present invention are cultured on artificial substrates with the seeds of Habenaria mengyuanensis, different fungi, and a control respectively through symbiotic germination experiments. By statistically analyzing the seed germination rate, effective strains that can promote the germination of the seeds of Habenaria mengyuanensis are successfully obtained, thus opening up a new way for the efficient cultivation of seedlings by using the symbiotic germination of the seeds of Habenaria mengyuanensis and fungi. The acquisition of these strains has important practical significance for the species protection of the rare and endangered Habenaria mengyuanensis with important ornamental value and the development of flower resources.
[0020] The beneficial effects of the present application are as follows:
[0021] The Ceratobasidium fungi strains in the present application can significantly promote the germination of the seeds of Habenaria mengyuanensis, which has important practical significance for obtaining symbiotic germinated seedlings. It can be used for nursery seedling raising or field direct seeding. Compared with tissue culture, it has the advantages of simple operation, no need for acclimatization, and low cost. Moreover, the seedlings have strong resistance to pathogenic bacteria, high survival rate in the wild, and no tissue degradation, and have the application value of replacing tissue culture to obtain symbiotic seedlings. Specific Embodiments
[0022] The embodiments of the present application will be described in more detail below with reference to the examples. Although the embodiments show the embodiments of the present application, it should be understood that the present application can be implemented in various forms and should not be limited by the embodiments described herein. On the contrary, these embodiments are provided to make the present application more thorough and complete, and to fully convey the scope of the present application to those skilled in the art.
[0023] Example 1
[0024] Isolation of Ceratobasidium Fungal Strains
[0025] (1) In-situ Induction Experiment
[0026] Take out the cryopreserved seeds of Habenaria mengyuanica from -20°C 24 hours in advance. After the seeds are restored to room temperature, set them aside. Put 0.3 g of agar powder into 300 mL of pure water for sterilization to prepare a 0.1% agar suspension. Take a certain amount of seeds and put them into the 0.1% agar suspension, shake well to make the seeds completely suspended. Use a pipette to aspirate 100 μl of seeds onto a glass slide, cover with a coverslip, and count under a stereomicroscope. Repeat 10 times, take the average count, and estimate the number of seeds contained in 1 mL of the seed suspension. In this in-situ induction experiment, each milliliter of the seed suspension contains approximately 86 seeds.
[0027] In this study, the terrestrial orchid seed bag designed by Rasmussen and Whigham was improved. Cut the nylon cloth into strips of 6 cm × 3 cm, fold the strips in half, and heat-seal the two sides with an alcohol lamp. Use a pipette to aspirate 1 mL of the seed suspension and add it to the 3 cm × 3 cm seed bag made of nylon cloth, and heat-seal the edge of the nylon cloth seed bag with an alcohol lamp. After making marks, string 10 seed bags together with a needle and thread for easy burial.
[0028] The placement location of the seed bags was selected in the natural habitat of Habenaria mengyuanica in Mengla County. On June 7, 2023, the prepared seed bags were buried in the surface soil (soil thickness 3 - 5 cm) within 30 cm of the wild plants of Habenaria mengyuanica. Cover the seed bags with fallen leaves and other humus to shade them and keep the moisture of the seed bags. Lay a white plastic mesh cloth to prevent rain erosion. Finally, insert a 5 mL pipette tip nearby as a mark. A total of 90 seed bags were placed in this experiment. After 70 days, go to the research site to check the germination of the seed bags. When checking, clean the soil and attachments outside the seed bags, carefully cut along the seal with scissors. If seed germination is found, wrap it with a wet tissue and bring it back to the laboratory for subsequent fungal isolation experiments.
[0029] (2) Preparation for Mycelial Mass Preparation
[0030] Formula of Potato Dextrose Agar (PDA medium): 200 g / L of potato; 20 g / L of dextrose; 16 g / L of agar, with natural pH. Preparation method of PDA medium: Weigh 200 g of peeled potato, cut it into pieces about 1 cm in size, boil for 30 min, filter the potato residue with four layers of gauze. First add 20 g of dextrose to the filtered solution, then add 16 g of agar and heat, quickly stir and mix well with a glass rod until the agar dissolves. Let the solution stand and add pure water to make up the volume to 1 L. Dispense it into 3 conical flasks, cover with rubber stoppers, wrap the bottle mouths with newspaper again, sterilize in an autoclave at 121 °C and a pressure of 100 kPa for 20 min. In a laminar flow hood, pour it into a sterilized petri dish with a diameter of 9 cm, about 15 mL of medium in each dish, and set aside after cooling.
[0031] The method for preparing test tube slants is to suck the prepared PDA medium solution into a glass test tube with a syringe, and the medium accounts for about 1 / 3 of the test tube volume. Plug the test tube mouth tightly with a rubber stopper, tie 10 test tubes into a bundle with a rubber band, and then wrap the interface of the rubber stopper and the test tube with newspaper. Sterilize in an autoclave at 121 °C for 20 min, and then place the test tubes on the experimental tabletop to form slants for use.
[0032] (3) Preparation of mycelial pellets
[0033] For endophytic fungi in protocorms and rhizomes, the tissue block isolation method is used. In a laminar flow hood, disinfect the protocorms with 75% ethanol for 2 min, rinse with sterile water for 30 s, rinse twice, then disinfect with 1% NaClO solution for 5 min, and wash with sterile water 3 - 5 times. Take out the protocorms and place them in a sterile petri dish for standby. Cut the protocorms into small pieces with a sterile scalpel, and use an inoculation needle to pick up small pieces of tissue and make the cut surface stick to the surface of the PDA medium.
[0034] For the isolation of endophytic fungi in root tissues, the single mycelial pellet isolation method is used. Select tender roots about 3 cm long of Habenaria mengyuanensis, rinse with sterile water to remove attachments and impurities on the root segment surface, then place them in a laminar flow hood, cut them into root segments about 1 cm long with a sterile scalpel, gently scrape off the velamen with a scalpel again. After scraping the velamen, rinse the root segments with sterile water once, disinfect with 75% ethanol for 30 s, then rinse with sterile water again, disinfect with 1% NaClO solution for 2 min, and wash with sterile water 3 - 5 times. Repeatedly scrape the roots gently with a sterile scalpel to release the mycelial pellets into a petri dish containing sterile water. After standing in sterile water for 1 - 2 h, observe the release of mycelial pellets under a 10x objective lens of an optical microscope. When the mycelial pellets appear in the field of view of the eyepiece, use a 10 μl pipette to aspirate a single mycelial pellet onto the PDA medium and mark the inoculation position for easy observation.
[0035] (4) Cultivation of mycelial pellets
[0036] Write the label and separation date on the petri dish, seal it with sealing film, and place it in a mold incubator for cultivation (25±2°C, dark condition). Wait until hyphae grow from the mycelial mass, pick the tip of the hyphae and inoculate it onto a new PDA medium. After making a mark, seal it with sealing film and place it in the mold incubator for cultivation (conditions as above). After repeating this process 3 - 5 times, pure colonies can be obtained.
[0037] (5) Strain purification
[0038] Wait until hyphae grow at the cut end of the protocorm. In a laminar flow hood, use a sterile inoculation needle to pick the tip of the hyphae at the edge of the growing fungal colony and inoculate it onto a new PDA medium. Repeat the above steps to obtain pure colonies.
[0039] (6) Naming
[0040] Preserve the purified fungus in a test tube slant and name it MYYFH20.
[0041] Specifically, in a laminar flow hood, use a sterile inoculation needle to pick the edge hyphae of the purified fungus and inoculate it on a PDA slant. Plug it tightly with a rubber stopper and label the strain and date. Place the inoculated test tube in a mold incubator for cultivation at 25±2°C. After the hyphae cover the test tube slant, put some of the test tube slants into a 4°C refrigerator for preservation.
[0042] Biological preservation information:
[0043] The Ceratobasidium sp. fungal strain MYYFH20 involved in this application was preserved at the China General Microbiological Culture Collection Center on October 21, 2024. Address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. The preservation number is CGMCC No. 41580, and the taxonomic name is Ceratobasidium sp.
[0044] Identification of Ceratobasidium sp. fungal strain
[0045] Morphological identification:
[0046] Colony appearance and microscopic morphological characteristics: Use the cover glass insertion culture method and cultivate it in a mold incubator at 25±1°C for 7 to 14 days. Take the inserted glass slide and prepare the specimen according to the conventional specimen preparation method. Observe and measure the hyphae at different growth stages as needed.
[0047] The results show that: The colony of the strain in this application is white on the PDA plate after 7 days of cultivation, without concentric rings; the hyphae have a rough texture and are arranged closely; the hyphae diameter is 4.8 - 7.0 μm, with septa, the cell length is 48.8 - 111.3 μm, with branches, the branch angle is 60° - 90°, there is a septum not far from the branch, and there is a septum in the direction of the inner angle of the hyphae from the branch.
[0048] Molecular identification:
[0049] The primers used for PCR amplification were the fungal universal primers ITS1 and ITS4.
[0050] The amplification reaction was carried out on a PCR instrument Perkin Elmer with the following PCR cycle: pre-denaturation at 94 °C for 3 min, 1 cycle; denaturation at 94 °C for 1 min, annealing at 51 °C for 45 s, extension at 72 °C for 45 s, 35 cycles; finally, extension at 72 °C for 7 min. The PCR products were recovered using the AxyPrep DNA Gel Extraction Kit. The PCR products of the purified strains were taken and DNA sequencing was performed using the sequencer ABI3730-XL. The PCR amplification products were sent to Shanghai Personal Biotechnology Co., Ltd. for sequencing.
[0051] The obtained ITS fragment sequences of the symbiotic fungi effective for the germination of Nervilia mengyuanensis seeds were subjected to BLAST alignment analysis in the National Center for Biotechnology Information database (NCBI, http: / / www.ncbi.nlm.nih.gov / ). Its similarity with the strain CMML21-42 (GenBank number: OR857248.1) isolated from South Korea was 100.00%.
[0052] Based on colony, microscopic morphological characteristics and molecular biological means, the fungi involved in the present invention were identified as fungi of the genus Ceratobasidium.
[0053] The ITS sequence of Ceratobasidium is as follows (SEQ ID NO.1):
[0054] GAGATCAGATCATAAATTAATTGTCTAACTTAATAGACTGTTAGAAGCGGTTCATCTGCA
[0055] TTTCCTGGCCACTTTTTACAGTGTCCTCAGCGAGTGATACTTATCACGCCGAGTGGAACC
[0056] AAGCATATACTGAGATCCAGCTAATAAATTTAAGAGGAGCAGACGTGAAATCTGCAAAAA
[0057] CCTCCAAGTCCAAAGCAAACCAGTTGAATTAACAAAAAATTTACTTTGAGAATTTCATGA
[0058] TACTCAAACAGGCATGCTCCAAGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGA
[0059] TGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGAT
[0060] GCGAGAGCCAAGAGATCCGTTGTTGAAACTTAGTTCTAATGATGCGTTACATCAATTACA
[0061] TTCAATTTAATTAAATGAGTTTGTGTAATTAAGTAGACGGAAAACTAATTAAAGTCCTCC
[0062] GTCTCACAAGTGCACAGGTGTGTGTGGATGAAAGAGAAGGCGTGCACATGCCCCCGAAAG
[0063] GGCCAGCGACAACCAACTCTACATTCATTCAATAATGATCCTTC
[0064] Example 2
[0065] Detection of the effectiveness of Serendipita strains in the symbiotic germination of Habenaria mengyuanensis seeds
[0066] (1) Preparation of inoculation materials: Activate the Piriformospora indica (YDLXB) preserved in the laboratory, the PJXL strain from the protocorms of Anoectochilus roxburghii, M1, M3, and M5 from the rhizomes of Habenaria mengyuanensis, M20 and M42 from the protocorms, and MR3, MR6, and MR7 strains from the root tissues on PDA culture dishes with a diameter of 9 cm. When the mycelium is nearly full of the culture dish, make the culture medium with mycelium into a 1-cm-diameter fungal cake for standby under sterile conditions; at the same time, make a 1-cm-diameter agar cake from the blank PDA medium for standby;
[0067] (2) Prepare several dishes of oat medium and MS medium for sterilization according to the experimental design requirements for standby.
[0068] (3) Sowing of seeds after disinfection and sterilization: Place a small amount of Habenaria mengyuanensis seeds on the ultra-clean workbench and soak them in a sodium hypochlorite solution with an effective chlorine concentration of 1% for 5 min, then rinse the seeds 3 times with sterile water. Add the seeds to a sterile agar suspension of 1 g·L -1 and shake well to make a seed suspension. Use a pipette to suck a quantitative seed suspension and evenly spread it in each culture dish. The role of sodium hypochlorite here is to sterilize and disinfect the seeds and at the same time soften the seed coat.
[0069] (4) Inoculation: A total of 11 groups, including 10 different strain discs and sterile PDA agar discs (negative control), were inoculated into the oat medium; the same amount of seeds was sown on the positive control MS medium (positive control); there were a total of 288 petri dishes;
[0070] (5) Set the light culture conditions: First, place the petri dishes in a tissue culture room with complete darkness (0 / 24h L / D) for 30 days, and then adjust the light cycle to 12 / 12h L / D light-dark alternation for culture, with a light intensity of 2000 lx; the culture temperature is 23 ± 1 °C;
[0071] (6) Detection and data statistical analysis: Observe and record the seed germination and development conditions every week after sowing. After 30, 60, and 90 days of sowing, 6 petri dishes from each strain treatment group were observed and counted under a stereomicroscope.
[0072] The different germination stages of Orchidaceae plant seeds are shown in Table 1. It is divided into 5 stages: Stage 0 is described as the embryo being transparent, the seed coat being intact, and the seed not germinated; Stage 1 is described as the embryo absorbing water and swelling, but the seed coat still exists, regarded as germination; Stage 2 is described as the embryo continuing to expand, breaking through the seed coat, and forming a protocorm; Stage 3 is described as the appearance of the primary meristem and the formation of the first protrusion, that is, the cotyledon formation stage; Stage 4 is described as the emergence of the first leaf, that is, the initial stage of seedling development; Stage 5 is described as the emergence of the second leaf, that is, the formation of a seedling.
[0073] Record the number of seeds in each germination stage of different fungal treatment groups at different time periods. Conduct statistical analysis on the data of different time periods. Calculate indicators such as seed germination rate, cotyledon formation rate, and seedling formation rate. Calculate the germination proportion of seeds at different stages. Use SPSS 27.0 software to perform one-way ANOVA and independent-samples t-test on the experimental data. For data that conform to normal distribution and homogeneity of variance, multiple comparisons are performed using the least significant difference method (LSD). For data that do not conform to homogeneity of variance, Tamhane T2 is used for multiple comparisons; for data that do not conform to normal distribution, the Mann-Whitney U test in non-parametric tests is used. Use Origin 2023 to draw charts (N0: the number of seeds that have not absorbed water and swelled; N1: the number of seeds germinated to the first stage, and so on for N2 - N5). Protocorm formation rate (seed germination rate) = (N2 + N3 + N4 + N5) / total number of seeds; cotyledon formation rate = (N3 + N4 + N5) / total number of seeds; seedling formation rate = (N4 + N5) / total number of seeds.
[0074] Table 1 Description of different germination stages of Habenaria mengyuanensis seeds
[0075]
[0076]
[0077] (7) Detection of seed germination and statistical analysis of data
[0078] Thirty days after the symbiotic germination experiment, most of the seeds in each treatment group were in the stage of imbibition and swelling. The positive control group (MS), M3, M20, M42, and MR3 treatment groups could promote the seeds to germinate and break through the seed coat to form protocorms. The seed germination rate of the M20 strain derived from the protocorm was significantly higher than that of other treatments, reaching 8.07 ± 2.31%, and only the seeds in the M20 treatment group could grow to the cotyledon stage within 30 days, with a cotyledon formation rate of 0.74 ± 0.4% (p < 0.0001).
[0079] Table 2 Effects of different fungal treatments on the seed germination of Habenaria mengyuanensis (statistics at 30 days)
[0080]
[0081] Note: The data in the table are mean ± standard error. Different lowercase letters in the same column represent that their corresponding means are significantly different at the p < 0.05 level. The same below.
[0082] Sixty days after the symbiotic culture of seeds and fungi, except for MR3, MR6, MR7, and PJXL which could not promote further seed germination, the remaining strains could promote the seeds to germinate and form protocorms within 60 days. Among them, the germination rates of the M20 and M42 strains were significantly higher than those of other treatments. The 60-day germination rate of the M20 treatment group reached 16.14 ± 3.82%, and the 60-day germination rate of the M42 treatment group was 10.43 ± 5.29%. The 60-day cotyledon formation rates of the M20 and M42 treatment groups reached 9.1 ± 3.96% and 7.89 ± 5.13%, respectively, which were significantly higher than those of the positive control treatment group (MS). Only the M20 and M42 treatment groups could promote the seeds of Habenaria mengyuanensis to germinate and form seedlings within 60 days of symbiotic culture, and the seedling formation rates were 4.59 ± 2.85% and 2.56 ± 2.35%, respectively.
[0083] Table 3 Effects of different fungi on the seed germination of Habenaria mengyuanensis (statistics at 60 days)
[0084]
[0085] After 90 days of symbiotic culture of the seeds with fungi, the seeds in most treatment groups were still in the state of imbibition and swelling. The MR3, MR6, MR7, and PJXL treatment groups could not promote the seeds to germinate to the protocorm stage. The 90-day seed germination rate of the M20 treatment group was the highest, reaching 18.14±5.79%, which was significantly higher than that of other treatment groups; the germination rate of the M42 treatment group was also relatively high, at 12.52±5.06%; the 90-day seed germination rate of the MS treatment group was 9.41±3.16%. Among the M1, M3, and M5 fungal treatment groups isolated from rhizomes, the 90-day seed germination rate of the M1 treatment group was 5.9±3.34%, which was significantly higher than that of the M3 and M5 treatment groups; although YDLXB could promote seed germination, the germination rate was relatively low, only 1.06±0.32%. The M20, M42, and MS treatment groups could promote the seeds to germinate to the cotyledon stage within 90 days. The cotyledon formation rates of the M20 and M42 treatment groups were 10.33±4.8% and 7.11±3.61% respectively, which were significantly higher than that of the MS treatment group. Only the M20 and M42 treatment groups could promote the rapid growth and development of the seeds of Habenaria mengyuanensis to form seedlings within 90 days, and the seedling formation rates were 7.21±4.03% and 5.87±3.13% respectively.
[0086] Table 4 Effects of different fungi on the germination of seeds of Habenaria mengyuanensis (statistics at 90 days)
[0087]
[0088] The above experiments confirmed that the M20 strain could extremely significantly improve the seed germination rate of Habenaria mengyuanensis in the initial stage of symbiotic culture, which was equivalent to shortening the seed germination time. More importantly, M20 promoted the formation of seedlings from the seeds of Habenaria mengyuanensis earliest, and the formation ratio was significantly higher than that of other fungal treatments, negative control, and positive control. In the later stage of symbiotic culture, that is, the seedling formation period, although inoculating symbiotic fungi isolated from different sources could also promote the germination of Habenaria mengyuanensis to a certain extent, the M20 strain isolated from the protocorm of Habenaria mengyuanensis itself had the best germination-promoting effect. The seeds of Habenaria mengyuanensis and the strains of the present invention showed strong specificity, and the M20 strain and the seeds of Habenaria mengyuanensis could be used for symbiotic germination to produce seedlings.
[0089] It should be noted that the M20 strain in this example is the Ceratobasidium fungal strain MYYFH20 mentioned in Example 1, which can be fully understood by those skilled in the art.
[0090] The embodiments of the present application have been described above. The above description is exemplary, not exhaustive, and is not limited to the disclosed embodiments. Many modifications and variations are obvious to those of ordinary skill in the art without departing from the scope and spirit of the described embodiments. The choice of terms used herein is intended to best explain the principles of the embodiments, practical applications, or improvements to technologies in the market, or to enable other ordinary skill in the art to understand the embodiments disclosed herein.
Claims
1. A fungal strain of the genus Ceratonia that promotes the germination of seeds of Mengyuan Jade Phoenix ( Ceratobasidium sp. )MYYFH20, characterized in that, The strain MYYFH20 was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on October 21, 2024, with the deposit number CGMCC No. 41580 and the classification name of Ceratitis.
2. A method for promoting the germination of Mengyuan Yufenghua seeds, characterized in that: A symbiotic relationship is established between the Angiospermum fungus strain described in claim 1 and the Mengyuan Jade Phoenix Flower seeds to promote the germination of the Mengyuan Jade Phoenix Flower seeds.
3. The method for promoting the germination of seeds of Mengyuan Yufenghua according to claim 2, characterized in that: The following steps are involved: (1) Preparation of inoculation materials: Activate the Ceratium fungus strain on a PDA culture dish. When the mycelium is close to filling the culture dish, make a cake of the culture medium with mycelium under sterile conditions for later use; (2) Preparation of germination medium: preparing germination medium for germination of Mengyuan Yufenghua seeds; (3) Seed disinfection and sterilization before sowing: Disinfect the seeds of Mengyuan Yufenghua and sow them into the germination medium; (4) Inoculation: placing the bacterial cake around the seeds of the magnolia lily to be promoted for germination that have been sown in the germination medium in step (2); (5) Co-cultivation: Co-cultivating the seeds of the Mengyuan Yufenghua to be promoted to germinate with the fungal strain of the genus Ceratium.
4. The method for promoting germination of seeds of Mengyuan Yufenghua according to claim 3, characterized in that: The specific steps of sowing after disinfection and sterilization of seeds in step (3) are as follows: soak the seeds of Mengyuan Yufenghua in a sodium hypochlorite solution containing 1% effective chloride ion concentration on a clean bench for 5 minutes, rinse the seeds with sterile water for 3 times, and add 1g·L -1 Shake well in the sterile agar suspension to make a seed suspension, use a pipette to absorb a certain amount of the seed suspension and evenly spread it in the germination medium.
5. The method for promoting germination of seeds of Mengyuan Yufenghua according to claim 3, characterized in that: The co-culture conditions are as follows: after culturing in a completely dark tissue culture room for 30 days, the light cycle is adjusted to 12 / 12h L / D light-dark alternating culture, the light intensity is 2000 lx, and the culture temperature is 23±1°C.
6. Use of the Ceratium fungus strain according to claim 1 or the method according to any one of claims 2 to 5 in promoting the germination of Mengyuan Yufenghua seeds.
Citation Information
Patent Citations
Method for promoting growth of orchidaceae through Ceratobasidium sp.
CN108719336A
Crossobasidium fungus strain for promoting growth of gymnadenia conopsea as well as method and application thereof
CN114456951A