Corynebacterium glutamicum engineering strain with blue light response as well as construction method and application of corynebacterium glutamicum engineering strain

Abstract

The invention belongs to the technical field of biology, and particularly relates to a blue-light-responsive corynebacterium glutamicum engineering strain and a construction method and application thereof.According to the corynebacterium glutamicum engineering strain, corynebacterium glutamicum serves as a host, a light-operated gene is introduced for blue-light response, and the blue-light-responsive corynebacterium glutamicum engineering strain is obtained. The light-operated gene is a BsLicTCAT-VVD fusion protein coding gene which is formed by fusing a DNA (Deoxyribose Nucleic Acid) sequence of an RNA (Ribonucleic Acid) binding structural domain LicTCAT for transcribing an anti-terminating protein LicT and a VVD protein coding gene sequence. Compared with the prior art, the light-controlled gene BsLicTCAT-VVD fusion protein coding gene is introduced to carry out blue light response, the target gene is constructed at the downstream of the RAT anti-terminator, and the expression of the target gene is regulated through a blue light signal, so that the corynebacterium glutamicum has the capability of finely regulating the expression quantity of various genes in cells.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a blue light-responsive Corynebacterium glutamicum engineering strain and a construction method and application thereof. Background Art

[0002] Corynebacterium glutamicum is widely used in many fields such as food and medicine as a model industrial microorganism, and has great potential for synthesizing a variety of new chemicals. However, previous studies have found that in the chassis strain of Corynebacterium glutamicum, the synthesis of target product is often accompanied by the accumulation of organic acid metabolic byproducts, the obvious inhibition of bacterial growth and other phenomena, and the metabolic network and regulatory network of the host cell itself are more inclined to use resources for cell growth and reproduction, and it is difficult to coordinate the relationship between cell growth and the synthesis of target product only with static regulation means. Thus, only by carrying out directional coordinated dynamic regulation of multiple key genes in the metabolic pathway at the same time can an ideal microbial cell factory be obtained. However, the efficient dynamic regulation tool currently applicable to Corynebacterium glutamicum is relatively limited, and it is of great significance to develop a more universal, refined, and globalized dynamic regulation technology of Corynebacterium glutamicum.

[0003] At present, the chemical molecule-induced gene expression system is relatively mature and can control gene expression in time. It also has the advantages of high induction multiples and low background expression. However, chemical molecule inducers have problems such as physiological toxicity, physiological pleiotropy, poor universality and easy diffusion. Moreover, the inducer cannot be removed during the fermentation process, which makes such a system unable to switch between activation and inactivation states, thus limiting their industrial application. In addition, researchers have also discovered some regulatory elements that respond to specific metabolites, thereby playing the role of activating or inhibiting gene transcription. However, not all metabolites have corresponding response elements, and the lack of natural response components limits the diversity and universality of gene circuits. Compared with other dynamic response switches, light-induced switches have the advantages of high resolution, fast transmission, good reversibility, controllable intensity, traceless and non-toxic side effects. Here, we creatively developed a light-controlled gene expression system for Corynebacterium glutamicum, which can control gene circuits by responding to blue light signals, improve the compatibility of artificial metabolic pathways with host cells, and improve biotransformation efficiency. Summary of the invention

[0004] The purpose of the present invention is to provide a blue light-responsive Corynebacterium glutamicum engineered strain and its construction method and application, by introducing the light-controlled gene BsLicTCAT-VVD fusion protein encoding gene for blue light response, constructing the target gene downstream of the RAT anti-terminator, and regulating the expression of the target gene by blue light signal, so that Corynebacterium glutamicum has the ability to finely regulate the expression levels of various genes in cells.

[0005] The purpose of the present invention is achieved through the following technical solutions:

[0006] One of the technical solutions of the present invention is to provide a recombinant Corynebacterium glutamicum, wherein the Corynebacterium glutamicum engineering strain uses Corynebacterium glutamicum as a host, introduces a light-controlled gene for blue light response, and the light-controlled gene is a BsLicTCAT-VVD fusion protein encoding gene formed by fusion of the DNA sequence of LicTCAT, the RNA binding domain of the transcription anti-termination protein LicT, and the VVD protein encoding gene sequence, and the nucleotide sequence of the BsLicTCAT-VVD fusion protein encoding gene is shown in SEQ ID NO.1.

[0007] Furthermore, a RAT anti-terminator and a fluorescent protein reporter coding gene are inserted into the upstream position of the BsLicTCAT-VVD fusion protein coding gene.

[0008] The second technical solution of the present invention is to provide a method for constructing the blue light responsive Corynebacterium glutamicum engineering strain as described above, comprising the following steps:

[0009] The DNA sequence of LicTCAT and the gene sequence encoding protein VVD are fused and concatenated to obtain the BsLicTCAT-VVD fusion protein encoding gene, the BsLicTCAT-VVD encoding gene is connected to an expression vector, and a RAT anti-terminator and a fluorescent protein reporter encoding gene are inserted at its upstream position, the recombinant expression vector is constructed and screened, and the recombinant expression vector is then transferred into Corynebacterium glutamicum to obtain a blue light responsive Corynebacterium glutamicum engineering strain.

[0010] Furthermore, the vector is plasmid pJYW-4.

[0011] Furthermore, the nucleotide sequence of the RAT anti-terminator is shown in SEQ ID NO.23; the fluorescent protein reporter encoding gene is the mCherry encoding gene, and the nucleotide sequence of the mCherry encoding gene is shown in SEQ ID NO.24.

[0012] Furthermore, the RAT anti-terminator and mCherry fluorescent protein reporter coding gene are derived from E. coli DH5-α.

[0013] Furthermore, the BsLicTCAT-VVD, RAT and mCherry encoding genes are prior art [Reference: Liu, R., Yang, J., Yao, J., et al. (2022) Optogenetic control of RNA function and metabolism using engineered light-switchable RNA-binding proteins. Nat. Biotechnol., 40, 779-786].

[0014] Furthermore, the construction and screening of the recombinant expression vector comprises the following steps:

[0015] (1) The gene encoding the BsLicTCAT-VVD fusion protein was inserted into the multiple cloning site of the pJYW-4 plasmid and expressed by the constitutive promoter pJ23119;

[0016] (2) inserting the RAT anti-terminator and the mCherry fluorescent protein encoding gene upstream of the BsLicTCAT-VVD fusion protein encoding gene to obtain the recombinant plasmid pJYW-4-RAT-cherry-LicV0;

[0017] (3) A mutant library of the linker region between BsLicTCAT-VVD was constructed, and the recombinant plasmid pJYW-4-RAT-cherry-LicV1 with the largest difference in fluorescence intensity before and after blue light irradiation was obtained by screening;

[0018] (4) A library of RBS sequence mutants upstream of the LicV1 coding gene was constructed, and the recombinant plasmid pJYW-4-RAT-cherry-LicV2 with the largest difference in fluorescence intensity before and after blue light irradiation was obtained by screening.

[0019] Furthermore, the BsLicTCAT-VVD encoding gene sequence is located at the +28 site downstream of the Pj23119 promoter, the RAT sequence is located at the +87 site of the Ptac promoter, and the mCherry sequence is located at the +208 site of the Ptac promoter.

[0020] Furthermore, the Pj23119 promoter, Ptac promoter, BsLicTCAT-VVD and RAT, mCherry encoding genes are located on the vector pJYW-4.

[0021] Further, the promoter sequence of Pj23119 is: TTGACAgctagctcagtcctaggTATAATactagt, wherein the capitalized sequences represent the -35 region and the -10 region, respectively. The promoter sequence of Ptac is: TTGACAattaatcatcggctcgTATAATg, wherein the capitalized sequences represent the -35 region and the -10 region, respectively.

[0022] Furthermore, in step (3), the amino acid sequences of Linker1-Linker8 screened out are shown as SEQ ID NO.2-SEQ ID NO.9.

[0023] Furthermore, in step (4), the nucleotide sequences of RBS1-RBS13 screened out are shown as SEQ ID NO.10-SEQ ID NO.22.

[0024] Furthermore, the transcription anti-termination protein LicT is derived from Bacillus subtilis, and the VVD protein encoding gene sequence is derived from Neurospora crassa.

[0025] The third technical solution of the present invention is to provide an application of the blue light responsive Corynebacterium glutamicum engineered strain as described above in the metabolic regulation of Corynebacterium glutamicum.

[0026] Furthermore, the target gene is constructed downstream of the RAT anti-terminator, wherein the coding gene of the RAT anti-terminator is located upstream of the coding gene of the BsLicTCAT-VVD fusion protein, and the expression of the target gene is regulated by blue light signals.

[0027] Compared with the prior art, the present invention has the following advantages:

[0028] 1. The present invention successfully constructed a light-controlled gene expression system based on the RNA-binding protein LicTCAT-VVD with different dynamic ranges, in which the minimum regulation range was 1.4 times (after initial construction) and the maximum increased by 14.6 times (after linker and RBS screening), which can be used for fine regulation of the expression levels of various genes in cells.

[0029] 2. The present invention has successfully obtained a blue light signal photo-controlled gene expression system based on RNA binding protein, which can be used for the temporal expression of intracellular genes. For example, the chitosan oligosaccharide CHOSs synthesis pathway is used as a proof of concept, and the metabolic flow of its synthesis network is rationally designed through the gene expression regulation technology based on photo-control, so as to achieve dynamic interference of genes in multiple competing pathways and improve the titer of the target product.

[0030] 3. The control method adopted in the present invention is optical signal control. Optical signals have the characteristics of high resolution, fast transmission, good reversibility, and controllable intensity. They are economical and easy to obtain. They can be turned on or off according to actual needs, dynamically regulating the expression level of intracellular genes and realizing dynamic control of intracellular metabolic flows. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 A is a schematic diagram for screening the linker part of the light-controlled RNA binding protein LicTCAT-VVD; A is a schematic diagram of the principle of screening light-controlled RNA binding proteins; B is the verification result of LicTCAT-VVD fusion proteins with different linkers between LicTCAT and VVD.

[0032] Figure 2 Screening of the RBS sequence of the ribosome binding site of the light-controlled RNA binding protein LicTCAT-VVD; A is a schematic diagram of the results of randomly selecting 192 colonies and inoculating them on a 96-well plate for fluorescence intensity measurement after light induction, and on this basis, selecting 42 strains with the highest fluorescence intensity for fluorescence intensity measurement after dark culture; B is a diagram of the verification results of the fluorescent protein expression of LicTCAT-VVD fusion proteins with different RBS sequences under light and dark conditions.

[0033] Figure 3 A is a CRISPR-dcpf1-based light-controlled gene expression regulation tool for Corynebacterium glutamicum; A is a schematic diagram of the CRISPR-dCpf1-mediated light-controlled gene interference system; B is a result diagram for evaluating the inhibitory effect of the light-controlled gene interference system using mCherry as an indicator protein.

[0034] Figure 4 To study the effect of CRISPR-dCpf1-mediated light-controlled gene interference system on the synthesis of chitosan oligosaccharides (CHOSs) in Corynebacterium glutamicum. DETAILED DESCRIPTION

[0035] The present invention is further described below by way of examples, but the present invention is not limited to the scope of the examples. The experimental methods in the following examples without specifying specific conditions are carried out according to conventional conditions or selected according to the product specifications. It should be understood that the specific embodiments described herein are only used to explain the present invention and do not constitute a limitation of the present invention.

[0036] 1. Strains

[0037] Corynebacterium glutamicum S9114, deposit number: CCTCCAB2019183.

[0038] 2. Culture medium and culture conditions of Escherichia coli

[0039] (1) LB medium (g / L): yeast powder 5.0, peptone 10.0, NaCl 10.0.

[0040] (2) LB solid medium (g / L): yeast powder 5.0, peptone 10.0, NaCl 10.0.

[0041] (3) TB medium (g / L): yeast powder 24.0, peptone 12.0, glycerol 4.0, KH2PO4 2.32, K2HPO4 16.4.

[0042] (4) Antibiotics used in E. coli culture medium and their corresponding concentrations: kanamycin 50 μg / mL, chloramphenicol 20 μg / mL.

[0043] 3. Culture medium and culture conditions of Corynebacterium glutamicum

[0044] (1) Seed activation liquid medium (LBB medium) (g / L): yeast powder 5.0, peptone 10.0, NaCl 10.0, brain heart infusion 18.5, 250 mL baffled flask with 25 mL of liquid.

[0045] (2) Seed activation solid medium (LBB solid medium) (g / L): yeast powder 5.0, peptone 10.0, NaCl 10.0, brain heart infusion 18.5, nutrient agar powder 20.0.

[0046] (3) Competent medium (g / L): 18.5 brain heart infusion, 5.0 yeast powder, 10.0 peptone, 10.0 NaCl, 30.0 glycine, 4.0 isoniazid, add 1 mL Tween 80, and fill the 500 mL baffled flask with 50 mL of liquid.

[0047] (4) After electroporation, the cells were restored to liquid culture medium LBHIS (g / L): 5.0% peptone, 5.0% yeast extract, 5.0% NaCl, 91.0% sorbitol, and 18.5% brain heart infusion.

[0048] (5) Solid culture medium for transformants (g / L): 5.0% peptone, 5.0% yeast extract, 5.0% NaCl, 91.0% sorbitol, 18.5% brain heart infusion, and 20.0% nutrient agar.

[0049] (6) Seed culture medium (g / L): glucose 25.0, corn syrup 20.0, KH2PO4 1.0, (NH4)2SO4 0.5, urea 1.25, pH adjusted (with 1 mol / L potassium hydroxide) to 7.0.

[0050] (7) Shake flask fermentation medium (g / L): glucose 100.0, corn steep liquor 15.0, KH2PO4 1.0, (NH4)2SO4 20.0, MgSO4 0.5, CaCO3 20.0, Fe2(SO4)3, 0.18. Adjust pH (using 1 mol / L potassium hydroxide) to 7.0.

[0051] (8) Fed-batch fermentation initial medium (g / L): glucose 50.0, corn steep liquor 10.0, KH2PO4 1.0, (NH4)2SO4 20.0, MgSO4 0.5, Fe2(SO4)3, 0.18. The pH was adjusted (using 1 mol / L potassium hydroxide) to 7.0.

[0052] (9) Antibiotics used in the culture medium of Corynebacterium glutamicum and their corresponding concentrations: kanamycin 25 μg / mL, chloramphenicol 10 μg / mL.

[0053] 4. Preparation of electrocompetent cells of Corynebacterium glutamicum

[0054] (1) Corynebacterium glutamicum was inoculated into LBB medium (selection was required on a freshly cultured slant, otherwise the growth of the bacteria would be affected), placed on a roving shaker (220 rpm), and cultured at 30°C for 16 h. OD 562 Reached 3.0.

[0055] (2) Inoculate the bacterial solution in (1) into competent culture medium at a 10% inoculum volume. 562 When the OD reaches 0.3, place it on a circulating shaker (220 rpm) and culture at 30°C until the OD 562 Reach 0.9 (culture for about 3-5 hours, in the logarithmic growth phase. Generally, if the bacterial solution concentration remains low at about 0.6, subsequent operations can be continued).

[0056] (3) Place the bacterial solution on ice for 30 min, centrifuge at 4000 rpm, 4°C for 10 min, and discard the supernatant.

[0057] (4) Fully suspend the cells in 30 mL of pre-cooled 10% glycerol, centrifuge at 4000 rpm, 4°C for 10 min, discard the supernatant, and repeat the washing process four times.

[0058] (5) Resuspend the cells in 500 μL of pre-cooled 10% glycerol (concentrated 100 times) and dispense into 1.5 mL sterile centrifuge tubes, 100 μL per tube.

[0059] (6) Store at -80°C until use (to ensure the transformation efficiency of competent cells, it is best to prepare them immediately before use and not store them for more than 1 week. Otherwise, the competent cells will lyse and release their contents, which will cause the electroporation cuvette to break down during the subsequent electroporation process, affecting the transformation efficiency).

[0060] 5. Electroporation transformation of Corynebacterium glutamicum:

[0061] (1) Thaw the competent bacteria of Corynebacterium glutamicum stored at -80°C in an ice bath.

[0062] (2) Add 10 μL of plasmid (total DNA volume is approximately 1.0 μg) and mix well. Incubate on ice for 30 min.

[0063] (3) Add to a pre-cooled 0.1 cm electric shock cup and shock twice at 1.8 kV for 5 ms.

[0064] (4) Rapidly add to 1.0 mL of preheated recovery medium (LBHIS), mix well, and transfer to a new 1.5 mL sterile centrifuge tube. Incubate in a 46°C metal bath for 6 min, then place in an ice bath.

[0065] (5) Place the bacteria on a circulating shaker (150 rpm) and incubate at 30°C for 2 h.

[0066] (6) Centrifuge at 6000 rpm for 1 min at room temperature, spread onto a transformant detection plate with corresponding resistance, and culture in a constant temperature incubator at 30°C for 2-3 days.

[0067] (7) Verification of competence efficiency: 5.0 μL sterile ddH2O was added as a negative control, and no colonies grew. For the positive control, 1-5 μL plasmid pXMJ19 (total DNA amount was approximately 1.0 μg) was added, and a large number of colonies grew.

[0068] 6. Determination method of chitosan oligosaccharide

[0069] High performance liquid chromatography (HPLC) detection method: Agilent 1100, UV detector, wavelength 195 nm, NH2P-50 4E column (Shodex Asahipak), mobile phase: 70% acetonitrile solution, flow rate 1 mL / min, column temperature 30°C, injection volume 10 μL.

[0070] Example 1: Construction and screening of tool plasmids for the light-controlled gene expression system of Corynebacterium glutamicum

[0071] like Figure 1As shown in A, the DNA sequence of LicTCAT, the RNA binding domain (coantiterminator, CAT) of the transcription anti-termination protein LicT from Bacillus subtilis, and the gene sequence encoding the Vivid (VVD) protein from Neurospora crassa were synthesized and fused to obtain the BsLicTCAT-VVD fusion protein encoding gene, in which the linker amino acid sequence is (GGGGS) 2. Among them, the VVD protein contains a light-sensitive domain (LOV), which is a monomer in the resting state and forms a dimer through symmetrical contact of the exposed hydrophobic surface under light.

[0072] Using BV-F / BV-R as primers, the BsLicTCAT-VVD fusion protein encoding gene was inserted into the multiple cloning site of the pJYW-4 plasmid, and the expression was initiated by the constitutive promoter PJ23119. Then, using RAT-F / RAT-R and mcherry-F / mcherry-R as primers, a gene consisting of one unit of RAT anti-terminator derived from E. coli DH5-α and the mCherry fluorescent protein reporter encoding gene was inserted upstream of the transcription anti-terminator protein-light-sensitive protein fusion protein to establish a reporter system for detecting the anti-terminator effect of LicV. The recombinant plasmid was named pJYW-4-RAT-cherry-LicV0. Under dark conditions, LicV exists in a monomeric form and cannot specifically bind to RNA sequences (RAT antiterminators); after exposure to blue light, LicV undergoes a conformational change, forming a homodimer and specifically recognizing and binding to the RAT sequence, preventing the formation of the RNA terminator stem-loop structure, thereby allowing the transcription of the RAT downstream sequence and forming the mCherry fluorescent protein.

[0073] Primers linker5-F / R, linker10-F / R, and linker15-F / R were phosphorylated at the 5' end using a phosphorylation kit. After sequencing was correct, the recombinant plasmid pJYW-4-RAT-cherry-LicV0 was used as a template, and 5'-phosphorylated linker5-F / R, linker5-F / R, linker10-F / R, and linker15-F / R were used as primers to construct a mutant library of the linker region between LicTCAT-VVD and transformed into C. glutamicum (Corynebacterium glutamicum) S9114. In the resulting linker-5, linker-10, and linker-15 mutant libraries, the linker region between the LicTCAT-VVD recombinant proteins in the recombinant strains carried 5, 10, and 15 amino acid mutation sites, respectively, and all amino acids were randomly mutated to any amino acid combination. The mCherry fluorescent protein was used as a reporter gene to verify the binding of the LicTCAT-VVD fusion protein to the RNA anti-terminator sequence under blue light illumination and dark conditions, inhibiting transcription termination and thus promoting protein expression.

[0074] The recombinant strain was selected from the transformed plate medium and inoculated into 96 wells. The cells were cultured in the dark until the logarithmic growth phase (about 8 h) and then stimulated at 4.6 mW cm -2 Under blue light irradiation, culture at 30 ℃ to 24h; The control group is placed in the dark and cultured throughout the culture period. The cells are centrifuged at 4,000rpm and resuspended in PBS to an optical density (OD 600) of 0.1 at 600nm. Then, by a BD FACSIOR flow cytometer with a 561nm laser, the cells are analyzed and sorted according to the mCherry fluorescence intensity to determine the recombinant strain containing the LicTCAT-VVD fusion protein expressing a higher level of mCherry. The sorted cells are cultured at 30 ℃ in the dark for 18 hours and sorted to determine the recombinant strain expressing a lower level of mCherry fluorescence intensity. Carry out three such "bright-dark" screening cycles to enrich the expression of the recombinant strain of Corynebacterium glutamicum with the LicTCAT-VVD fusion protein, thereby screening out the recombinant strain with a high mCherry reporter gene expression activation level after blue light irradiation but with a low background activation level under dark conditions.

[0075] LicT carrying H207D / H269D (LicTm) mutations is maintained in an activated state that can bind to RAT. By detecting the dynamic changes of the system with or without LicIm, it can be determined whether the LicT protein can act in the cell of Corynebacterium glutamicum. In order to detect the anti-transcription termination effect mediated by LicTm, the full-length sequence of transcription anti-termination protein LicT derived from Bacillus subtilis is synthesized, wherein two amino acid mutations H207D and H269D are introduced to obtain mutant LicTm. The LicTm gene fragment is integrated into the plasmid pJYW-4-RAT-mcherry-LicV0 using primers LicTm-F / LicTm-R to obtain the recombinant plasmid pJYW-4-RAT-mcherry-LicTm. The LicTm expression plasmid pJYW-4-RAT-mcherry-LicTm is transformed into Corynebacterium glutamicum S9114. In the mutant library, mutants (Bslinker2-Bslinker 8) with higher fluorescence dynamic range were obtained compared with the original LicTCAT-VVD combination (Bslinker1). Several mutants with improved fluorescent protein expression and light-controlled dynamic range were sequenced. Among them, the LicTCAT-VVD fusion protein with linker8 (PLAPDCIFSE) showed the highest dynamic change (the fluorescent protein expression under light conditions was 7.8 times that under dark conditions), and the LicTCAT-VVD fusion protein with linker8 was called LicV1. Subsequent studies will continue to conduct subsequent experiments on this basis to try to obtain a light-controlled gene expression system with higher activation efficiency ( Figure 1 B).

[0076] Phosphorylated primers RBS1-F / RBS1-R and RBS2-F / RBS2-R were used as primers to construct a mutant library of the RBS sequence of licT-VVD. The RBS recombinant plasmids containing different lict-VVD were transformed into C.glutamicum S9114 cells, and the colonies grown on the culture dishes after mutation were inoculated in 96-well plate culture medium for culture and screening. mCherry fluorescent protein was used as a reporter gene to verify the fluorescence content of the recombinant strains containing different Lict-VVD expression levels under blue light illumination and dark conditions.

[0077] The effect of the expression level of LicTCAT-VVD on the performance of the light-controlled system was tested by randomly changing the RBS sequence upstream of the LicV1 coding gene. By constructing a library of RBS sequence mutants upstream of the LicV1 coding gene, we obtained recombinant strains with different LicV1 expression levels and constructed a library of light-controlled components with different dynamic regulation ranges, which can be used in specific experimental conditions. First, 192 colonies were randomly selected and inoculated on a 96-well plate for light-induced culture, and then the fluorescence intensity was measured. The 42 strains with the highest fluorescence intensity were selected for dark culture and then the fluorescence intensity was measured. The mutants with a higher fluorescence dynamic range (RBS2-RBS13) were selected and sequenced. Among them, Figure 2 As shown in A, the LicTCAT-VVD recombinant strain with RBS8 sequence (TATAACTTCAGGCAGAGATC) showed the highest dynamic change (14.6-fold) and was named LicV2 ( Figure 2 B).

[0078] The primer sequences described in Example 1 are shown in Table 1:

[0079] Table 1 Primer sequence 1

[0080]

[0081] Example 2: Verification of the tool plasmid of the Corynebacterium glutamicum light-controlled CRISPRi gene system

[0082] Primers dcpf1-F / dcpf1-R were used to amplify the linearized plasmid using plasmid pJYS3_ΔcrtYF as a template (plasmid sequence reference: http: / / www.addgene.org / search / catalog / plasmids / ?q=pJYS3_%CE%94crtYF), and the linearized plasmid was transformed into Escherichia coli JM109 and several transformants were selected for sequencing verification. The recombinant plasmid containing the mutation site D917A was named pJYS3_ΔcrtYF-dcpf1. Dcpf1 was integrated into the genome of Corynebacterium glutamicum S9114 using CRISPR technology to obtain the recombinant strain Corynebacterium glutamicum S9114-dcpf1. The crRNAs used in this study were all designed using the CRISPR-DT tool.

[0083] Primers mcherry-crRNA-F / mcherry-crRNA-R were used to amplify the recombinant plasmid pJYS3_ΔcrtYF-crmcherry containing the crRNA corresponding to the mcherry gene using pJYS3_ΔcrtYF as a template.

[0084] The crRNA fragment corresponding to the mcherry gene was integrated into pJYW-4-RAT-cherry-LicV using primers crm-F / crm-R, and the promoter Ptac-M was added to the mcherry gene using primers pm-F / pm-R to obtain the recombinant plasmid pJYW-4-RAT-crmcherry-mcherry-LicV. The plasmid pJYW-4-RAT-crmcherry-mcherry-LicV was transformed into the C.glutamicum S9114-dcpf1 strain, and the relative fluorescence intensity of the recombinant strain during the fermentation process of 24h fermentation was detected by shaking flask fermentation, and blue light irradiation induction conditions or in dark conditions were used. The same method was used to integrate dcpf1 into the CGGH3 and CGCS3 genomes using CRISPR technology, respectively, to obtain recombinant strains CGGH3-dcpf1 and CGCS3-dcpf1. The primer sequences used in Example 2 are shown in Table 2.

[0085] Table 2: Primer sequences 2

[0086]

[0087] like Figure 3 As shown in A, dCpf1 is an RNA-guided nuclease that can bind to crRNA to target and cut DNA or RNA. Connecting the crRNA fragment to a plasmid and then transferring it into bacteria that can express dCpf1 can hinder the expression of the gene corresponding to crRNA. Under light conditions, LicV undergoes conformational changes, forming homodimers and specifically recognizing and binding to the RAT sequence, preventing the formation of an RNA terminator stem-loop structure, thereby allowing the transcription of the RAT downstream sequence, thereby allowing crmcherry to be transcribed, affecting the expression of mCherry.

[0088] like Figure 3 As shown in B, after fermentation verification, after the blue light signal was turned on at 8h, the fluorescence intensity of mCherry in the expression strain carrying dCpf1 and the corresponding crRNA of mCherry was lower than that of the control strain within 8-24h, and was only 0.19 times the fluorescence intensity of the control group at 24h, indicating that the expression of the mCherry gene was effectively inhibited, indicating that under blue light irradiation, LicV specifically recognized and bound the RAT sequence, causing crmcherry to be transcribed, affecting the expression of mCherry.

[0089] Example 3: Application of the Corynebacterium glutamicum light-controlled gene expression system

[0090] Primers zwf-crRNA-F / zwf-crRNA-R, pfk-crRNA-F / pfk-crRNA-R, and murAA-crRNA-F / murAA-crRNA-R were used to amplify the recombinant plasmid pJYS3_ΔcrtYF-crzwf / pfk / murAA with the array of crRNAs corresponding to the three genes zwf, pfk and murAA using pJYS3_ΔcrtYF as a template, and primers cr-F / cr-R were used to integrate the array fragments of crRNAs corresponding to the zwf, pfk and murAA genes into pJYW-4-GNA1-yqaB-nodC to obtain the recombinant plasmid pJYW-4-CHOS-crzwf / pfk / murAA.

[0091] Using pJYS3_ΔcrtYF-crzwf / pfk / murAA as a template, the crRNA array fragment corresponding to the zwf / pfk / murAA gene was integrated into pJYW-4-RAT-mCherry-LicV using primers rat-cr-F / rat-cr-R to obtain the recombinant plasmid pJYW-4-RAT-crzwf / pfk / murAA-LicV. The fragment RAT-crzwf / pfk / murAA-LicV was cloned into the plasmid pJYW-4-GNA1-yqaB-nodC using primers RL-F / RL-R to obtain the recombinant plasmid pJYW-4-CHOS-RAT-crzwf / pfk / murAA-LicV.

[0092] The recombinant plasmids pJYW-4-CHOS-crzwf / pfk / murAA and pJYW-4-CHOS-RAT-crzwf / pfk / murAA-LicV were transformed into the CGCH3-dcpf1 strain to obtain the recombinant strains CGCH3-CHOS-zwf / pfk / murAAi and CGCH3-CHOS-zwf / pfk / murAAi-R.

[0093] The recombinant strains CGCH3-GNA1-yqaB-nodC, CGCH3-CHOS-zwf / pfk / murAAi, and CGCH3-CHOS-zwf / pfk / murAAi-R were fermented in shake flasks, wherein the strain CGCH3-CHOS-zwf / pfk / murAAi-R was placed under blue light (460nm peak) irradiation conditions for fermentation 8 hours after inoculation. The titer of CHOSs in the fermentation broth was detected after 72 hours. The primer sequences used in Example 3 are shown in Table 3.

[0094] The biosynthesis pathway of chitosan oligosaccharides and other functional sugars involves multiple key node compounds in the central carbon-nitrogen metabolism and peptidoglycan synthesis pathway. Conventional metabolic engineering strategies are difficult to effectively achieve dynamic and global regulation of metabolic flux, and may even interfere with the synthesis of bacterial cell walls, thereby affecting cell growth and metabolism. Figure 4 As shown, in this embodiment, the light-controlled CRISPRi gene expression regulation tool is used to dynamically regulate the expression of the related genes zwf (introducing the metabolic flow into the pentose phosphate pathway), pfk (introducing the metabolic flow into the glycolysis pathway), and murAA (introducing the metabolic flow into the peptidoglycan synthesis pathway) of the key competitive pathway, and the light-controlled gene interference bacteria CGCH3-CHOS-zwf / pfk / murAAi-R are constructed. At the same time, the strains CGCH3-CHOS-zwf / pfk / murAAi and CGCH3-GNA1-yqaB-nodC are used as the control group. After shake flask fermentation, the CHOSs production of the recombinant strain CGCH3-CHOS-zwf / pfk / murAAi-R reached 1288.4 mg / L, while CGCH3-CHOS-zwf / pfk / murAAi was 542.7 mg / L, and CGCH3-GNA1-yqaB-nodC was 251.8 mg / L ( Figure 4 ).

[0095] Table 3: Primer sequence 3

[0096]

[0097]

[0098] sequence:

[0099] SEQ ID NO.1:

[0100] ATGAAAATCGCCAAGGTGATTAATAACAATGTCATCTCGGTGGTGAACGAACAGGGCAAGGAACTTGTTGTAATGGGTCGTGGTCTTGCTTTTCAGAAAAAGTCGGGTGACGACGTCGACGAGGCTCGCATTGAAAAAGTATTCACTCTCGACAACAAGGACGTGTCTCCATTAGCCCCAGACTGCATTTTCTCTGAACACACCCTCTATGCACCCGGAGGCTATGATATTATGGGTTATCTTATTCAAATTATGAAGCGTCCAAATCCCCAAGTCGAATTGGGCCCCGTCGATACTTCCGTCGCGCTCATCTTGTGTGATTTGAAACAGAAGGATACGCCTATCGTATATGCGTCAGAGGCGTTCCTTTACATGACGGGTTATTCCAATGCGGAAGTTCTTGGTCGGAACTGCCGGTTTTTGCAGAGCCCGGACGGAATGGTAAAACCAAAGAGCACTCGGAAGTACGTCGATTCTAACACCATTAATACGATGCGTAAAGCTATTGATCGTAACGCAGAGGTTCAGGTTGAGGTCGTGAACTTTAAGAAAAATGGCCAGCGGTTCGTGAACTTCCTGACTATGATCCCGGTTCGTGATGAAACTGGCGAGTATCGTTACAGCATGGGATTTCAATGTGAAACCGAATAA。

[0101] SEQ ID NO.2:GGGGSGGGGSGGGGS。

[0102] SEQ ID NO.3:PPVEPIKYTNGDYRS。

[0103] SEQ ID NO.4:EQLQH。

[0104] SEQ ID NO.5:LAVPYLGKEC。

[0105] SEQ ID NO.6:RRTWNDLAEK。

[0106] SEQ ID NO.7:CRLRCGREIS。

[0107] SEQ ID NO.8:SLAEIGVAPE。

[0108] SEQ ID NO.9:PLAPDCIFSE。

[0109] SEQ ID NO.10:TGAAGCAGTCAA。

[0110] SEQ ID NO.11:CAGCGATTTCAT。

[0111] SEQ ID NO.12:CCACCTATTAAGGAGTATGG。

[0112] SEQ ID NO.13:CAGCGGTGCTAC。

[0113] SEQ ID NO.14:CTGGCGACGTGC。

[0114] SEQ ID NO.15:GAGCCTTATACTGTGAGGAC。

[0115] SEQ ID NO.16:CTGAATAGGTGCACAATAGG。

[0116] SEQ ID NO.17:TATAACTTCAGGCAGAGATC。

[0117] SEQ ID NO.18:CTTATCGCAAAT。

[0118] SEQ ID NO.19:GAAGCACACTTTGAGCACAG。

[0119] SEQ ID NO.20:GCAGAGGACTAGACTGAAGT。

[0120] SEQ ID NO.21:TCTATAATAAAG。

[0121] SEQ ID NO.22:GATTCATTCGCTAAAGGGTC。

[0122] SEQ ID NO.23:

[0123] GAGTAAAGGATTGTTACCGCACTAAGCGGGCAAAACCTGAAAAAAAAT TGCTTGATTCACGTCAGGCCGTTTTTCAGGTTTTTTTTTGGAGTTTTGCC GCAAAACTTCAGGCAGATTATT。

[0124] SEQ ID NO.24:

[0125] .

[0126] The above description of the embodiments is to facilitate the understanding and use of the invention by those skilled in the art. It is obvious that those skilled in the art can easily make various modifications to these embodiments and apply the general principles described herein to other embodiments without creative work. Therefore, the present invention is not limited to the above embodiments, and improvements and modifications made by those skilled in the art based on the disclosure of the present invention without departing from the scope of the present invention should be within the scope of protection of the present invention.

Claims

1. A blue light responsive Corynebacterium glutamicum engineered strain, characterized in that: The engineered strain of Corynebacterium glutamicum uses Corynebacterium glutamicum as a host, and introduces a light-controlled gene for blue light response. The light-controlled gene is a BsLicTCAT-VVD fusion protein encoding gene formed by fusion of the DNA sequence of LicTCAT, the RNA binding domain of the transcription anti-termination protein LicT, and the VVD protein encoding gene sequence. The nucleotide sequence of the BsLicTCAT-VVD fusion protein encoding gene is shown in SEQ ID NO.

1.

2. The blue light-responsive Corynebacterium glutamicum engineered strain according to claim 1, characterized in that: A RAT anti-terminator and a fluorescent protein reporter coding gene are inserted into the upstream position of the BsLicTCAT-VVD fusion protein coding gene.

3. A method for constructing a blue light-responsive Corynebacterium glutamicum engineered strain as claimed in claim 1, characterized in that: The steps include: The DNA sequence of LicTCAT and the gene sequence encoding protein VVD are fused and concatenated to obtain the BsLicTCAT-VVD fusion protein encoding gene, the BsLicTCAT-VVD encoding gene is connected to an expression vector, and a RAT anti-terminator and a fluorescent protein reporter encoding gene are inserted at its upstream position, the recombinant expression vector is constructed and screened, and the recombinant expression vector is then transferred into Corynebacterium glutamicum to obtain a blue light responsive Corynebacterium glutamicum engineering strain.

4. The blue light responsive Corynebacterium glutamicum engineered strain according to claim 3, characterized in that: The nucleotide sequence of the RAT anti-terminator is shown in SEQ ID NO.23; the fluorescent protein reporter encoding gene is the mCherry encoding gene, and the nucleotide sequence of the mCherry encoding gene is shown in SEQ ID NO.

24.

5. The method for constructing a blue light-responsive Corynebacterium glutamicum engineered strain according to claim 4, characterized in that: The construction and screening of the recombinant expression vector comprises the following steps: (1) The gene encoding the BsLicTCAT-VVD fusion protein was inserted into the multiple cloning site of the pJYW-4 plasmid and expressed by the constitutive promoter pJ23119; (2) inserting the RAT anti-terminator and the mCherry fluorescent protein encoding gene upstream of the BsLicTCAT-VVD fusion protein encoding gene to obtain the recombinant plasmid pJYW-4-RAT-cherry-LicV0; (3) A mutant library of the linker region between BsLicTCAT-VVD was constructed, and the recombinant plasmid pJYW-4-RAT-cherry-LicV1 with the largest difference in fluorescence intensity before and after blue light irradiation was obtained by screening; (4) A library of RBS sequence mutants upstream of the LicV1 coding gene was constructed, and the recombinant plasmid pJYW-4-RAT-cherry-LicV2 with the largest difference in fluorescence intensity before and after blue light irradiation was screened.

6. The method for constructing a blue light-responsive Corynebacterium glutamicum engineered strain according to claim 5, characterized in that: In step (3), the amino acid sequences of Linker1-Linker8 screened out are shown as SEQ ID NO.2-SEQ ID NO.

9.

7. The method for constructing a blue light-responsive Corynebacterium glutamicum engineered strain according to claim 5, characterized in that: In step (4), the nucleotide sequences of RBS1-RBS13 screened out are shown as SEQ ID NO.10-SEQ ID NO.

22.

8. The method for constructing a blue light-responsive Corynebacterium glutamicum engineered strain according to claim 3, characterized in that: The transcription anti-termination protein LicT is derived from Bacillus subtilis, and the VVD protein encoding gene sequence is derived from Neurospora crassa.

9. Use of the blue light-responsive Corynebacterium glutamicum engineered strain as claimed in claim 1 in the metabolic regulation of Corynebacterium glutamicum.

10. The use of the blue light responsive Corynebacterium glutamicum engineered strain according to claim 9, characterized in that: The target gene is constructed downstream of the RAT anti-terminator, wherein the coding gene of the RAT anti-terminator is located upstream of the coding gene of the BsLicTCAT-VVD fusion protein, and the expression of the target gene is regulated by blue light signals.

Images