Construction method of phosphotriesterase co-expression system

Abstract

The invention provides a construction method of a phosphotriesterase co-expression system, which is characterized in that a co-expression plasmid PTIG-trx of PTE is constructed in a form of co-expression of PTE and TRX protein methods, and an expression vector of which the soluble expression quantity of PTE is remarkably improved is obtained. According to the invention, PTE is successfully and efficiently expressed in Escherichia coli, co-expression of PTE in Escherichia coli is realized for the first time, the problems that a large amount of inclusion bodies exist and the soluble expression quantity is low in the existing PTE expression process can be solved, the obtained enzyme quantity is higher than that of the existing PTE expression system and can reach 5mg / 10g thalli, and the PTE enzyme activity can reach 0.45 U.mL <-1 >.

Description

Technical Field

[0001] The invention belongs to the technical field of efficient expression of organophosphorus pollutant hydrolase, and particularly relates to a method for constructing a phosphotriesterase co-expression system. Background Art

[0002] Phosphotripterase (PTE, EC3.1.8.1) from microorganisms can widely hydrolyze organophosphorus pesticides and nerve agents, with the advantages of green environmental protection and in-situ degradation, providing a new way for the disinfection of such toxic compounds. However, the expression level of heterologous PTE is low, far from the requirements of industrial production level. Researchers also promote the soluble expression of target proteins based on label proteins such as MBP (maltose binding protein tag) and GST (glutathione sulfhydryl transferase tag), but this brings new problems to the subsequent application of enzyme proteins, and these labels need to be removed before subsequent applications. Studies have shown that co-expression of folding enzymes and molecular chaperones can help the correct folding of proteins, reduce misfolding and aggregation, reduce the formation of inclusion bodies, and assist in the soluble expression of proteins. There are many molecular chaperones in the periplasm of E. coli, which can effectively improve the accuracy of protein assembly and disulfide bond formation and reduce misfolding after secretory expression. Common co-expressed periplasmic molecular chaperones include Dsb family proteins (such as DsbA, DsbB, DsbC, DsbD and DsbG), Skp, FkpA, etc. Similarly, co-expression of periplasmic folding enzymes (such as DsbA and DsbC) can also increase the secretory expression of proteins and the accuracy of disulfide bond formation, thereby increasing the solubility and expression of proteins. Summary of the invention

[0003] 1. Technical issues to be resolved

[0004] The present invention provides a method for constructing a phosphotriesterase co-expression system to solve the technical problem of low heterologous expression of PTE in Escherichia coli.

[0005] (II) Technical solution

[0006] In order to solve the above technical problems, the present invention proposes a method for constructing a phosphotriesterase co-expression system, which comprises the following steps:

[0007] S1. Design the primers as follows:

[0008] ForwardPrimer5'-3'CCGGAATTCGATAGAATTAATACAGTTAGAGG

[0009] ReversePrimer5'-3'CCGAAGCTTTGCTCTAAGTGTCGGTGACAGAAAT

[0010] S2. Synthesize the PTE gene with the following sequence

[0011] GATAGAATTAATACAGTTAGAGGACCGATTACAATTAGCGAAGCAGGCTTTACACTGACACATGAACATATTTGCGGCTCTAGCGCAGGCTTTCTGCGTGCGTGGCCGGAATTTTTCGGAAGCAGA AAAGCACTTGCGGAAAAAGCAGTGAGAGGCCTGAGAAGAGCGAGAGCAGCAGGCGTTAGAACAATTGTTGATGTTTCAACATTTGATATTGGCAGAGATGTTAGCCTTCTGGCAGAAGTTTCAAGAG CAGCAGATGTCCATATTGTGGCAGCACAGGCCTTTGGTTTGATCCGCCGCTGTCAATGCGCCTGAGATCAGTTGAAGAACTGACACAATTCTTTCTGAGAGAAATTCAATATGGAATTGAAGATACAGGCATTCGTGCAGGAATTATTAAAGTCGCAACAACAGGCAAAGCAACACCGTTTCAAGAACTGGTTCTGAAAGCGGCAGCAAGAGCATCATTAGCAACAGGCGTCCCGGTTACAACACATACAGC

[0012] After amplifying the target fragment of the PTE gene, perform agarose gel electrophoresis, cut the gel to recover the pure PTE coding gene, connect it with pMD19-T Simple Vector, transform it into E.coilJM109 competent cells, spread it on ampicillin resistant plates, pick the transformants, perform colony PCR verification and enzyme digestion verification, detect the size of the inserted fragment of the PTE coding gene, and construct the pMD19-T-pte plasmid for the next step of amplifying the target fragment;

[0013] S3. After the fragment size is verified to be correct, the pMD19-T-pte plasmid is double-digested and then subjected to agarose gel electrophoresis. The target fragment is cut and recovered from the gel and the linearized vector PTIG-trx is added to the reaction system, incubated and connected to construct the recombinant plasmid PTIG-trx-pte;

[0014] S4. The recombinant plasmid PTIG-trx-pte was transformed into E.coliBL21 (DE3) competent cells, spread on ampicillin-resistant plates, and cultured; after the size was verified by colony PCR, the correct transformant was amplified and verified, and the plasmid was extracted for restriction digestion and sequencing verification;

[0015] S5. Pick a single colony from the strain verified by sequencing and inoculate it into LB medium. After shaking culture, obtain the seed liquid for fermentation, inoculate it into TB liquid medium, shake culture, add IPTG inducer to the bacterial liquid after culture, induce culture, and complete the construction.

[0016] Furthermore, in step S1, the primer design function of the National Center for Biotechnology Information of the United States is used to introduce EcoRI / HindIII restriction sites at both ends of the primers to design the primers.

[0017] Furthermore, in step S2, the target fragment of the PTE gene is amplified by PCR amplification.

[0018] Furthermore, in step S3, the target fragment recovered by gel excision and the linearized vector PTIG-trx were added into 10 μL reaction system at a mass ratio of 1:10.

[0019] Furthermore, in step S3, the cells were incubated in a metal bath at 16° C. for 18 to 24 hours to connect and construct the recombinant plasmid PTIG-trx-pte.

[0020] Furthermore, in step S4, the culture is inverted at 37° C. for 12 to 16 hours.

[0021] Further, in step S5, a single colony was picked and inoculated into 20 mL of LB medium at 37°C and 200 r·min. -1 After shaking culture for 10 h, the seed solution used for fermentation was obtained.

[0022] Further, in step S5, 2% of the inoculum was inoculated into 50 mL of TB liquid culture medium at 37°C and 200 r·min -1 After 2 h of culturing, different concentrations of IPTG inducer were added to the bacterial solution for induction culture to complete the construction.

[0023] Furthermore, in step S5, the LB medium and the TB liquid medium contain 100 μg mL -1 Ampicillin.

[0024] Further, in step S5, the temperature is set at 16°C and 200 r / min. -1 Induce the culture in a shaker.

[0025] (III) Beneficial effects

[0026] The present invention proposes a method for constructing a phosphotriesterase co-expression system, in which PTE and TRX proteins are co-expressed to construct a co-expression plasmid PTIG-trx of PTE, and an expression vector with significantly improved soluble expression of PTE is obtained. The present invention successfully and efficiently expresses PTE in Escherichia coli, and realizes the co-expression of PTE in Escherichia coli for the first time, which can solve the problem of a large number of inclusion bodies and low soluble expression in the current PTE expression process. The amount of enzyme obtained is higher than the current PTE expression system, which can reach 5 mg / 10 g of bacteria, and the PTE enzyme activity can reach 0.45 U·mL -1 . BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1a is the ethanol precipitation curve of PTE in the present invention (the curve shows the relative activity change of PTE in different ethanol concentration systems, Figure 1b SDS-PAGE electrophoresis analysis of the purified product of the target protein;

[0028] Figure 2a is the change of enzyme activity at different temperatures in the present invention, Figure 2b The enzyme stability change curve at different temperatures;

[0029] Figure 3a The enzyme activity changes under different pH conditions in the present invention, Figure 3b The enzyme stability change curve under different pH conditions in the present invention;

[0030] Figure 4 The kinetic curve of degradation of methyl parathion by PTE in the present invention;

[0031] Figure 5 The biotransformation curve of PTE degradation of methyl parathion, dimethoate and VX in the present invention. DETAILED DESCRIPTION

[0032] In order to make the purpose, content and advantages of the present invention more clear, the specific implementation methods of the present invention are further described in detail below in conjunction with the drawings and examples.

[0033] Example 1

[0034] The recombinant E. coli BL21 (DE3) / PTIG-trx-pte and the control E. coli BL21 (DE3) / PTIG-trx were inoculated into 20 mL LB liquid medium and incubated at 37 °C and 200 r / min. -1 The culture was carried out for 12 h under the conditions of 50 mL LB medium at a 2% inoculum volume. The temperature and speed were kept constant and the culture was continued until the OD600 was about 0.6. The final concentration of 0.2 mmol·L -1IPTG, at 25°C, 150 r·min -1 Under the conditions, the induction was carried out for 6 hours. 4℃, 12000r·min -1 Centrifuge for 20 min to collect the cells. Wash the cells three times with ddH2O and then wash with 30 mL 50 mmol / L -1 The cells were resuspended in Tris-HCl (pH = 8.0) containing mmol·L -1 EDTA and 25% (w / v) sucrose buffer, then incubate in an ice water bath overnight, and the supernatant after centrifugation is the crude phosphotriesterase enzyme solution in the periplasmic space. -1 After resuspending in Tris-HCl (pH=8.0), the cells were broken with a disruptor. Breaking conditions: break for 1s, stop for 2s, and then for 5min. After low-temperature centrifugation, the precipitate was discarded and the supernatant was taken to obtain the crude intracellular phosphotriesterase enzyme solution, which was further purified by nickel column.

[0035] The recombinant bacteria E. coli BL21 (DE3) / PTIG-trx-pte were fermented and cultured according to the above method. After the cells were broken, the crude PTE enzyme solution was obtained. In order to further study the expression and properties of PTE, it was separated and purified. First, ethanol was used for graded precipitation. Figure 1a It can be seen that when the ethanol concentration is 40%, most of the recombinant enzymes exist in the supernatant; when the ethanol concentration is greater than 40%, the enzyme activity in the supernatant gradually decreases; when the ethanol concentration reaches 80%, there is basically no enzyme activity in the supernatant, indicating that PTE has been basically precipitated. Therefore, 30% ethanol is used for primary precipitation, centrifugation is used to remove impurities, and then the ethanol concentration is adjusted to 80% for secondary precipitation of the target protein. The resulting precipitate is dialyzed using an 8-14 kDa dialysis bag. The dialyzed enzyme solution is further purified by affinity chromatography, and the crude enzyme solution and purified PTE are analyzed by SDS-PAGE. The results show that a single band is obtained after purification, with a size of approximately 46KD. The molecular mass of the target protein is basically consistent with the theoretical protein size calculated by the amino acid sequence (43.6KD), as shown in Figure 2. Figure 1b shown.

[0036] Example 2

[0037] The fermentation temperature of the recombinant E. coli BL21 / pTIG-trx-ob3 was optimized. The optimal fermentation temperature was 16°C, and the enzyme activity and bacterial concentration were determined under the same fermentation conditions; the final concentration of IPTG inducer was 0.1 mmol·L -1 , other fermentation conditions were the same, and the enzyme activity and bacterial concentration were determined, as shown in Table 1.

[0038] Table 1 Effect of fermentation temperature on enzyme activity and bacterial concentration

[0039]

[0040] Example 3

[0041] The fermentation temperature of the recombinant E. coli BL21 / pTIG-trx-ob3 was optimized. The optimal fermentation temperature was 20°C, and the enzyme activity and bacterial concentration were determined under the same fermentation conditions; the final concentration of IPTG inducer was 0.1 mmol·L -1 , other fermentation conditions were the same, and the enzyme activity and bacterial concentration were determined, as shown in Table 2.

[0042] Table 2 Effect of fermentation temperature on enzyme activity and bacterial concentration

[0043]

[0044] Example 4

[0045] The fermentation temperature of the recombinant E. coli BL21 / pTIG-trx-ob3 was optimized. The optimal fermentation temperature was 30°C, and the enzyme activity and bacterial concentration were determined under the same fermentation conditions; the final concentration of IPTG inducer was 0.1 mmol·L -1 , other fermentation conditions were the same, and the enzyme activity and bacterial concentration were measured, as shown in Table 3.

[0046] Table 3 Effect of fermentation temperature on enzyme activity and bacterial concentration

[0047]

[0048] Example 5

[0049] The fermentation temperature of the recombinant E. coli BL21 / pTIG-trx-ob3 was optimized. The optimal fermentation temperature was 30°C, and the enzyme activity and bacterial concentration were determined under the same fermentation conditions; the final concentration of IPTG inducer was 0.01 mmol·L -1 , other fermentation conditions were the same, and the enzyme activity and bacterial concentration were measured, as shown in Table 4.

[0050] Table 4 Effect of inducer concentration on enzyme activity and bacterial concentration

[0051]

[0052] Example 6

[0053] The final concentration of IPTG inducer of recombinant E.coliBL21 / pTIG-trx-ob3 was optimized. The optimal fermentation temperature was 30°C, and the enzyme activity and bacterial concentration were determined under the same fermentation conditions; the final concentration of IPTG inducer was 0.1mmol·L -1, other fermentation conditions were the same, and the enzyme activity and bacterial concentration were measured, as shown in Table 5.

[0054] Table 5 Effect of inducer concentration on enzyme activity and bacterial concentration

[0055]

[0056] Example 7

[0057] The final concentration of IPTG inducer of recombinant E.coliBL21 / pTIG-trx-ob3 was optimized. The optimal fermentation temperature was 30°C, and the enzyme activity and bacterial concentration were determined under the same fermentation conditions; the final concentration of IPTG inducer was 0.25mmol·L -1 , other fermentation conditions were the same, and the enzyme activity and bacterial concentration were measured, as shown in Table 6.

[0058] Table 6 Effect of inducer concentration on enzyme activity and bacterial concentration

[0059]

[0060] Example 8

[0061] The final concentration of IPTG inducer of recombinant E.coliBL21 / pTIG-trx-ob3 was optimized. The optimal fermentation temperature was 30°C, and the enzyme activity and bacterial concentration were determined under the same fermentation conditions; the final concentration of IPTG inducer was 0.5mmol·L -1 , other fermentation conditions were the same, and the enzyme activity and bacterial concentration were measured, as shown in Table 7.

[0062] Table 7 Effect of inducer concentration on enzyme activity and bacterial concentration

[0063]

[0064] Example 9

[0065] Determination of the optimal reaction temperature: Set the temperature to 20-80°C, set 3 parallels at each temperature, first add 100 μL of 10 mg mL -1 Methyl parathion and 0.8mL 50mmol·L -1 Tris-HCl (pH=8.0) buffer was preheated for 10 min at different temperatures, and then 100 μL of purified enzyme solution was added. After reacting for 10 min at different temperatures, 1 mL of 10% TCA was immediately added to terminate the reaction, and 1 mL of 10% Na2CO3 was added for color development. The reaction was then continued at 12000 r·min. -1 After centrifugation for 20 min, OD410 was measured and the enzyme activity was calculated.

[0066] Determination of temperature tolerance: After the purified enzyme was placed under different conditions of 20-80°C for 1 h, 100 μL of the treated enzyme solution was taken out and added to the test reaction solution that had been preheated at 37°C for 5 min, where the test reaction solution contained 100 μL of 10 mg mL -1 Methyl parathion and 0.8mL 50mmol·L -1 Tris-HCl (pH=8.0) buffer was used to measure OD410, and the untreated enzyme solution was used as a control.

[0067] Biological enzymes are easily affected by temperature. PTE activity was determined according to the above method. Figure 2a As shown. The results show that the best reaction temperature is 50℃. When the temperature is lower than 50℃, the enzyme activity will increase with the increase of temperature. However, at 20℃, the relative enzyme activity is still 31.25% of the maximum activity. When the temperature is higher than 50℃, the enzyme activity of PTE will decrease rapidly. When the temperature reaches 80℃, there is still 77% enzyme activity. At the same time, because methyl parathion is easily affected by temperature, when the reaction temperature gets higher and higher, the decomposition rate of methyl parathion itself will gradually accelerate. The thermal stability curve of PTE is shown in Figure 2b As shown in the figure, it can be seen that when the temperature rises, the activity of phosphotriesterase will slightly decrease. At 90°C, the enzyme activity will decrease, but the relative enzyme activity is still 45.21%, which shows that the enzyme has a certain temperature tolerance.

[0068] Example 10

[0069] Determination of the optimum pH: Prepare Tris-HCl buffer (pH = 7.0-9.5) and glycine-sodium hydroxide buffer (pH = 8.6-10.6), take 0.8 mL of buffers with different pH values ​​and add them to 5 mL EP tubes, preheat at 37 °C for 5 min and set aside for use. At the same time, add 100 μL of 10 mg mL -1 Methyl parathion was mixed with 100 μL of the corresponding enzyme solution (the purified enzyme was concentrated and then diluted with the corresponding buffer) and reacted at 37°C for 10 min, after which OD410 was measured. The enzyme solution was replaced with the corresponding pH buffer as a blank control.

[0070] pH tolerance: Place the recombinant enzyme in buffer solutions of different pH values ​​and keep them at 37°C for 1 hour. Place the test solution in a 5mL EP tube and preheat at 37°C for 5 minutes before use. Then add 100μL of the test enzyme solution and measure the activity of the recombinant enzyme. Use the enzyme solution that has not been kept at different pH conditions as a control.

[0071] Changes in recombinant enzyme activity under different pH conditions Figure 3aAs shown in the figure, it can be seen that the optimal reaction pH of the enzyme is 8.5, and the enzyme activity at pH = 8.5 is 100%. When the pH is in the range of 8 to 10.5, its relative enzyme activity exceeds 81%. The pH stability curve of phosphotriesterase is shown in Figure 3b As shown in the figure, it can be concluded that after being incubated in different pH environments for 1 hour, the relative enzyme activity of the enzyme solution at pH = 10.5 is still 79.15%, which indicates that the enzyme is suitable for storage under alkaline conditions.

[0072] Embodiment 11

[0073] Methyl parathion was used as the reaction substrate, and the substrate concentration was selected to be 10 g·L -1 , 8g·L -1 , 5g·L -1 , 2.5g·L -1 , 1.25g·L -1 , 0.625g·L -1 , 0.2g·L -1 , added to 50mmol·L -1 The reaction rate of the recombinant enzyme was measured in a Tris-HCl (pH=8.0) buffer system at 37°C. The double reciprocal method was used to plot the reaction rate according to the Michaelis-Menten equation. The formula is as follows:

[0074]

[0075] Where: V represents the enzyme reaction rate; S represents the substrate concentration; V max Represents the maximum reaction rate; K m represents the Michaelis constant.

[0076] Taking methyl parathion as substrate, the substrate concentration selected for determination was 10 g·L -1 , 8g·L -1 , 5g·L -1 , 2.5g·L -1 , 1.25g·L -1 , 0.625g·L -1 , 0.2g·L -1 According to the Michaelis equation, the double reciprocal method is used to plot, that is, the reciprocal of the substrate concentration is used as the x-axis and the reciprocal of the reaction rate is used as the y-axis. The results are as follows: Figure 4 shown.

[0077] The intercept of the line with the x-axis is K m 0.55mmol·L -1 ; The intercept of the straight line with the y-axis is That is V max 1.36 μmol·L -1 ·min-1 .

[0078] Example 12

[0079] The recombinant enzyme was investigated for the effects of different reaction times on methyl parathion, dimethoate and VX (5 mg·mL -1 ) catalytic degradation performance: reaction temperature 37℃, disinfection experiment in test tube, enzyme dosage 0.1mg, substrate dosage 5mg; extraction with 2mL dichloromethane at the end of the reaction, extract analysis by Agilent 7890A gas chromatography, quantitative analysis of the conversion rate of the reactants based on the ratio of the peak area before and after the reaction. Chromatographic conditions: chromatographic column: HP-5 quartz capillary column 30m×0.25mm×0.25μm; injection port temperature: 280℃, carrier gas: hydrogen; carrier gas flow rate: 1.5mL·min -1 GC injection mode: split injection, split ratio 1:20; heating program: initial temperature 40°C, hold for 2 min, heating rate 20°C·min -1 Raise the temperature to 280°C and maintain for 5 minutes.

[0080] The degradation rate of the recombinant enzyme on methyl parathion, dimethoate and VX was determined according to the above method. Figure 5 As shown in the figure, at 37°C, after 30 minutes of reaction, the degradation rates of methyl parathion, dimethoate and VX reached 98%, 92% and 79% respectively.

[0081] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the technical principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A method for constructing a phosphotriesterase co-expression system, characterized in that: The construction method comprises the following steps: S1. Design the primers as follows: ForwardPrimer5'-3'CCGGAATTCGATAGAATTAATACAGTTAGAGG ReversePrimer5'-3'CCGAAGCTTTGCTCTAAGTGTCGGTGACAGAAAT S2. Synthesize the PTE gene with the following sequence GATAGAATTAATACAGTTAGAGGACCGATTACAATTAGCGAAGCAGGCTTTACACTGACACATGAACATATTTGCGGCTCTAGCGCAGGCTTTCTGCGTGCGTGGCCGGAATTTTTCGGAAGCAGA AAAGCACTTGCGGAAAAAGCAGTGAGAGGCCTGAGAAGAGCGAGAGCAGCAGGCGTTAGAACAATTGTTGATGTTTCAACATTTGATATTGGCAGAGATGTTAGCCTTCTGGCAGAAGTTTCAAGAG CAGCAGATGTCCATATTGTGGCAGCACAGGCCTTTGGTTTGATCCGCCGCTGTCAATGCGCCTGAGATCAGTTGAAGAACTGACACAATTCTTTCTGAGAGAAATTCAATATGGAATTGAAGATACAGGCATTCGTGCAGGAATTATTAAAGTCGCAACAACAGGCAAAGCAACACCGTTTCAAGAACTGGTTCTGAAAGCGGCAGCAAGAGCATCATTAGCAACAGGCGTCCCGGTTACAACACATACAGC After amplifying the target fragment of the PTE gene, perform agarose gel electrophoresis, cut the gel to recover the pure PTE coding gene, connect it with pMD19-T Simple Vector, transform it into E.coilJM109 competent cells, spread it on ampicillin resistant plates, pick the transformants, perform colony PCR verification and enzyme digestion verification, detect the size of the inserted fragment of the PTE coding gene, and construct the pMD19-T-pte plasmid for the next step of amplifying the target fragment; S3. After the fragment size is verified to be correct, the pMD19-T-pte plasmid is double-digested and then subjected to agarose gel electrophoresis. The target fragment is cut and recovered from the gel and the linearized vector PTIG-trx is added to the reaction system, incubated and connected to construct the recombinant plasmid PTIG-trx-pte; S4. The recombinant plasmid PTIG-trx-pte was transformed into E.coliBL21 (DE3) competent cells, spread on ampicillin-resistant plates, and cultured; after the size was verified by colony PCR, the correct transformant was amplified and verified, and the plasmid was extracted for restriction digestion and sequencing verification; S5. Pick a single colony from the strain verified by sequencing and inoculate it into LB medium. After shaking culture, obtain the seed liquid for fermentation, inoculate it into TB liquid medium, shake culture, add IPTG inducer to the bacterial liquid after culture, induce culture, and complete the construction.

2. The method for constructing the phosphotriesterase co-expression system according to claim 1, wherein: In step S1, the primer design function of the National Center for Biotechnology Information of the United States is used to introduce EcoRI / HindIII restriction sites at both ends of the primers to design primers.

3. The method for constructing the phosphotriesterase co-expression system according to claim 1, wherein: In step S2, the target fragment of the PTE gene is amplified by PCR amplification.

4. The method for constructing the phosphotriesterase co-expression system according to claim 1, wherein: In step S3, the target fragment recovered by gel excision and the linearized vector PTIG-trx were added into 10 μL reaction system at a mass ratio of 1:

10.

5. The method for constructing the phosphotriesterase co-expression system according to claim 4, characterized in that: In step S3, the cells were incubated in a metal bath at 16° C. for 18 to 24 hours to allow ligation and to construct the recombinant plasmid PTIG-trx-pte.

6. The method for constructing the phosphotriesterase co-expression system according to claim 1, wherein: In step S4, the cells are incubated at 37°C for 12 to 16 hours.

7. The method for constructing the phosphotriesterase co-expression system according to claim 1, wherein: In step S5, a single colony was picked and inoculated into 20 mL of LB medium at 37°C and 200 r / min. -1 After shaking culture for 10 h, the seed solution used for fermentation was obtained.

8. The method for constructing the phosphotriesterase co-expression system according to claim 7, wherein: In step S5, 2% of the inoculum was inoculated into 50 mL of TB liquid culture medium and the mixture was incubated at 37°C and 200 r·min -1 After 2 h of culturing, different concentrations of IPTG inducer were added to the bacterial solution for induction culture to complete the construction.

9. The method for constructing the phosphotriesterase co-expression system according to claim 7, wherein: In step S5, LB medium and TB liquid medium contain 100 μg mL -1 Ampicillin.

10. The method for constructing a phosphotriesterase co-expression system according to claim 7, wherein: In step S5, the temperature is set at 16°C and 200 r / min. -1 Induce the culture in a shaker.

Images