Construction method of methylotrophic escherichia coli

Abstract

The invention discloses a construction method of methylotrophic escherichia coli, and belongs to the technical field of bioengineering. The recombinant escherichia coli is obtained by knocking out glutathione dehydrogenase FRMA in a dissimilatory pathway of formaldehyde and overexpressing genes related to a methanol assimilation pathway in cells. According to the application, the CRISPR-Cas9 technology is adopted to knock out the FRMA gene and realize the overexpression of the pathway gene in cells. After the strain is subjected to fermentation culture in a 100mL shake flask, the OD600 reaches 5. As an excellent strain of artificial methylotrophic escherichia coli, the strain has a good application prospect in the fields of chemical industry, degradable materials and food.

Description

Technical Field

[0001] The invention relates to a method for constructing methylotrophic Escherichia coli and belongs to the field of biotechnology. Background Art

[0002] Methanol is an important chemical raw material. It is a colorless liquid with a slight alcohol smell. It has the characteristics of high combustion efficiency and low pollution emissions. Methanol is widely used in many fields such as energy, chemical industry and pharmaceutical industry. It is often used as a fuel additive, chemical synthesis and pharmaceutical process. With the development of biotechnology, the technology of using microorganisms to synthesize methanol and its derivatives has gradually become a research hotspot. However, traditional microorganisms usually use carbon sources such as glucose as their main nutrients and cannot directly use methanol as the only carbon source, which greatly limits their application potential in the methanol conversion process.

[0003] Escherichia coli is a model organism widely used in the field of bioengineering. It is widely used to produce a variety of biological products due to its advantages such as rapid growth, efficient expression of foreign genes, and convenient genetic manipulation. However, wild-type Escherichia coli cannot use methanol as the only carbon source and energy source, which limits its application in methanol bioconversion. Therefore, constructing an Escherichia coli strain that can use methanol as a nutrient source through genetic engineering has become one of the important research directions in the current field of bioengineering.

[0004] In order to realize the ability of Escherichia coli to utilize methanol, it is usually necessary to carry out large-scale modification of its metabolic pathways, including the introduction of methanol metabolism genes, optimization of the expression level of methanol conversion enzymes, and adjustment of global regulatory mechanisms related to methanol metabolism. However, this process faces multiple challenges, such as low expression efficiency of exogenous genes, uncoordinated metabolic flux, and inhibition of strain growth. Therefore, the development of an efficient and stable method for constructing artificial methanol-trophic Escherichia coli can effectively overcome the above technical bottlenecks and has broad application prospects in industrial production. Summary of the invention

[0005] In view of the deficiencies of the above-mentioned prior art, the present invention provides a method for constructing an artificial methanol-trophic Escherichia coli. Wild-type Escherichia coli MG1655 is used as a starting strain, and an engineered strain E. coli MG AC using methanol as the sole carbon source is obtained through a series of metabolic engineering modifications. The strain has a first reaction module for converting methanol into formaldehyde, a second reaction module for converting formaldehyde into fructose 6-phosphate, and a third reaction module for converting fructose 6-phosphate into a central metabolite. The purpose is to solve the technical problems of low expression efficiency of exogenous genes, uncoordinated metabolic flux, and inhibition of strain growth in the process of transforming Escherichia coli to utilize methanol.

[0006] The first technical solution provided by the present invention is an artificial methylotrophic genetically engineered bacterium with a methanol assimilation pathway. The genetically engineered bacterium uses Escherichia coli as a chassis strain, knocks out glutathione dehydrogenase of the chassis strain, and overexpresses related enzymes in the methanol assimilation pathway in the chassis strain, and the related enzymes in the methanol assimilation pathway include methanol dehydrogenase, methanol oxidase, phosphate hexose isomerase and phosphate hexose synthase. The above strain has a functional methanol assimilation pathway and can grow with methanol as the sole carbon source.

[0007] In one embodiment, the chassis strain is Escherichia coli MG1655.

[0008] In one embodiment, the source of methanol dehydrogenase includes Pseudomonas, Methylobacillus, Hansenula, Pichia pastoris, Cupribotium necrotum, etc., preferably Cupribotium necrotum.

[0009] Methanol dehydrogenase (EC 1.1.1.244) is encoded by the MDH gene. The nucleotide sequence of the CnMDH gene from Cupriavidus necrotizingus is shown in SEQ ID NO.1.

[0010] In one embodiment, the source of methanol oxidase includes Pichia pastoris, Acetobacter, Candida boidinii, Pseudomonas, Saccharomyces cerevisiae, etc., preferably Saccharomyces cerevisiae.

[0011] Methanol oxidase (EC 1.1.3.13) is encoded by the AOX gene. The nucleotide sequence of the ScAOX gene from Saccharomyces cerevisiae is shown in SEQ ID NO.2.

[0012] In one embodiment, the source of hexose phosphate isomerase includes Methanococcus jannaschii, Thermoarchaea, Cupriavidus necrotus, Methylobacillus, etc., preferably, it is derived from Methylobacillus.

[0013] Hexose phosphate isomerase (EC 5.3.1.9) is encoded by the PHI gene. The nucleotide sequence of the BmPHI gene from Bacillus methylogenes is shown in SEQ ID NO.3.

[0014] In one embodiment, the source of hexose phosphate synthase includes methanotrophic bacteria, Mycobacterium tuberculosis, Cupribotium necrotizingum, Bacillus subtilis, etc., preferably Bacillus subtilis.

[0015] Hexose phosphate synthase (EC 5.3.1.9) is encoded by the HPS gene. The nucleotide sequence of the BsHPS gene from Bacillus subtilis is shown in SEQ ID NO.4.

[0016] The second technical solution provided by the present invention is a method for constructing a genetically engineered bacterium, wherein the method uses Escherichia coli as a starting strain, knocks out glutathione dehydrogenase, and then overexpresses methanol dehydrogenase, methanol oxidase, hexose phosphate isomerase, and hexose phosphate synthase.

[0017] In one embodiment, methanol dehydrogenase (EC 1.1.1.244) is encoded by MDH gene. Methanol dehydrogenase sources include Pseudomonas, Methylobacillus, Hansenula, Pichia, Cupriavidus necator, etc., preferably CnMDH from Cupriavidus necator, the nucleotide sequence of CnMDH is shown in SEQ ID NO.1.

[0018] In one embodiment, methanol oxidase (EC 1.1.3.13) is encoded by AOX gene. Methanol oxidase sources include Pichia pastoris, Acetobacter, Candida boidinii, Pseudomonas, Saccharomyces cerevisiae, etc., preferably ScAOX from Saccharomyces cerevisiae, the nucleotide sequence of ScAOX is shown in SEQ ID NO.2.

[0019] In one embodiment, the hexose phosphate isomerase (EC 5.3.1.9) is encoded by the PHI gene. The sources of the hexose phosphate isomerase include Methanococcus jannaschii, Thermoarchaea, Cupriavidus necrotus, Methylobacillus, etc., preferably BmPHI derived from Methylobacillus, and the nucleotide sequence of BmPHI is shown in SEQ ID NO.3.

[0020] In one embodiment, the hexose phosphate synthase (EC 5.3.1.9) is encoded by the HPS gene. The sources of the hexose phosphate synthase include methanotrophic bacteria, Mycobacterium tuberculosis, Cupriavidus necrotus, Bacillus subtilis, etc., preferably BsHPS derived from Bacillus subtilis, and the nucleotide sequence of BsHPS is shown in SEQ ID NO.4.

[0021] In one embodiment, the gene encoding methanol oxidase is integrated and expressed at the ilvG locus.

[0022] In one embodiment, the MDH gene, PHI gene, and HPS gene are integrated and expressed at the rph site.

[0023] In one embodiment, the nucleotide sequence of the gene ilvG is shown as Gene ID: 2847699; the nucleotide sequence of the gene rph is shown as Gene ID: 948156.

[0024] The third technical solution provided by the present invention is a method for culturing genetically engineered bacteria, wherein the method comprises culturing and fermenting the genetically engineered bacteria described in the first technical solution using methanol as a carbon source and ammonium chloride as a nitrogen source.

[0025] In one embodiment, the initial amount of methanol added is 500 mmol / L, and methanol is added in batches during the fermentation process until the total amount added is 3 mol / L.

[0026] In one embodiment, the method comprises the following steps: (1) culturing the genetically engineered bacteria described in the first technical solution in LB medium for at least 12 hours;

[0027] (2) Transfer the overnight culture solution back into fresh LB for secondary activation;

[0028] (3) The secondary activated strain was washed three times with sterile water, then transferred to M9 medium containing methanol and cultured in a shake flask;

[0029] (4) The bacterial solution from step (3) was inoculated into M9 medium containing methanol and vitamin B1, and cultured at 37°C for at least 24 h; 500 mmol / L methanol was added every 4 h.

[0030] The fourth technical solution provided by the present invention is the use of the genetically engineered bacteria described in the first technical solution, the method described in the second technical solution, or the method described in the third technical solution in the production of high-value chemicals, wherein the production uses methanol as a carbon source to biosynthesize high-value chemicals.

[0031] In one embodiment, the high-value chemicals include succinic acid, malic acid, alpha-ketoglutaric acid.

[0032] The technical effects of the present invention are as follows:

[0033] The present invention constructs an artificial methylotrophic Escherichia coli genetic engineering bacterium, and successfully achieves cell growth of microorganisms using methanol as the sole carbon source by introducing the methanol assimilation pathway into Escherichia coli. In addition, through expression optimization and shake flask verification, OD 600 The growth rate is 5. The strain constructed by the present invention provides a new idea for the industrial application of methanol, and has important practical significance and application value for industrial methylotrophic microorganisms. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 For chassis screening, W3110 (pCDR-MDH-HPS-PHI), ATTC8739 (pCDR-MDH-HPS-PHI), and MG1655 (pCDR-MDH-HPS-PHI) were cultured in shake flasks to verify the cell growth results.

[0035] Figure 2 Schematic diagram of the FRMA knockout box.

[0036] Figure 3Schematic diagram of the MDH-HPS-PHI integration framework.

[0037] Figure 4 This is a schematic diagram of the AOX integration box.

[0038] Figure 5 This is the result of shaking flask culture of the genetically engineered recombinant strain E. coli MGAC in Example 3 of the present invention. DETAILED DESCRIPTION

[0039] The preferred embodiments of the present invention are described below. It should be understood that the embodiments are for better explaining the present invention and are not used to limit the present invention.

[0040] Test method:

[0041] Methanol content detection: After centrifugation at 15000 rpm for 3 minutes, an aliquot of the culture supernatant was taken to prepare the sample, and then filtered with a 0.22 filter. The methanol concentration was determined by an Agilent Technologies 7890 gas chromatograph with a flame ionization detector. A constant pressure of 19.082 psi nitrogen flow was passed through a DB-624UI column (Agilent Technologies, 0.32 mm 330 m 30.25 mm), and the thermal cycle included the following stages: an initial 45 °C for 1 minute, a temperature increase of 20 °C / min to 150 °C, and then a temperature increase of 45 °C / min to 240 °C, and finally a hold of 1 minute.

[0042] Formaldehyde content was detected by acetylacetone colorimetric method. Acetylacetone preparation: weigh 50g ammonium acetate, 6mL acetic acid, 0.5mL acetylacetone, mix well, and dilute to 100mL. Determination: When measuring, take 20μL sample and mix with 200μL acetylacetone detection solution, treat at 60℃ for 5-10min, and take 200μL to the microplate reader to measure the absorbance at 414nm.

[0043] The spot plate experiment was used to characterize the growth of the strains. The experimental and control strains were cultured overnight in LB medium, and the overnight cultured strains were transferred to fresh medium for secondary activation for 4-5 hours; the activated strains were washed three times with sterile water; the washed bacterial solution was diluted once to 10 0 , 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 The diluted bacterial solution was spotted on LB, M9+4% Glu, M9+1% MeOH, M9+2% MeOH, and M9+3% MeOH solid plates in turn and cultured at 37°C for 24 hours.

[0044] Analysis method: The concentration of by-products was determined using an HPLC system (Dionex UltiMate 3000 Series, Thermo Scientific, USA). The system was equipped with an Aminex HPX-87H ion exchange column (7.8×300 mm, Bio-Rad Laboratories, USA), a column temperature of 52°C, a flow rate of 0.6 mL / min, a mobile phase of 5 mmol / L sulfuric acid solution, and an injection volume of 10 μL. The concentration of by-products in the sample was calculated using a pyruvic acid concentration standard curve.

[0045] The raw materials used in the embodiment:

[0046] 1. Luria-Bertani (LB) medium: tryptone 10g / L (Oxoid), yeast extract 5g / L (Oxoid), NaCl 10g / L (China Pharmaceutical Group). LB medium is used for strain activation. When the cells contain recombinant plasmids, the final concentrations of the corresponding antibiotics added to the medium are: ampicillin (Shanghai Biotech) 100mg / L, spectinomycin (Shanghai Biotech) 33mg / L, chloramphenicol (Shanghai Biotech) 30mg / L.

[0047] 2. M9 inorganic salt medium: 3.0g / L KH2PO4 (China Pharmaceutical Group), 6.78g / L Na2HPO4 (China Pharmaceutical Group), 0.5g / L NaCl (China Pharmaceutical Group), 1.0g / L NH4Cl (China Pharmaceutical Group), 241mg / L MgSO4·2H2O (China Pharmaceutical Group), 11mg / L CaCl2·2H2O (China Pharmaceutical Group) and 0.5mg / L vitamin B1 (Shanghai Bioengineering); 1mL of metal ion liquid needs to be added to each liter of M9 inorganic salt culture medium; the components of the metal ion liquid are: FeCl3 (China Pharmaceutical Group) 1.6g / L, CoCl2.6H2O (China Pharmaceutical Group) 0.2g / L, CuCl2 (China Pharmaceutical Group) 0.1g / L, ZnCl2.4H2O (China Pharmaceutical Group) 0.2g / L, NaMnO4 (China Pharmaceutical Group) 0.2g / L, H3BO3 (China Pharmaceutical Group) 0.05g / L, and 0.1M hydrochloric acid (China Pharmaceutical Group) as solvent.

[0048] 3. Plasmid pCDR, E. coli W3110, E. coli ATTC8739, and E. coli MG1655 are all commercial plasmids and strains, derived from laboratory preserved strains.

[0049] 4. pCas9 plasmid and pTargetF plasmid have been published in Reprogramming protein stability in Escherichia coli to improve four-carbon dicarboxylic acids production (10.1016 / j.cej.2024.152893).

[0050] Example 1: Screening of chassis hosts

[0051] Construction of pCDR-MDH-HPS-PHI vector: Primers were designed based on the codon-optimized CnMDH nucleotide sequence (SEQ ID NO.1), BmPHI nucleotide sequence (SEQ ID NO.3), BsHPS nucleotide sequence (SEQ ID NO.4), and plasmid pCDR nucleotide sequence:

[0052] CnMDH-F: ATGACACACCTAAACATAGCT

[0053] CnMDH-R:CATAGCGGCTGCGAAAATTGC

[0054] BmPHI-F: ATGGGATCCATGAAAACCAC

[0055] BmPHI-R:AAGCTTTTCCAGGTTCGCGT

[0056] BsHPS-F:ATGGAGTTACAGTTGGCTTTG

[0057] BsHPS-R:ACCCTGCACGATCAACTGCT

[0058] pCDR-F: GCGGTTCTTTTACCAGACTCGAGTTA

[0059] pCDR-R: GGATCCGTGATGGTGATGGTGATGCGATCCTCTCATAGTTAATTTC

[0060] Based on the above primers, CnMDH, BmPHI, BsHPS and plasmid pCDR were connected by homologous recombination to construct pCDR-MDH-HPS-PHI.

[0061] Screening process: First, the expression vector (pCDR-MDH-HPS-PHI) containing the key enzyme gene of the ribulose monophosphate cycle pathway was transformed into the candidate strains (WT W3110, WT ATTC8739, WT MG1655) selected in the initial screening, and the successfully transformed recombinant strains were screened in the selective medium through the antibiotic selection marker, and the correct integration and expression of the gene were verified by PCR or sequencing. The successfully transformed bacteria were first inoculated in LB medium for overnight culture activation, and then transferred to LB for culture for 4-5 hours to the logarithmic phase. Collect the bacteria and use sterile water to wash the residual LB in the bacteria, 12000rpm, 3min, wash three times, then dissolve the bacteria with sterile water, measure OD600, and calculate the inoculation size; Culture: select the initial OD600 = 0.01, inoculate the bacterial solution into M9 medium containing 500mmol / L methanol, for strains containing plasmids, additional IPTG and corresponding resistance need to be added to the culture medium, shake culture at 37℃, and measure OD600 values ​​every 8h to draw a growth curve to evaluate its methanol assimilation ability.

[0062] like Figure 1 As shown, the growth of three wild-type Escherichia coli containing pCDR-MDH-HPS-PHI plasmids on methanol inorganic salt medium. Finally, the strain Escherichia coli MG1655 that can grow stably and efficiently utilize methanol was screened out through the growth curve data as the final chassis host of artificial methylotrophic Escherichia coli.

[0063] Example 2: Construction of artificial methylotrophic strains with reduced methanol dissimilatory capacity

[0064] This embodiment uses the CRISPR-Cas9 method to knock out the FRMA gene to block methanol dissimilation. The specific implementation method is as follows: Design primers based on the upstream and downstream sequences of the Escherichia coli FRMA gene region. According to the Escherichia coli MG1655 genome sequence published on NCBI, find the FRMA locus region and its corresponding nucleotide sequence (GenBank: CP047127.1), and select the cutting site N20-FRMA (AGCACTTCACCTTTTTTCGG) in the region. Design the reverse amplification primers for the pCAS9 full plasmid PCR to obtain the pCAS9-FRMA knockout plasmid (such as Figure 2 The primers were designed as follows:

[0065] sgRNA-FRMA-F:

[0066] GTCCTAGGTATAATACTAGTAGCACTTCACCTTTTTTCGGGTTTTAGAGCTAGAAATA G;

[0067] sgRNA-FRMA-R:

[0068] GATCCTTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT;

[0069] The upstream homology arm and downstream homology arm of FRMA were amplified by PCR, and the primers were designed as follows:

[0070] FRMA-UF:

[0071] CCGATGATGATCACCGACTGAC;

[0072] FRMA-UR:

[0073] TTTTGCCAGAACGACAGAACCGAACCAGTTCAATAGTGTCG;

[0074] FRMA-DF:

[0075] TTTTGCCAGAACGACAGAACCGAACCAGTTCAATAGTGTCG;

[0076] FRMA-DR:

[0077] AGAGCATCAATCTGCCCCCG;

[0078] The upstream and downstream homologous arms were connected into a gene fragment, namely Donor DNA1, by one-step homologous recombination technology, and amplified by PCR. Then, pCAS9-FRMA and this fragment were co-transformed into wild-type Escherichia coli E. coli MG1655, and the gene was knocked out by CRISPR-Cas9 technology. The engineered bacteria E. coli MG1655 (ΔFRMA) with successful knockout of the FRMA gene was obtained by PCR screening of the verification primers and streaking on antibiotic plates. The verification primers were designed as follows:

[0079] YZ-ΔFRMA-F:

[0080] GTAGAGCACCCCATGTAGTG;

[0081] YZ-ΔFRMA-R:

[0082] CGGGGGCAGATTGATGCTCT;

[0083] After gene editing is completed, the strain containing the pCAS9 plasmid is inoculated into LB medium, IPTG is added, and cultured at 37°C for 12 hours to eliminate the N20 plasmid, and a single colony is isolated on a plate containing kanamycin. The single colony is cultured at 42°C for 12 hours, plated, and the single colony that grows on the non-antibiotic plate but does not grow on the corresponding plate containing kanamycin is picked. This single colony is the engineered strain that has eliminated the pCAS9 plasmid, namely E. coli MG1655 (ΔFRMA).

[0084] Example 3: Construction of artificial methylotrophic Escherichia coli with methanol assimilation pathway

[0085] Based on the E. coli MG1655 (ΔFRMA) strain constructed in Example 2, the overexpression cassettes MDH-HPS-PHI and AOX carrying the pathway genes were integrated into the E. coli genome by homologous recombination, and the constructed strain was able to achieve cell growth with methanol as the only substrate. The specific implementation method is as follows: Primers were designed based on the codon-optimized CnMDH nucleotide sequence, BmPHI nucleotide sequence, BsHPS nucleotide sequence, and ScAOX nucleotide sequence (SEQ ID NO.2):

[0086] CnMDH-F: ATGACACACCTAAACATAGCT

[0087] CnMDH-R:CATAGCGGCTGCGAAAATTGC

[0088] BmPHI-F: ATGGGATCCATGAAAACCAC

[0089] BmPHI-R:AAGCTTTTCCAGGTTCGCGT

[0090] BsHPS-F:ATGGAGTTACAGTTGGCTTTG

[0091] BsHPS-R:ACCCTGCACGATCAACTGCT

[0092] ScAOX-R:

[0093] tgaAGCTACAATGTGTCACACAGGAAAACCTGCTCGATGATGGCAATTCCAGAAGAGTScAOX-F:CTGGCGTTCAAATTTCGCAGCATTAGAAGCGAGCAAGTCCTGT

[0094] Primers were designed based on the upstream and downstream sequences of the ilvG and rph gene regions of E. coli. Primers were designed based on the upstream and downstream sequences of the ilvG and rph gene regions of E. coli. According to the E. coli genome sequence published on NCBI, the ilvG and rph sequences were found, and the cleavage sites N20 ilvG (CATGATGAATGTGCAAGAGC) and N20rph (GTTTTGTATAGTTACGAGTC) were selected in the ilvG and rph regions, respectively, and reverse amplification primers for pTargetF full plasmid PCR were designed to obtain pTargetFilvG and pTargetF rph knockout plasmids, respectively. The primers are as follows:

[0095] sgRNA-ilvG-U1: CATGATGAATGTGCAAGAGC GTTTTAGAGCTAGAAATAGCAAGT; sgRNA-ilvG-D1: GCTCTTGCACATTCATCATG ACTAGTATTATACCTAGGACTGA;

[0096] sgRNA-rph-U1: GTTTTGTATAGTTACGAGTC GTTTTAGAGCTAGAAATAGCAAGTT; sgRNA-rph-D1: GACTCGTAACTATACAAAAC ACTAGTATTATACCTAGGACTGA;

[0097] The upstream and downstream homology arms of ilvG, rph, and ylbE were amplified by PCR, and the primers are as follows:

[0098] ilvG-UF: GTGCAAGTGAAGTTGAGTTGTCTGGC;

[0099] ilvG-UR: AGTTAGTTCCCGTCCTGAATTCTGA;

[0100] rph-UF: CGCGTTCCTGACGATCGAGCGAAAT;

[0101] rph-UR:AAGTAAGATGAGGAGCGAAGGCATG;

[0102] The two were connected to CnMDH, BmPHI, BsHPS expression cassette and ScAOX respectively by one-step homologous recombination technology to form a gene fragment, and the MDH-HPS-PHI integration cassette ( Figure 3 ) and AOX integration box ( Figure 4). PCR amplification was performed, and then pTargetF ilvG, pTargetF rph, plasmid and this fragment were co-transformed into the strain E. coli MG1655 (ΔFRMA) constructed in Example 1 carrying the pCas9 plasmid, and gene knockout and replacement were completed using CRISPR Cas9 technology, and the successfully integrated engineered bacteria E. coli MGAC were screened.

[0103] Example 4: Shake flask fermentation of recombinant strain E. coli MGAC

[0104] The genetically engineered E. coli MGAC described in Example 3 that uses methanol as the sole carbon source for cell growth is fermented in a shake flask, and the specific implementation method is as follows:

[0105] Primary seed culture: 10 μL of bacterial solution was taken from the glycerol tube and inoculated into a 100 mL shake flask containing 30 mL of LB medium. The culture was carried out at 200 rpm and 37°C for 10 to 16 hours. The OD600 of the primary seed was between 6.0 and 10.0.

[0106] Secondary seed culture: Inoculate the primary shake flask seed solution into a 500 mL Erlenmeyer flask containing 100 mL LB medium at a 2% inoculation rate, and culture at 200 rpm and 37°C for 4 to 5 hours. 600 Between 1.0 and 3.0;

[0107] Shake flask fermentation in methanol inorganic salt medium: collect secondary seed cells, use sterile water to wash the residual LB in the cells, 12000rpm, 3min, wash three times, then dissolve the cells with sterile water, measure OD600, and calculate the inoculation size; culture: select initial OD600=0.01, inoculate the bacterial solution into M9 medium containing 500mmol / L methanol, culture at 37℃ with shaking, add 500mmol / L methanol every 4h, and measure OD600 value every 8h to draw growth curve and evaluate its methanol assimilation ability. Figure 5 The cell growth was shown, and the cell growth reached OD600=5 in 24h.

[0108] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. An artificial methylotrophic genetically engineered bacterium having a methanol assimilation pathway, characterized in that: The genetically engineered bacteria uses Escherichia coli as a chassis strain, knocks out glutathione dehydrogenase FRMA of the chassis strain, and also overexpresses related enzymes in the methanol assimilation pathway in the chassis strain, wherein the related enzymes in the methanol assimilation pathway include methanol dehydrogenase MDH, methanol oxidase AOX, hexose phosphate isomerase PHI and hexose phosphate synthase HPS.

2. The genetically engineered bacterium according to claim 1, characterized in that: The chassis strain is Escherichia coli MG1655.

3. The genetically engineered bacterium according to claim 1, characterized in that The methanol dehydrogenase MDH is derived from Pseudomonas, Methylobacillus, Hansenula, Pichia pastoris or Cupric bacteria; the methanol oxidase AOX is derived from Pichia pastoris, Acetobacter, Candida boidinii, Pseudomonas or Saccharomyces cerevisiae; the hexose phosphate isomerase PHI is derived from Methanococcus jannaschii, Thermoarchaea, Cupric bacteria or Methylobacillus; the hexose phosphate synthase HPS is derived from methane oxidizing bacteria, Mycobacterium tuberculosis, Cupric bacteria or Bacillus subtilis; Optionally, the methanol dehydrogenase MDH is derived from Copperobacterium necrotum, and the nucleotide sequence encoding the methanol dehydrogenase MDH gene is shown in SEQ ID NO.1; the methanol oxidase AOX is derived from Saccharomyces cerevisiae, and the nucleotide sequence encoding the methanol oxidase AOX gene is shown in SEQ ID NO.2; The phosphohexose isomerase PHI is derived from Bacillus methylophyllis, and the nucleotide sequence encoding the phosphohexose isomerase PHI gene is shown in SEQ ID NO.3; the phosphohexose synthase HPS is derived from Bacillus subtilis, and the nucleotide sequence encoding the phosphohexose synthase HPS gene is shown in SEQ ID NO.

4.

4. A method for constructing a genetically engineered bacterium, characterized in that: The construction method is to use Escherichia coli MG1655 as a starting strain, knock out glutathione dehydrogenase, and then overexpress methanol dehydrogenase MDH, methanol oxidase AOX, hexose phosphate isomerase PHI and hexose phosphate synthase HPS.

5. The method according to claim 4, characterized in that The nucleotide sequence encoding the methanol dehydrogenase MDH gene is shown in SEQ ID NO.1; the nucleotide sequence encoding the methanol oxidase AOX gene is shown in SEQ ID NO.2; the nucleotide sequence encoding the hexose phosphate isomerase PHI gene is shown in SEQ ID NO.3; and the nucleotide sequence encoding the hexose phosphate synthase HPS gene is shown in SEQ ID NO.

4.

6. The method according to claim 4, characterized in that The methanol oxidase encoding gene is integrated and expressed at the ilvG site; the MDH gene, PHI gene and HPS gene are integrated and expressed at the rph site.

7. A method for culturing genetically engineered bacteria, characterized in that: The method comprises the following steps: using methanol as a carbon source and ammonium chloride as a nitrogen source to culture and ferment the genetically engineered bacteria according to any one of claims 1 to 3.

8. The method according to claim 7, characterized in that The method comprises the following steps: (1) subjecting the genetically engineered bacteria according to any one of claims 1 to 3 to a first activation culture; (2) performing secondary activation culture on the bacterial solution cultured in step (1); (3) transferring the secondary activated strain in step (2) to M9 medium containing methanol and culturing in a shake flask; (4) The bacterial solution from step (3) was inoculated into M9 medium containing methanol and vitamin B1, and cultured at 37°C for at least 24 h; 500 mmol / L methanol was added every 4 h.

9. Use of the genetically engineered bacteria according to any one of claims 1 to 3, the method according to any one of claims 4 to 6, or the method according to claim 7 or 8 in the production of high-value chemicals, characterized in that: The production is to use methanol as a carbon source to biosynthesize high-value chemicals.

10. The use according to claim 9, characterized in that: The high-value chemicals include succinic acid, malic acid, and α-ketoglutaric acid.

Images