A cellobiose epimerase mutant and its application

Abstract

The present invention discloses a cellobiose epimerase mutant and its application, belonging to the field of bioengineering technology. The mutant is a mutant in which seven amino acids of the amino acid sequence shown in SEQ ID NO.2 are simultaneously subjected to site-directed mutation; the site-directed mutations are: arginine at position 17 is mutated to glutamine, alanine at position 24 is mutated to serine, isoleucine at position 64 is mutated to valine, leucine at position 184 is mutated to serine, phenylalanine at position 243 is mutated to leucine, glutamic acid at position 339 is mutated to aspartic acid, and lysine at position 340 is mutated to isoleucine. The mutant can be applied to the industrial production of lactulose, can efficiently prepare lactulose, and has high production intensity, good catalytic effect on high-concentration substrates, and the enzyme exhibits better stability, can achieve efficient conversion of lactulose, and further provides a favorable foundation for the industrial application of cellobiose epimerase.

Description

Technical Field

[0001] The present invention relates to the technical field of bioengineering, in particular to a cellobiose epimerase mutant and application thereof. Background Art

[0002] Lactulose (4-O-β-D-galactopyranosyl-D-fructofuranose) is a disaccharide composed of D-galactosyl and D-fructose groups linked by a β-1,4-glycosidic bond. It is highly water-soluble. Lactulose has numerous physiological benefits and is a functional oligosaccharide that can be used as both a medicine and a food. It is widely used in pharmaceuticals, food, and health supplements. Concentrated lactulose syrup can be used as an oral solution to treat constipation and hepatic encephalopathy caused by hyperammonemia. Furthermore, as a prebiotic, lactulose promotes the growth of beneficial intestinal bacteria, such as bifidobacteria and lactic acid bacteria, while inhibiting the growth of harmful bacteria, such as Salmonella and Clostridium, thereby achieving a balanced intestinal microenvironment. Lactulose is registered as an over-the-counter (OTC) drug in over 100 countries and has been used for nearly 70 years. It is highly safe, with no reports of poisoning, cancer, or teratogenicity, even with high doses.

[0003] Naturally occurring lactulose is present in very low concentrations, requiring artificial synthesis to obtain large quantities. Chemical catalysis is currently the primary method for industrial lactulose production. However, chemical synthesis of lactulose suffers from low conversion rates, numerous byproducts, and difficulty in separation and purification. Enzymatic methods, on the other hand, offer efficient conversion, are environmentally friendly, and facilitate separation and purification. Therefore, developing an effective biological method for lactulose production is crucial for its industrialization. Recently, it has been discovered that cellobiose epimerase can efficiently produce lactulose with high production efficiency, excellent catalytic activity against high-concentration substrates, and excellent enzyme stability, making it a new generation of lactulose production methods with great industrial potential.

[0004] However, the current technology for synthesizing lactulose using cellobiose epimerase still has some drawbacks, the most notable of which is its low isomerization activity, which requires the addition of large amounts of enzyme to the lactulose synthesis reaction, increasing production costs. Furthermore, the reaction must be carried out at high temperatures, which places higher demands on the thermostability of the cellobiose epimerase. Therefore, using only the natural cellobiose epimerase to synthesize lactulose is not ideal, and molecular modification is needed to improve the enzyme's deficiencies and enhance its industrial application prospects. Summary of the Invention

[0005] The present invention aims to provide a cellobiose epimerase mutant and its application to address the problems of the prior art. The cellobiose epimerase mutant provided by the present invention can efficiently prepare lactulose, has high production efficiency, has a good catalytic effect on high-concentration substrates, exhibits improved enzyme stability, and can achieve efficient conversion of lactulose, further providing a favorable foundation for the industrial application of cellobiose epimerase.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides a cellobiose epimerase mutant, wherein the mutant is obtained by simultaneously subjecting seven amino acids in the amino acid sequence shown in SEQ ID NO.2 to site-directed mutations; the site-directed mutations are as follows: the 17th arginine in the amino acid sequence shown in SEQ ID NO.2 is mutated to glutamine, the 24th alanine is mutated to serine, the 64th isoleucine is mutated to valine, the 184th leucine is mutated to serine, the 243rd phenylalanine is mutated to leucine, the 339th glutamic acid is mutated to aspartic acid, and the 340th lysine is mutated to isoleucine.

[0008] The present invention also provides a gene encoding the cellobiose epimerase mutant.

[0009] The present invention also provides a recombinant vector comprising the gene.

[0010] The present invention also provides a recombinant bacterium comprising the gene.

[0011] The present invention also provides use of the cellobiose epimerase mutant, the gene, the recombinant vector or the recombinant bacteria in preparing lactulose.

[0012] The present invention also provides the use of the cellobiose epimerase mutant, the gene, the recombinant vector or the recombinant bacteria in improving the production efficiency of lactulose.

[0013] The present invention also provides a method for improving lactulose production efficiency, comprising the step of utilizing the cellobiose epimerase mutant to catalyze lactose to synthesize lactulose.

[0014] Furthermore, in the process of synthesizing lactulose, lactose is used as a substrate and a buffer solution with a pH of 7.5 is used as a reaction medium to form a reaction system, and the reaction is carried out at 80° C. to obtain lactulose.

[0015] The present invention discloses the following technical effects:

[0016] The present invention provides a cellobiose epimerase mutant R17Q / L184S. Compared with the wild-type cellobiose epimerase (CsCE), the optimal catalytic conditions of the cellobiose epimerase mutant R17Q / L184S are not changed, but the mutant has a V of 80°C. max and k cat The enzyme has a higher catalytic activity and a higher reaction rate, with a half-life of 200 minutes at 80°C. This mutant can be applied to the industrial production of lactulose, enabling efficient lactulose production with high production intensity. It also exhibits excellent catalytic effects on high-concentration substrates and exhibits improved enzyme stability, enabling efficient lactulose conversion. This further provides a favorable foundation for the industrial application of cellobiose epimerase. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0018] Figure 1 is the temperature stability of the original enzyme and the R17Q / L184S mutant;

[0019] Figure 2 This is the HPLC detection diagram after the R17Q / L184S mutant catalyzed the lactose reaction. DETAILED DESCRIPTION

[0020] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0021] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0022] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0023] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be illustrative only.

[0024] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0025] The experimental materials and reagents used in the embodiments of the present invention are as follows:

[0026] (1) The tryptone and yeast extract used in the present invention were purchased from Oxoid Company, UK, and the other analytical pure chemical reagents were purchased from Sinopharm Chemical Reagent Co., Ltd.

[0027] (2) E. coli BL21 (DH5α), E. coli BL21 (DE3) and other molecular biology reagents were provided by Beijing Quanshijin Biotechnology Co., Ltd.

[0028] (3) Primer synthesis and sequencing services were provided by Beijing Qingke Biotechnology Co., Ltd. Nanjing Branch.

[0029] (4) The culture medium formula used is as follows:

[0030] LB medium: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl. Solid medium is supplemented with 2% (w / v) agar.

[0031] Medium A: Tryptone 10 g / L, KNO3 10 g / L, glycerol 10 g / L, glucose 5 g / L, Na2HPO4 6.78 g / L, KH2PO4 3 g / L, NH4Cl 1 g / L.

[0032] (5) Resorcinol-HCl solution formula: 0.09 g of resorcinol is dissolved in 180 mL of concentrated hydrochloric acid and water is added to make up to 500 mL.

[0033] (6) HPLC mobile phase formulation: 84:16 (v / v) acetonitrile-phosphate buffer (1.15 g NaH2PO4 dissolved in 1000 mL water), and then adjusted to pH 6.8 using 20% ​​(w / v) sodium hydroxide solution.

[0034] Example 1 Construction and expression of wild-type cellobiose epimerase gene

[0035] The cellobiose epimerase (CsCE, PDB ID: 4Z4J) from Caldicellulosiruptors accharolyticus DSM 8903 was synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd. after codon optimization. The amino acid sequence encoded by the optimized gene is shown in SEQ ID NO. 2. The synthesized gene sequence was then transferred into the pET-28a(+) vector via the restriction sites BamHI and XhoI to synthesize the recombinant plasmid pET-28a(+)-CsCE. The synthesized recombinant plasmid was transformed into E. coli BL21(DE3) and plated on LB agar plates containing a final concentration of 100 μg / mL kanamycin. The cells were then incubated at 37°C for 12 hours.

[0036] The enzyme production process is as follows:

[0037] Single colonies were picked and transferred to 50 mL of liquid LB medium containing kanamycin at a final concentration of 50 μg / mL. Culture was performed at 37°C and 220 rpm for 12 hours. Subsequently, a 1% (v / v) inoculum was transferred to medium A and cultured at 37°C and 220 rpm for 5 hours. Isopropyl-β-D-thiogalactopyranoside (IPTG) was added to a final concentration of 50 μg / mL and induced at 25°C and 220 rpm for 18 hours. The induced bacterial suspension was centrifuged at 8000 rpm for 15 minutes. The supernatant was decanted and 40 mL of 10 mM KH2PO4-NaOH buffer (pH 7.5) was added to the pellet. The suspension was repeatedly shaken until dissolved. The cells were then sonicated at 400W for 20 minutes (2 seconds on, 3 seconds off). The disrupted cells were then centrifuged at 8000 rpm for 15 minutes. The supernatant was the crude enzyme solution.

[0038] Example 2 Construction and expression of mutant genes

[0039] Using pET-28a(+)-CsCE as a template, primers were designed for site-directed mutagenesis. Based on the G4-C5 mutant studied by Shen et al. from Jiangnan University (disclosed in the paper "Enhancement of isomerization activity and lactulose production of cellobiose2-epimerase from Caldicellulosiruptors accharolyticus"), in addition to introducing mutations A24S, I64V, F243L, E339D, and K340I, new mutations R17Q and L184S were added to construct the mutant plasmid pET-28a(+)-R17Q / L184S. The amino acid sequence encoded by this plasmid is shown in SEQ ID NO. 3. The designed primers were:

[0040] Forward primer R17Q: CAGATCTTCTTTAAACATGGTAATATCCATGCTGCCG (SEQ ID NO. 4);

[0041] Reverse primer R17Q: ATGTTTAAAGAAGATCTGAAATCGCATCTGG (SEQ ID NO. 5);

[0042] Forward primer A24S: TCGCATCTGGAAGAAAAAATTATTCCG (SEQ ID NO. 6);

[0043] Reverse primer A24S: TTCTTCCAGATGCGATTTCAGATCTTCT (SEQ ID NO. 7);

[0044] Forward primer I64V: AAAGCGCAGAAAGGCTGCGTTCTGAACAGCCG (SEQ ID NO. 8);

[0045] Reverse primer I64V: AACGCAGCTTTCTGCGCTTTGCGATCAATGTTC (SEQ ID NO. 9);

[0046] Forward primer L184S: TCGAGCGAAAACGGCGTGATTGCGAGC (SEQ ID NO. 10);

[0047] Reverse primer L184S: CGCCGTTTTCGCTCGAAAAGCGGTTTT (SEQ ID NO. 11);

[0048] Forward primer F243L: CTCTGCGATGATAACTGGAACGAACTGATT (SEQ ID NO. 12);

[0049] Reverse primer F243L: CCAGTTATCATCGCAGAGCACTTTAAAATGGCC (SEQ ID NO. 13);

[0050] Forward primer E339D-K340I: GATATCTATCTGGATGCGGCGATTAAAACCTGG (SEQ ID NO. 14);

[0051] Reverse primer E339D-K340I: CGCCGCATCCAGATAGATATCTTCTTTGGTTTTCTG (SEQ ID NO. 15).

[0052] PCR reaction system: forward primer 0.5 μL, reverse primer 0.5 μL, template 0.5 μL, 2×TransStartFastPfu Fly PCR Super Mix 12.5 μL, ddH2O 11 μL, total volume 25 μL.

[0053] PCR amplification conditions: pre-denaturation at 94°C for 5 min, 25 cycles of (94°C for 20 s, 55°C for 30 s, 72°C for 90 s), 72°C for 10 min, and finally incubation at 4°C.

[0054] For point mutagenesis, the original enzyme plasmid pET-28a(+)-CsCE was used as a template. One of the aforementioned primer pairs was selected and PCR amplified according to the aforementioned conditions to construct a mutant plasmid. The mutant plasmid was then identified by agarose gel electrophoresis. The template was digested by adding 0.5 μL of DMTase at 37°C for 1 hour. The cells were then transformed into E. coli BL21 (DH5α) and plated on LB agar plates containing 50 μg / mL kanamycin. The plates were incubated at 37°C for 12 hours. A single colony was cultured from the plates by the Nanjing Branch of Beijing Qingke Biotechnology Co., Ltd., and the plasmid was extracted and sequenced. Following sequencing verification, the successfully constructed mutant plasmid was used as a template to construct new mutant plasmids using the same method with other primers. Six rounds of mutagenesis were performed, ultimately resulting in the mutant plasmid pET-28a(+)-R17Q / L184S.

[0055] The successfully sequenced mutant plasmid pET-28a(+)-R17Q / L184S was transformed into E. coli BL21(DE3) and plated on LB agar plates containing kanamycin at a final concentration of 100 μg / mL. The culture was incubated at 37°C for 12 hours. The enzyme production process was then carried out according to the method in Example 1 to obtain an enzyme solution of the mutant R17Q / L184S.

[0056] Example 3 Enzyme activity determination and specific activity determination

[0057] Enzyme activity assay conditions: 3 mL total volume, 10% final lactose concentration, 1 mL enzyme, reaction at 80°C for 20 min, terminating with 100 μL of concentrated hydrochloric acid. Centrifuge the reaction at 8000 rpm for 5 min, and measure enzyme activity using the resorcinol method in the supernatant.

[0058] Enzyme activity definition: 1 U of enzyme is required to produce 1 μmol of lactulose per minute.

[0059] The specific process of enzyme activity determination by resorcinol method is as follows: take 800 μL of resorcinol-HCl solution, add appropriately diluted reaction solution (total volume 200 μL), mix and react in a boiling water bath for 7 minutes, immediately add 5 mL of pure water to cool, use UV-visible spectrophotometer to measure the absorbance at 480 nm, and substitute it into the formula to calculate the enzyme activity.

[0060] Enzyme activity calculation formula: Enzyme activity (U / mL) = (OD 480 × dilution factor) / 0.07824;

[0061] The protein concentration was determined by Bradford method, and the specific activity was further calculated.

[0062] The crude enzyme activity and specific activity of the original enzyme and the R17Q / L184S mutant are shown in Table 1. The crude enzyme activity and specific activity of the R17Q / L184S mutant are significantly improved compared with the original enzyme, with the crude enzyme activity being 320% of the original enzyme and the specific activity being 208% of the original enzyme.

[0063] Table 1 Crude enzyme activity and specific activity of the original enzyme and the R17Q / L184S mutant

[0064]

[0065] Example 4 Kinetic constants of the original enzyme and the R17Q / L184S mutant

[0066] Different lactose concentration gradients (100mM, 200mM, 300mM, 400mM, 500mM and 600mM) were set, 1mL of pure enzyme solution was added, and the reaction was carried out at 80℃ for 10min. The enzyme activity was determined by the resorcinol method and the protein concentration was determined by the Bradford method. K was further calculated by Lineweaver-Burk double reciprocal method fitting. m 、V max 、k cat and k cat / K mThe experimental results are shown in Table 2. The K m The value is lower than that of the original enzyme, indicating that the affinity for the substrate is reduced, but V max and k cat Higher, indicating increased reaction speed.

[0067] Table 2 Kinetic constants of the original enzyme and the R17Q / L184S mutant

[0068]

[0069] Example 5 Temperature stability of the original enzyme and the R17Q / L184S mutant

[0070] The enzyme solution was incubated at 80°C for 4 hours, and samples were taken every 0.5 hours. After sampling, it was immediately cooled in an ice bath for 10 minutes, and then centrifuged at 12000 rpm. The supernatant was collected and stored in a refrigerator at 4°C for later use. The enzyme activity was determined using the method of Example 3, and the enzyme half-life at this temperature was calculated. The experimental results are shown in Figure 1 The thermal stability of the R17Q / L184S mutant was significantly improved compared with the original enzyme. The half-lives of the original enzyme and R17Q / L184S at 80°C were 120 min and 200 min, respectively.

[0071] Example 6: Synthesis of Lactulose Catalyzed by the R17Q / L184S Mutant

[0072] Reaction conditions: total volume 20 mL, final lactose concentration 700 g / L, enzyme addition 25 U / mL, 80°C, 150 rpm, reaction for 3 h. After the reaction, the product in the reaction solution was detected by high-performance liquid chromatography. The chromatographic conditions are as follows:

[0073] Chromatographic column: amino column (4.6 mm × 250 mm, 5 μm);

[0074] Detector: differential refractive index detector;

[0075] Mobile phase: acetonitrile-phosphate buffer (84:16), pH 6.8;

[0076] Flow rate: 1.5 mL / min;

[0077] Column temperature: 40°C;

[0078] Injection volume: 20 μL.

[0079] The experimental results are shown in Figure 2 After the reaction, the lactulose yield was 77.4%, and the content of the by-product ipilactose was low, achieving efficient conversion of lactulose under high substrate concentration, which is suitable for industrial production.

[0080] Optimized CsCE gene sequence (SEQ ID NO.1):

[0081]

[0082] Amino acid sequence encoded by the optimized CsCE gene sequence (SEQ ID NO.2):

[0083] SMTGGQQMGRGSMDITRFKEDLKAHLEEKIIPFWQSLKDDEFGGYYGYMDFNLNIDRKAQKGCILNSRILWFFSACYNVLKSEKCKEMAFHAFEFLKNKFWDKEYEGLFWSVSHKGVPVDVTKHVYVQAFGIYGLSEYYEASGDEEALHMAKRLFEILETKCKRENGYTEQFERNWQEKENRFLSENGVIASKTMNTHLHVLESYTNLYRLLKLDDVYEALEWIVRLFVDKIYKKGTGHFKVFCDDNWNELIKAVSYGHDIEASWLLDQAAKYLKDEKLKEEVEKLALEVAQITLKEAFDGQSLINEMIEDRIDRSKIWWVEAETVVGFFNAYQKTKEEKYLDAAIKTWEFIKEHLVDRRKNSEWLWKVNEDLEAVNMPIVEQWKCPYHNGRMCLEIIKRVD。

[0084] Amino acid sequence encoded by the mutated CsCE gene sequence (SEQ ID NO.3):

[0085] SMTGGQQMGRGSMDITQFKEDLKSHLEEKIIPFWQSLKDDEFGGYYGYMDFNLNIDRKAQKGCVLNSRILWFFSACYNVLKSEKCKEMAFHAFEFLKNKFWDKEYEGLFWSVSHKGVPVDVTKHVYVQAFGIYGLSEYYEASGDEEALHMAKRLFEILETKCKRENGYTEQFERNWQEKENRFSSENGVIASKTMNTHLHVLESYTNLYRLLKLDDVYEALEWIVRLFVDKIYKKGTGHFKVLCDDNWNELIKAVSYGHDIEASWLLDQAAKYLKDEKLKEEVEKLALEVAQITLKEAFDGQSLINEMIEDRIDRSKIWWVEAETVVGFFNAYQKTKEDIYLDAAIKTWEFIKEHLVDRRKNSEWLWKVNEDLEAVNMPIVEQWKCPYHNGRMCLEIIKRVD。

[0086] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. A cellobiose epimerase mutant, characterized in that The mutant is obtained by simultaneously performing site-directed mutations on seven amino acids in the amino acid sequence shown in SEQ ID NO.2; the site-directed mutations are as follows: arginine at position 17 of the amino acid sequence shown in SEQ ID NO.2 is mutated to glutamine, alanine at position 24 is mutated to serine, isoleucine at position 64 is mutated to valine, leucine at position 184 is mutated to serine, phenylalanine at position 243 is mutated to leucine, glutamic acid at position 339 is mutated to aspartic acid, and lysine at position 340 is mutated to isoleucine.

2. A gene encoding the cellobiose epimerase mutant according to claim 1.

3. A recombinant vector comprising the gene according to claim 2. A recombinant bacterium comprising the gene according to claim 2.

5. Use of the cellobiose epimerase mutant according to claim 1, the gene according to claim 2, the recombinant vector according to claim 3 or the recombinant bacterium according to claim 4 in the preparation of lactulose.

6. Use of the cellobiose epimerase mutant according to claim 1, the gene according to claim 2, the recombinant vector according to claim 3 or the recombinant bacterium according to claim 4 in improving lactulose production efficiency.

7. A method for improving lactulose production efficiency, characterized in that: The method comprises the step of utilizing the cellobiose epimerase mutant according to claim 1 to catalyze lactose to synthesize lactulose.

8. The method according to claim 7, characterized in that In the process of synthesizing lactulose, lactose is used as a substrate and a buffer solution with a pH of 7.5 is used as a reaction medium to form a reaction system, and the reaction is carried out at 80° C. to obtain lactulose.

Images