Gene editing system and construction and evaluation method

Abstract

The invention discloses a gene editing system and a construction and evaluation method, and relates to the technical field of biology. A gene promoter for coding an EF1-alpha extension factor in medicago sativa is adopted to drive Cas9 expression, a Cas9 gene sequence is optimized according to codon preference for coding amino acid in medicago sativa, an improved CRISPR2.0 system is obtained, and a carrier CRISPR2.0-1 * MsEF1-alpha P:: Opt-Cas9 is constructed; a promoter sequence of an EF1-alpha elongation factor of the high-expression gene is shown as SEQ ID NO: 1, and a coding sequence of the optimized CAS9 gene is shown as SEQ ID NO: 2. The evaluation method of the gene editing effectiveness of the gene editing system comprises the following steps: co-expressing the system in tobacco leaves and establishing the gene editing evaluation system by relying on alfalfa transgenic hairy roots. The editing precision is improved, and the genome mutation risk is reduced.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a CRISPR / Cas9 gene editing system for alfalfa and a construction and evaluation method thereof. Background Art

[0002] Alfalfa (Medicago sativa) is an important forage crop. It is known as the "king of forage grasses" for its rich nutrients, especially its high protein content. In animal husbandry, alfalfa is a high-quality feed for livestock such as cattle and sheep, which helps to increase livestock's milk production and improve meat quality. In addition, alfalfa has a nitrogen-fixing effect, which can improve soil quality and reduce dependence on chemical fertilizers. Therefore, it also has important value in agricultural ecosystems. Therefore, cultivating new varieties of high-yield and high-quality alfalfa has become an urgent problem to be solved.

[0003] Gene editing technology is a new biotechnology developed in recent years and is widely used in the fields of crop variety improvement, genetic engineering breeding, and plant gene function research. This technology can accurately perform genetic modification at specific sites in the crop genome and avoid the risk of inserting foreign genes into the genome. Therefore, gene editing technology not only overcomes the limitations of transgenic technology in crop molecular breeding, but also avoids the environmental safety issues that foreign genes may bring.

[0004] Crop gene editing technologies mainly include ZFNs, TALEN and CRISPR / Cas systems, among which the most commonly used is the CRISPR / Cas9 system. In the CRISPR / Cas9 editing system used in crops, the coding sequence of the nuclease Cas9 gene was optimized according to the amino acid codon preferences of rice and Arabidopsis to ensure that Cas9 can be quickly translated into protein in these plants. Commonly used promoters that drive Cas9 expression include the CaMV35S promoter and the AtUbi10 promoter, which come from tobacco and Arabidopsis, respectively. Both are constitutive promoters that can efficiently drive the expression of Cas9 in plants.

[0005] CRISPR / Cas9 gene editing technology has broad application prospects in alfalfa breeding. However, to further improve the efficiency of the CRISPR / Cas9 system in alfalfa, the following key issues need to be addressed: 1. How to promote the efficient expression of Cas9 in alfalfa? 2. How to increase the expression of sgRNA in alfalfa? 3. How to reduce the off-target problem in alfalfa? Fu Chunxiang's research team (Zhao et al., 2024) used the CRISPR_2.0 system to increase the probability of targeted binding of genes through multi-target tandem, and successfully obtained the mutant of PALM1.

[0006] Therefore, technicians in this field are committed to developing a CRISPR_2.0 modification system with higher editing efficiency. Summary of the invention

[0007] In view of the above-mentioned defects of the prior art, the technical problem to be solved by the present invention is how to develop a CRISPR_2.0 transformation system with higher editing efficiency.

[0008] To achieve the above-mentioned purpose, the present invention provides a CRISPR / Cas9 gene editing system for alfalfa, the gene editing system is a modified CRISPR_2.0 system, comprising a promoter of a highly expressed gene and an optimized coding sequence of a CAS9 gene; wherein the promoter of the highly expressed gene is a promoter of an EF1-α elongation factor, the nucleotide sequence of which is shown in SEQ ID NO: 1, and the coding sequence of the optimized CAS9 gene is shown in SEQ ID NO: 2.

[0009] The original CRISPR_2.0 system has been made public (Zhao, H., Zhao, S., Cao, Y., Jiang, X., Zhao, L., Li, Z., Wang, M., Yang, R., Zhou, C., Wang, Z., Yuan, F., Ma, D., Lin, H., Liu, W., & Fu, C. (2024). CRISPR / Cas9 toolkit for efficient genome editing in autotetraploid alfalfa. The Crop Journal, 12(3), 788–795. https: / / doi.org / 10.1016 / j.cj.2024.04.001).

[0010] The present invention also includes a method for constructing a CRISPR / Cas9 gene editing system for alfalfa, comprising the following steps:

[0011] The CRISPR_2.0 system was modified, and the gene promoter encoding EF1-α elongation factor in alfalfa was used to drive Cas9 expression. The coding sequence of the Cas9 gene was optimized according to the codon preference of encoding amino acids in alfalfa. This resulted in an improved CRISPR_2.0 system and a vector CRISPR_2.0-1×MsEF1-αP::Opt-Cas9.

[0012] The present invention also includes a method for evaluating the effectiveness of gene editing of a CRISPR / Cas9 gene editing system for alfalfa, comprising the following steps:

[0013] Step 1), co-expressing the improved CRISPR_2.0 system and the reporter gene in tobacco leaves, checking the amount of protein or enzyme activity encoded by the reporter gene, and determining the effectiveness of the editing system; co-expressing the improved CRISPR_2.0 system and the reporter gene in tobacco leaves, checking the amount of protein or enzyme activity encoded by the reporter gene, and determining the effectiveness of the editing system;

[0014] Step 2) Establish a CRISPR / Cas9 gene editing evaluation system based on transgenic hairy roots of alfalfa; co-express the improved CRISPR_2.0 system and reporter gene in hairy roots of alfalfa, check the protein amount or enzyme activity encoded by the reporter gene, and use the original CRISPR_2.0 as a control to determine the high efficiency of the improved CRISPR_2.0.

[0015] Furthermore, step 1) also includes:

[0016] Four target sites were designed according to the sequence of LUC gene; the sequences of the four target sites were shown in SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25 and SEQ ID NO: 26 respectively.

[0017] Furthermore, step 1) also includes:

[0018] Four target sites were introduced into the original CRISPR_2.0 through the Golden Gate technology to obtain the original CRISPR_2.0 with the introduced editing target sites, which was used for site-specific editing of the LUC gene; the original CRISPR_2.0 with the introduced editing target sites was used as the effector plasmid, and pGreen II 0800-LUC was used as the reporter plasmid, which were transformed into Agrobacterium respectively; the Agrobacterium culture solution containing the effector plasmid and the reporter plasmid was mixed and injected into tobacco leaves. After dark culture, the leaves in the injection area were cut, and the expression of LUC was observed by the fluorescence imaging system to analyze the editing effect of the editing system on the LUC gene.

[0019] Furthermore, the Agrobacterium is GV3101, the mixing ratio of the Agrobacterium liquid containing the effector plasmid and the reporter plasmid is 1:1, and the dark culture time is 48 hours.

[0020] Furthermore, step 1) also includes: constructing CRISPR_2.0-1×MsEF1-αP::Cas9 and CRISPR_2.0-2×MsEF1-αP::Cas9 vectors respectively; the CRISPR_2.0-1×MsEF1-αP::Cas9 vector is obtained by amplifying the MsEF1-α promoter using the MsEFapro-T plasmid as a template and EFa-GZ-F (sequence 3) and EFa-GZ-R (sequence 4) as primer pairs; the CRISPR_2.0-2×MsEF1-αP::Cas9 vector is obtained by amplifying two DNA fragments containing MsEFapro using the MsEFapro-T plasmid as a template and EFa-GZ-F1 / R1 (sequences 5 and 6) and EFa-GZ-F2 / R2 (sequences 7 and 8) as primer pairs.

[0021] Furthermore, step 1) further comprises: constructing CRISPR_2.0-1×MsEF1-αP::Opt-Cas9 and CRISPR_2.0-2×MsEF1-αP::Opt-Cas9 vectors respectively; using the MsEFapro-T plasmid as a template and CR-F1 (sequence 9) and CR-R1 (sequence 10) as a primer pair to amplify the MsEFapro fragment; using pMV -Cas9 plasmid as template, CR-F2 (sequence 11) and CR-R2 (sequence 12) as primers to amplify the optimized Cas9 (Opt-Cas9) fragment; the original CRISPR_2.0 plasmid as template, CR-F3 (sequence 13) and CR-R3 (sequence 14) as primers to amplify the sgRNA fragment; the amplified MsEFapro fragment, the optimized Cas9 fragment and the sgRNA fragment were connected to the original CRISPR_2.0 linearized by restriction enzyme digestion; CRISPR_2 .0-2×MsEF1-αP::Opt-Cas9 vector was used to amplify fragment 1 containing MsEFapro using the MsEFapro-T plasmid as a template and primers CR2-F1 (sequence 15) and CR2-R1 (sequence 16). The same plasmid was used as a template and primers CR2-F2 (sequence 17) and CR2-R2 (sequence 18) were used to amplify fragment 2 containing MsEFapro. The pMV-Cas9 plasmid was used as a template and primers CR2-F3 (sequence 19) and CR2 -R3 (sequence 20) was used as a primer pair to amplify fragment 3 containing Opt-Cas9; using the original CRISPR_2.0 plasmid as a template, CR2-F4 (sequence 21) and CR2-R4 (sequence 22) were used as a primer pair to amplify fragment 4 containing sgRNA, and the amplified fragment 1 containing MsEFapro, fragment 2 containing MsEFapro, and fragment 3 containing Opt-Cas9; fragment 4 containing sgRNA was inserted into the original CRISPR_2.0 obtained by enzyme linearization.

[0022] Furthermore, step 1) also includes: using CRISPR_2.0-1×MsEF1-αP::Cas9 with four targets of LUC gene introduced as effector plasmid, using CRISPR_2.0-1×MsEF1-αP::Cas9 without introduced targets as control, and using pGreen II0800-LUC as reporter plasmid, respectively transforming Agrobacterium GV3101, and then co-transforming tobacco leaves, observing the expression of LUC by fluorescence imaging system, and analyzing the editing effect of the editing system on the LUC gene.

[0023] Furthermore, step 1) also includes:

[0024] CRISPR_2.0-1×MsEF1-αP::Opt-Cas9, CRISPR_2.0-2×MsEF1-αP::Opt-Cas9 and the original CRISPR_2.0 that introduced four targets of the LUC gene were used as effector plasmids, and pGreen II 0800-LUC was used as a reporter plasmid. After transformation of Agrobacterium GV3101, tobacco leaves were co-transformed. The expression of LUC was observed by the fluorescence imaging system, and the editing effect of the editing system on the LUC gene was analyzed.

[0025] Furthermore, the promoter of the highly expressed gene EF1-α elongation factor of alfalfa itself has the characteristics of high driving activity in alfalfa, which promotes the transcription of CAS9 in alfalfa; high-abundance codons are conducive to protein translation and accelerate the protein translation process. After codon optimization, the translation speed of CAS9 protein is accelerated, thereby increasing the protein of CAS9 nuclease in alfalfa.

[0026] Furthermore, the activity of the protein or enzyme encoded by the reporter gene was significantly reduced, confirming that the improved CRISPR_2.0 system was effective.

[0027] Furthermore, the improved CRISPR_2.0 used the alfalfa high-activity promoter to drive CAS9 expression, and the gene encoded by CAS9 was codon-optimized for alfalfa. Its effect in alfalfa was higher than that of the original CRISPR_2.0.

[0028] The primer sequences are shown in Table 1.

[0029] Table 1: Primer sequences

[0030] Sequence Name Sequence 3 tttgaaaaatctcagccatggCGATGTCGTCACAATACCTTAACC Sequence 4 cgtggtccttatagtccatggGTTGTCTTAAAACTGCGATTCACAA Sequence 5 tttgaaaaatctcagccatggCGATGTCGTCACAATACCTTAACC Sequence 6 gtgacgacatcgGTTGTCTTAAAACTGCGATTCACAA Sequence 7 aagacaacCGATGTCGTCACAATACCTTAACC Sequence 8 cgtggtccttatagtccatggGTTGTCTTAAAACTGCGATTCACAA Sequence 9 tttgaaaaatctcagccatggCGATGTCGTCACAATACCTTAACC Sequence 10 ggtccttatagtccatggGTTGTCTTAAAACTGCGATTCACAA Sequence 11 acCCATGGACTATAAGGACCACGAC Sequence 12 tcCTACTTCTTCTTCTTTGCTTGTCCTG Sequence 13 gcaaagaagaagaagtagGAATTCAAAAAAAAAAAAAAAAAAAAAA Sequence 14 aaaacgacggccagtgaattcCTTATCTTTAATCATATTCCATAGTCCATACC Sequence 15 tttgaaaaatctcagccatggCGATGTCGTCACAATACCTTAACC Sequence 16 gtgacgacatcgGTTGTCTTAAAACTGCGATTCACAA Sequence 17 aagacaacCGATGTCGTCACAATACCTTAACC Sequence 18 ggtccttatagtccatggGTTGTCTTAAAACTGCGATTCACAA Sequence 19 acCCATGGACTATAAGGACCACGAC Sequence 20 tcCTACTTCTTCTTCTTTGCTTGTCCTG Sequence 21 gcaaagaagaagaagtagGAATTCAAAAAAAAAAAAAAAAAAAAAA Sequence 22 aaaacgacggccagtgaattcCTTATCTTTAATCATATTCCATAGTCCATACC Sequence 23 AGTACTTCGAAATGTCCGTT Sequence 24 GGGCATTTCGCAGCCTACCG Sequence 25 GGATCTACTGGTCTGCCTAA Sequence 26 GCTATTCTGATTACACCCGA

[0031] In preferred embodiment 1 of the present invention, the evaluation process of the MsEF1-α promoter activity in alfalfa is described in detail;

[0032] In another preferred embodiment 2 of the present invention, the process of optimizing the nucleic acid sequence of the CAS9 gene according to the usage frequency of amino acid codons in alfalfa is described in detail;

[0033] In another preferred embodiment 3 of the present invention, the vector construction process of the improved CRISPR_2.0 system is described in detail;

[0034] In another preferred embodiment 4 of the present invention, the gene editing effectiveness evaluation process of the improved CRISPR_2.0 system is described in detail.

[0035] The beneficial technical effects of the present invention are as follows:

[0036] The present invention modifies the CRISPR_2.0 system, uses the gene promoter encoding the EF1-α elongation factor in alfalfa to drive Cas9 expression, and optimizes the coding sequence of the Cas9 gene according to the codon preference for encoding amino acids in alfalfa. Through these two modifications, the editing efficiency of the CRISPR_2.0 system in alfalfa is significantly improved.

[0037] The present invention optimizes the CRISPR / Cas9 gene editing system (CRISPR_2.0) and uses the promoter of the highly expressed gene EF1-α elongation factor of alfalfa to replace the original Arabidopsis AtUbi10 promoter to increase the transcription level of the nuclease CAS9 in alfalfa. At the same time, based on the codon usage preference of alfalfa, the amino acid codons of the nuclease CAS9 are optimized to ensure that the codons used have a high abundance in alfalfa, thereby accelerating the protein translation of CAS9. The improved CRISPR_2.0 system can perform gene editing tasks in alfalfa more efficiently, significantly accelerating the precision breeding process of alfalfa. The specific practicality of its technical solution is shown as follows:

[0038] 1.Technological advantages

[0039] By using the promoter of a highly expressed gene in alfalfa to drive CAS9 gene expression, we can ensure that the gene editing tool is efficiently expressed in the target plant. This strategy can greatly improve editing efficiency, especially in multicellular and complex tissues, making gene editing more precise. Optimizing the alfalfa codon preference of the CAS9 gene coding sequence ensures efficient translation of the nuclease, thereby improving the overall efficiency of gene editing. These modifications help reduce off-target effects, improve editing accuracy, and reduce the risk of unnecessary genomic mutations.

[0040] 2. Performance indicators

[0041] High efficiency: The modified CAS9 gene system has significantly improved expression in alfalfa, and can produce a strong genome cutting effect in a short period of time. The high efficiency of this technology is reflected in the significant increase in the success rate of editing the target gene, while saving breeding time.

[0042] Stability: The optimization of the gene editing system not only improves the editing efficiency, but also enhances the stability of the system, ensuring that the editing effect remains consistent in multiple generations of plants. This is especially important for perennial plants such as alfalfa, because of its long life cycle, and stable editing effects are the key to successful breeding.

[0043] Accuracy: Through codon optimization and targeted regulation of promoters, the off-target effects that may occur during editing are reduced, and the accuracy and safety of editing are improved. This is crucial for product quality and regulatory compliance in industrial applications.

[0044] 3. Production implementation

[0045] In terms of production implementation, the modified gene editing technology is not only suitable for small-scale applications in laboratory environments, but can also be expanded to large-scale industrial applications in field breeding. Due to technical improvements in high-expression promoters and codon optimization, this system can be used in large-scale planting projects, significantly reducing the time and resource consumption in traditional breeding methods.

[0046] Large-scale application: The efficient and stable gene editing system can quickly generate a variety of new alfalfa strains with excellent characteristics, thus meeting the market demand for disease resistance, stress resistance, nutritional value and yield.

[0047] Cost-effectiveness: The high editing efficiency of this system will significantly shorten the breeding cycle, thereby reducing the cost of developing and promoting new varieties. At the same time, the modified system relies on the plant's own efficient gene expression regulation mechanism, does not require exogenous induction, reduces dependence on complex conditions, and further reduces production costs.

[0048] Compliance: The precise optimization of codons and promoters helps to comply with various international gene editing regulations and safety assessment standards, increasing its feasibility for commercialization on a global scale.

[0049] In general, the application of the modified gene editing system in alfalfa industrial breeding can not only significantly improve breeding efficiency and accuracy, but also have strong economic benefits and market competitiveness. This technology is expected to accelerate the development of high-yield, high-quality, and stress-resistant alfalfa varieties and promote the sustainable development of the global alfalfa planting industry.

[0050] The concept, specific structure and technical effects of the present invention will be further described below in conjunction with the accompanying drawings to fully understand the purpose, characteristics and effects of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0051] Figure 1 This is a tobacco conversion experiment result diagram of a preferred embodiment 1 of the present invention;

[0052] Figure 2 This is a diagram of experimental results of observing the expression of LUC by a fluorescent imaging system according to a preferred embodiment 1 of the present invention;

[0053] Figure 3 This is a diagram of the improved CRISPR_2.0 plasmid structure in a preferred embodiment 3 of the present invention;

[0054] Figure 4 This is a diagram of experimental results of evaluating the effectiveness of CRISPR / Cas9 gene editing using a tobacco transient transformation system according to a preferred embodiment 4 of the present invention;

[0055] Figure 5 This is a diagram of the experimental results of evaluating the effectiveness of gene editing in the MsEF1-α promoter-modified CRISPR_2.0 system according to a preferred embodiment 4 of the present invention;

[0056] Figure 6 This is a graph of experimental results of evaluating the effectiveness of gene editing by the MsEF1-α promoter and the optimized CAS9 gene-modified CRISPR_2.0 system of a preferred embodiment 4 of the present invention;

[0057] Figure 7 This is a gene editing efficiency diagram of a preferred embodiment 4 of the present invention. DETAILED DESCRIPTION

[0058] The following describes several preferred embodiments of the present invention with reference to the drawings in the specification, so that the technical content is clearer and easier to understand. The present invention can be embodied in many different forms of embodiments, and the protection scope of the present invention is not limited to the embodiments mentioned in the text.

[0059] Example 1 Evaluation of MsEF1-α promoter activity in alfalfa

[0060] This example analyzes the activity of the MsEF1-α promoter (as shown in SEQ ID NO: 1) in driving the expression of the target gene in alfalfa, and the results show that the MsEF1-α promoter has a high promoter activity. The specific experimental steps are as follows:

[0061] 1.1. Transient expression analysis of the recombinant expression vector pCAMBIA-MsEF1-αP::GUS in tobacco leaves

[0062] Agrobacterium GV3101 containing pCAMBIA1301 and the recombinant vector pCAMBIA-MsEF1-αP::GUS (GUS gene expression driven by MsEF1-α promoter) was transformed into tobacco (Nicotiana benthamiana) leaves, and the expression of GUS gene was detected by GUS staining.

[0063] Tobacco transformation method: Use a syringe to gently press the lower surface of the tobacco leaf and inject the Agrobacterium solution (3000 μL) with an OD value of 0.6 into the leaf. After dark culture for 48 hours, cut the leaves in the injection area and soak them in GUS staining solution. Then use alcohol to decolorize and observe the blue staining of the leaves. The experimental results are as follows: Figure 1 shown.

[0064] GUS staining solution composition: solvent is 50mmol / L sodium hydrogen phosphate buffer with pH 7.0, solute and its concentration are: 10mmol / L EDTA, 0.1% (v / v) Triton X-100, 2mmol / L potassium ferrocyanide and 2mmol / L potassium ferrocyanide. The staining solution is stored at 4°C for future use.

[0065] from Figure 1 It can be seen that both the CaMV35S promoter and the MsEF1-α promoter can drive the expression of the GUS gene in tobacco leaves, making the leaves appear dark blue, indicating that the MsEF1-α promoter can effectively drive the high-level expression of the reporter gene GUS, and its activity is comparable to that of the CaMV35S promoter.

[0066] 1.2. Transient expression analysis of the recombinant expression vector pCAMBIA-MsEF1-αP::LUC in tobacco leaves

[0067] Agrobacterium GV3101 containing the recombinant vectors pCAMBIA1301-LUC (LUC gene expression driven by CaMV35S promoter) and pCAMBIA-MsEF1-αP::LUC (LUC gene expression driven by MsEF1-α promoter) were transformed into tobacco leaves, and the expression of LUC gene was detected by fluorescence imaging system.

[0068] The transformation treatment method of tobacco was the same as 1.1. After 48 hours of dark culture, the leaves of the injection area were cut and the expression of LUC was observed by fluorescence imaging system. The experimental results are shown in Figure 2 As shown, all infected areas produced strong fluorescence, indicating that the MsEF1-α promoter can efficiently drive high-level expression of LUC genes in tobacco, and its activity is comparable to that of the CaMV35S promoter.

[0069] Example 2 Optimization of the nucleic acid sequence of the CAS9 gene according to the frequency of amino acid codon usage in alfalfa

[0070] 2.1. Analysis of RSCU codons in alfalfa

[0071] The top 20 genes with the highest expression in alfalfa were screened out through analysis of the laboratory RNAseq database, and the RNA sequences of these genes were obtained. The usage frequencies of their amino acid triplet codons were counted, and the relative synonymous codon usage (RSCU) was calculated to establish the alfalfa codon abundance table, as shown in Table 1.

[0072] 2.2. CAS9 gene sequence optimization based on alfalfa codon abundance

[0073] According to the alfalfa codon abundance table (as shown in Table 2), high-abundance codons were selected, and the ratios of A, T, G, and C in the CAS9 gene were ensured to be close, and the same base was avoided to appear more than 5 times in a row to prevent the formation of a multi-polymer structure. We optimized the CAS9 gene sequence, and the optimized sequence is shown in Sequence 2. BGI Synthesis Company synthesized the optimized CAS9 gene based on the sequence, and the sequencing results showed that the desired gene was successfully obtained.

[0074] Table 2: Frequency of amino acid triplet codon usage in alfalfa

[0075]

[0076] Note: RSCU (Relative Synonymous Codon Usage): Relative Synonymous Codon Usage frequency, used to measure the usage of a codon compared to other synonymous codons. If the usage frequency of a codon is consistent with the expected frequency of other synonymous codons, its RSCU value is close to 1; if RSCU>1, it means that this codon has a higher usage preference in the corresponding synonymous codon set.

[0077] Example 3 Improved vector construction of CRISPR_2.0 system

[0078] The constructed modified CRISPR_2.0 plasmid structure is as follows Figure 3 The specific construction method is as follows:

[0079] 3.1. Construction of CRISPR_2.0-1×MsEF1-αP::Cas9 and CRISPR_2.0-2×MsEF1-αP::Cas9 vectors

[0080] Vector construction of CRISPR_2.0-1×MsEF1-αP::Cas9: 1) Use Nco I restriction endonuclease to digest the original CRISPR_2.0 plasmid and recover the large fragment for later use; 2) Use Novozymes high-fidelity polymerase 2×Phanta MaxMasterMix, use MsEFapro-T plasmid as template, EFa-GZ-F (sequence 3) and EFa-GZ-R (sequence 4) as primer pairs to amplify the MsEFapro (MsEF1-α promoter) fragment, and then cut the gel and recover the fragment after agarose electrophoresis; 3) Use In-fusion technology to connect the recovered fragment to the linearized CRISPR_2.0, and the connection system is: 1.5 μl (10 ng) of linearized CRISPR_2.0 vector, 1 μl (30 ng) of fragment, 2*CE Mix 5 μl of recombinase and add ddH2O to 10 μl, react in a PCR instrument at 50℃ for 30 min, transform the ligated products into E. coli DH5a competent cells, and screen positive clones on LB+Kan solid plates; 4) Pick a single clone and culture it in LB+Kan liquid culture medium, shake and culture it at 37℃ and 220rpm for 12 h, use the above-mentioned amplification primers to perform bacterial liquid PCR to identify whether the fragment is successfully inserted, and sequence the positive clones for identification.

[0081] Construction of CRISPR_2.0-2×MsEF1-αP::Cas9 vector: The method is the same as above, except that the MsEFapro-T plasmid is used as a template, and EFa-GZ-F1 / R1 (sequences 5 and 6) and EFa-GZ-F2 / R2 (sequences 7 and 8) are used as primer pairs to amplify two DNA fragments containing MsEFapro, and the fragments are connected to the linearized CRISPR_2.0 vector by In-fusion technology. The connection system is: 1.5 microliters (10 ng) of linearized CRISPR_2.0 vector, 1 microliter (30 ng) of each PCR fragment, 5 microliters of 2*CE Mix recombinase, and ddH2O supplemented to 10 microliters; 4) Pick a single clone in LB+Kan liquid medium, shake and culture at 37℃220rpm for 12 hours, use different primers to identify whether the fragment is successfully inserted by bacterial liquid PCR, and sequence the positive clones.

[0082] 3.2. Construction of CRISPR_2.0-1×MsEF1-αP::Opt-Cas9 and CRISPR_2.0-2×MsEF1-αP::Opt-Cas9 vectors

[0083] Construction of CRISPR_2.0-1×MsEF1-αP::Opt-Cas9 vector: The method is the same as 3.1, except that the MsEFapro fragment was amplified using the MsEFapro-T plasmid as a template and CR-F1 (sequence 9) and CR-R1 (sequence 10) as primers; the optimized Cas9 (Opt-Cas9) fragment was amplified using the pMV-Cas9 plasmid as a template and CR-F2 (sequence 11) and CR-R2 (sequence 12) as primers; the original CRIS The PR_2.0 plasmid was used as a template, and CR-F3 (sequence 13) and CR-R3 (sequence 14) were used as primer pairs to amplify the sgRNA fragment; the three fragments were respectively cut from the gel and recovered after agarose electrophoresis; the three fragments were connected to the linearized CRISPR_2.0 by In-fusion technology; single clones were picked and placed in LB+Kan liquid culture medium, and cultured with shaking at 37℃ and 220rpm for 12h, and the above-mentioned primers were used for bacterial liquid PCR to identify whether each fragment was successfully inserted, and the positive clones were sequenced and identified.

[0084] Vector construction of CRISPR_2.0-2×MsEF1-αP::Opt-Cas9: Using MsEFapro-T plasmid as template, CR2-F1 (sequence 15) and CR2-R1 (sequence 16) were used as primers to PCR amplify fragment 1 containing MsEFapro. Using the same plasmid as template, CR2-F2 (sequence 17) and CR2-R2 (sequence 18) were used as primers to amplify fragment 2 containing MsEFapro. Using pMV-Cas9 plasmid as template, CR2-F3 (sequence 19) and CR2-R3 (sequence 20) as primer pair, amplify fragment 3 containing Opt-Cas9; using original CRISPR_2.0 plasmid as template, CR2-F4 (sequence 21) and CR2-R4 (sequence 22) as primer pair, amplify fragment 4 containing sgRNA. The four PCR amplified fragments were recovered after agarose electrophoresis, and the four fragments were inserted into the linearized CRISPR_2.0 by In-fusion, transformed into DH5a, and positive clones were screened on LB+Kan plate. The specific operation method is shown in 3.1. The fragments inserted in the positive clones were identified by bacterial liquid PCR and sequencing.

[0085] Example 4 Evaluation of Gene Editing Effectiveness of Improved CRISPR_2.0 System

[0086] 4.1. Tobacco transient transformation system to evaluate the effectiveness of CRISPR / Cas9 gene editing

[0087] Four target sites were designed according to the sequence of the LUC gene, and the target sequences were sequence 23, sequence 24, sequence 25 and sequence 26, respectively. The four target sites were introduced into the original CRISPR_2.0 by Golden Gate technology, and the operation method was performed according to the method described in Zhao et al., 2024 (Zhao, H., Zhao, S., Cao, Y., Jiang, X., Zhao, L., Li, Z., Wang, M., Yang, R., Zhou, C., Wang, Z., Yuan, F., Ma, D., Lin, H., Liu, W., & Fu, C. (2024). Development of a single transcript CRISPR / Cas9 toolkit for efficient genome editing in autotetraploid alfalfa. The Crop Journal, 12(3), 788–795. https: / / doi.org / 10.1016 / j.cj.2024.04.001), used for site-directed editing of the LUC gene.

[0088] The original CRISPR_2.0 with the editing target introduced was used as the effector plasmid (the control was CRISPR_2.0 without the target introduced), and pGreen II 0800-LUC was used as the reporter plasmid to transform Agrobacterium GV3101. The Agrobacterium liquid containing the effector plasmid and the reporter plasmid was mixed at a ratio of 1:1, and injected into tobacco leaves according to the method of Example 1.1. After 48 hours of dark culture, the leaves of the injection area were cut, and the expression of LUC was observed by the fluorescence imaging system to analyze the editing effect of the editing system on the LUC gene.

[0089] The experimental results are as follows Figure 4 As shown, 1: pGreen0800-LUC + 1*MsEFapro-Opt-Cas9-empty, 2: pGreen0800-UC + 1*MsEFapro-Opt-Cas9-UC, 5: pGreen0800-LUC + original CR2.0-empty, 6: pGreen0800-LUC + original CR2.0-LUC. After co-transformation of CRISPR_2.0 containing the LUC target, the LUC fluorescence intensity of region 6 was significantly weaker than that of the control region 5. The experiment was repeated 9 times with similar results. The gene editing efficiency was calculated to be 41.3%, and the results are shown in Figure 7 This experiment demonstrated that the tobacco transient transformation system is effective in evaluating gene editing systems.

[0090] 4.2. MsEF1-α promoter-modified CRISPR_2.0 system and evaluation of gene editing effectiveness

[0091] CRISPR_2.0-1×MsEF1-αP::Cas9 with four targets of LUC gene was used as effector plasmid (control was CRISPR_2.0-1×MsEF1-αP::Cas9 without target), pGreen II 0800-LUC was used as reporter plasmid, and Agrobacterium GV3101 was transformed separately, and then tobacco leaves were co-transformed. The specific operation method is shown in 4.1. The expression of LUC was observed by fluorescence imaging system, and the editing effect of the editing system on the LUC gene was analyzed.

[0092] The results are as follows Figure 5 As shown, among them, 1: pGreenll 0800-LC+1*EFapro-CR2.0-LC, 2: pGreenII0800-UC+1*EFapro-CR2.0-empty, 3: pGreenlI 0800-LUC+2*EFapro-CR2.0-UC, 4: pGreenll0800-LUC+2+EFapro-CR2.0-empty. After co-transformation of CRISPR_2.0-1×MsEF1-αP::Cas9 containing the LUC target, the LUC fluorescence intensity in region 1 was significantly weaker than that in the control region 2. The experiment was repeated 9 times with similar results. It proves that after changing the promoter, CRISPR_2.0 still has effective gene editing efficiency.

[0093] Similarly, the above experiment was repeated using CRISPR_2.0-2×MsEF1-αP::Cas9 introduced into four targets of the LUC gene as the effector plasmid (containing two copies of MsEFapro (MsEF1-α promoter)), and the results were the same. Figure 5 In region 3, after co-transformation with CRISPR_2.0-2×MsEF1-αP::Cas9 containing the LUC target, the LUC fluorescence intensity was significantly weaker than that in region 4 of the control.

[0094] 4.3. MsEF1-α promoter and optimized CAS9 gene improved CRISPR_2.0 system, evaluation of gene editing effectiveness

[0095] CRISPR_2.0-1×MsEF1-αP::Opt-Cas9, CRISPR_2.0-2×MsEF1-αP::Opt-Cas9 and original CRISPR_2.0 were used as effector plasmids, and pGreen II 0800-LUC was used as reporter plasmid to transform Agrobacterium GV3101 and then co-transform tobacco leaves. The specific operation method was as described in 4.1. The experiment was repeated 4 times. The expression of LUC was observed by the fluorescence imaging system to analyze the editing effect of the editing system on the LUC gene.

[0096] The results are as follows Figure 6 As shown, among them, 1: pGreen0800-LUC + 1*MsEFapro-Opt-Cas9-empty, 3: pGreen0800-LUC + 2*MsEFapro-Opt-Cas9-empty, 5: pGreen0800-LUC + original CR2.0-empty, 2: pGreen0800-LUC + 1*MsEFapro-Opt-Cas9-LUC, 4: pGreen0800-LUC + 2*MsEFapro-Opt-Cas9-LUC, 6: pGreen0800-LUC + original CR2.0-LUC. The improved CRISPR_2.0 system (1×MsEF1-αP::Opt-Cas9) can significantly reduce the LUC fluorescence intensity, which is not much different from the original CRISPR_2.0 system, see Figure 6 Region 2. However, after doubling the number of copies of the MsEF1-α promoter, the results were slightly unstable. The gene editing efficiency of the improved CRISPR_2.0 system was calculated and determined to be 39.0% for the 1*MsEFapro-Opt-Cas9 (single copy MsEF1-α promoter and optimized CAS9) system and 0.4% for the 2*MsEFapro-Opt-Cas9 (double copy MsEF1-α promoter and optimized CAS9) system. Figure 6 shown.

[0097] The preferred specific embodiments of the present invention are described in detail above. It should be understood that ordinary technicians in the field can make many modifications and changes based on the concept of the present invention without creative work. Therefore, all technical solutions that can be obtained by technicians in the technical field based on the concept of the present invention through logical analysis, reasoning or limited experiments on the basis of the prior art should be within the scope of protection determined by the claims.

Claims

1. A CRISPR / Cas9 gene editing system for alfalfa, characterized in that: The gene editing system is a modified CRISPR_2.0 system, comprising a promoter of a highly expressed gene and an optimized coding sequence of a CAS9 gene; wherein the promoter of the highly expressed gene is a promoter of an EF1-α elongation factor, the nucleotide sequence of which is shown in SEQ ID NO: 1, and the coding sequence of the optimized CAS9 gene is shown in SEQ ID NO:

2.

2. The method for constructing a gene editing system according to claim 1, characterized in that: The method comprises the following steps: The CRISPR_2.0 system was modified, and the gene promoter encoding EF1-α elongation factor in alfalfa was used to drive Cas9 expression. The coding sequence of the Cas9 gene was optimized according to the codon preference of encoding amino acids in alfalfa. This resulted in an improved CRISPR_2.0 system and a vector CRISPR_2.0-1×MsEF1-αP::Opt-Cas9.

3. The method for evaluating the gene editing effectiveness of a gene editing system according to claim 1, wherein: The method comprises the following steps: Step 1), co-expressing the improved CRISPR_2.0 system and the reporter gene in tobacco leaves, checking the amount of protein or enzyme activity encoded by the reporter gene, and determining the effectiveness of the editing system; co-expressing the improved CRISPR_2.0 system and the reporter gene in tobacco leaves, checking the amount of protein or enzyme activity encoded by the reporter gene, and determining the effectiveness of the editing system; Step 2) Establish a CRISPR / Cas9 gene editing evaluation system based on transgenic hairy roots of alfalfa; co-express the improved CRISPR_2.0 system and reporter gene in hairy roots of alfalfa, check the protein amount or enzyme activity encoded by the reporter gene, and determine the high efficiency of the improved CRISPR_2.0 by using the original CRISPR_2.0 as a control.

4. The evaluation method according to claim 3, characterized in that: The step 1) further comprises: Four target sites were designed according to the sequence of LUC gene; the sequences of the four target sites were shown in SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25 and SEQ ID NO: 26 respectively.

5. The evaluation method according to claim 4, characterized in that: The step 1) further comprises: The four target sites were introduced into the original CRISPR_2.0 by Golden Gate technology to obtain the original CRISPR_2.0 with the introduced editing target sites, which was used for site-specific editing of the LUC gene; the original CRISPR_2.0 with the introduced editing target sites was used as the effector plasmid, and pGreen II 0800-LUC was used as the reporter plasmid, and Agrobacterium was transformed respectively; the Agrobacterium bacterial solution containing the effector plasmid and the reporter plasmid was mixed, and injected into tobacco leaves. After dark cultivation, the leaves in the injection area were cut, the expression of LUC was observed by a fluorescent imaging system, and the editing effect of the editing system on the LUC gene was analyzed.

6. The evaluation method according to claim 5, characterized in that: The Agrobacterium is GV3101, the mixing ratio of the Agrobacterium liquid containing the effector plasmid and the reporter plasmid is 1:1, and the dark culture time is 48 hours.

7. The evaluation method according to claim 6, characterized in that: The step 1) also includes: constructing CRISPR_2.0-1×MsEF1-αP::Cas9 and CRISPR_2.0-2×MsEF1-αP::Cas9 vectors respectively; the CRISPR_2.0-1×MsEF1-αP::Cas9 vector is obtained by amplifying the MsEF1-α promoter using the MsEFapro-T plasmid as a template and EFa-GZ-F and EFa-GZ-R as primer pairs; the CRISPR_2.0-2×MsEF1-αP::Cas9 vector is obtained by amplifying two DNA fragments containing the MsEFapro using the MsEFapro-T plasmid as a template and EFa-GZ-F1 / R1 and EFa-GZ-F2 / R2 as primer pairs.

8. The evaluation method according to claim 7, characterized in that: The step 1) further comprises: constructing CRISPR_2.0-1×MsEF1-αP::Opt-Cas9 and CRISPR_2.0-2×MsEF1-αP::Opt-Cas9 vectors respectively; using the MsEFapro-T plasmid as a template and CR-F1 and CR-R1 as a primer pair to amplify the MsEFapro fragment in the CRISPR_2.0-1×MsEF1-αP::Opt-Cas9 vector; using the pMV-Cas9 plasmid as a template and CR-F2 and CR-R2 as primers to amplify the optimized Cas9 (Opt-Cas9) fragment; using the original CRISPR_2.0 plasmid as a template and CR-F3 and CR-R3 as a primer pair to amplify the sgRNA fragment; connecting the amplified MsEFapro fragment, the optimized Cas9 fragment and the sgRNA fragment into the original CRISPR_2.0 fragment obtained by restriction digestion and linearization; The ISPR_2.0-2×MsEF1-αP::Opt-Cas9 vector uses the MsEFapro-T plasmid as a template and CR2-F1 and CR2-R1 as a primer pair to PCR amplify fragment 1 containing MsEFapro, uses the same plasmid as a template and CR2-F2 and CR2-R2 as a primer pair to amplify fragment 2 containing MsEFapro, uses the pMV-Cas9 plasmid as a template and CR2-F3 and CR2-R3 as a primer pair to amplify fragment 3 containing Opt-Cas9; uses the original CRISPR_2.0 plasmid as a template and CR2-F4 and CR2-R4 as a primer pair to amplify fragment 4 containing sgRNA, and the amplified fragment 1 containing MsEFapro, the fragment 2 containing MsEFapro, and the fragment 3 containing Opt-Cas9; the fragment 4 containing sgRNA is inserted into the original CRISPR_2.0 obtained by enzyme linearization.

9. The evaluation method according to claim 8, characterized in that: The step 1) also includes: using CRISPR_2.0-1×MsEF1-αP::Cas9 with four targets of the LUC gene introduced as an effector plasmid, using CRISPR_2.0-1×MsEF1-αP::Cas9 without the target introduced as a control, and using pGreen II 0800-LUC as a reporter plasmid, respectively transforming Agrobacterium GV3101, co-transforming tobacco leaves, observing the expression of LUC by a fluorescent imaging system, and analyzing the editing effect of the editing system on the LUC gene.

10. The evaluation method according to claim 8, characterized in that: The step 1) further comprises: CRISPR_2.0-1×MsEF1-αP::Opt-Cas9, CRISPR_2.0-2×MsEF1-αP::Opt-Cas9 and the original CRISPR_2.0 that introduced the four targets of the LUC gene were used as effect plasmids, and the pGreen II 0800-LUC was used as a reporter plasmid. After transforming Agrobacterium GV3101, tobacco leaves were co-transformed, and the expression of LUC was observed by a fluorescent imaging system to analyze the editing effect of the editing system on the LUC gene.

Images