Application of tocopherol methyltransferase VTE4 gene in prevention and treatment of tomato chlorosis virus

Abstract

The invention discloses an application of a tocopherol methyltransferase VTE4 gene in prevention and treatment of tomato chlorosis virus. The invention discloses an application of an overexpressed tocopherol methyltransferase VTE4 gene in prevention and treatment of tomato chlorotic viruses of plants, the nucleotide sequence of the tocopherol methyltransferase VTE4 gene is shown as SEQ ID NO.2, and the plants are solanaceae plants. The invention finds that the tocopherol methyltransferase VTE4 and the coding gene thereof play an important role in ToCV infection and proliferation, are dominant anti-ToCV antiviral genes coded by host plants, can be used for preventing and treating tomato chlorotic virus diseases caused by ToCV, and can be used for ToCV-resistant molecular breeding and other works.

Description

Technical Field

[0001] The invention belongs to the technical field of plant disease prevention and control and disease-resistant breeding, and particularly relates to application of a tocopherol methyltransferase VTE4 gene in the prevention and control of tomato chlorosis virus. Background Art

[0002] Tomato chlorosis virus (ToCV) has occurred on a large scale and is increasing year by year, seriously threatening the safe and efficient production of important solanaceous vegetables such as tomatoes and peppers. However, there are no resistant / disease-tolerant varieties on the market, and there are no effective control agents and control methods. Therefore, it is urgent to explore a safe and effective control method for tomato chlorosis virus to ensure the safe production of solanaceous vegetables. Summary of the invention

[0003] The present invention aims to provide application of tocopherol methyltransferase VTE4 gene in the prevention and treatment of tomato chlorosis virus.

[0004] The replication and proliferation of plant viruses must rely on host factors. Therefore, identifying host factors involved in plant virus infection and growth can help those in this field to gain a deeper understanding of the virus's infection and pathogenic mechanisms, thereby providing molecular targets and theoretical basis for the prevention and control of viral diseases and disease-resistant breeding. The inventors used the method of immunoprecipitation combined with mass spectrometry (IP-MS) to screen host proteins that interact with p22 proteins based on ToCV p22 transgenic tobacco, and identified them as tocopherol methyltransferase (NbVTE4). The inventors found that silencing the NbVTE4 gene can lead to a significant increase in the accumulation level of ToCV, indicating that the NbVTE4 gene plays a role in resisting ToCV in Solanaceae vegetables. It is a dominant antiviral gene against ToCV encoded by the host Solanaceae crop, which can be used to prevent and control tomato chlorosis virus diseases caused by ToCV, and for molecular breeding of Solanaceae vegetables against ToCV.

[0005] The specific technical solutions of the present invention are as follows:

[0006] On one hand, the present invention provides an application of overexpressing a tocopherol methyltransferase VTE4 gene in controlling tomato chlorosis virus in plants. The nucleotide sequence of the tocopherol methyltransferase VTE4 gene is shown in SEQ ID NO.2, and the plant is a Solanaceae plant.

[0007] Furthermore, the Solanaceae plant is a plant of the genus Nicotiana or Solanum;

[0008] Preferably, the Solanaceae plant is tobacco or tomato.

[0009] Another aspect of the present invention provides the use of any one of a1) to a3) in at least one of the following 1) to 4):

[0010] a1) Tocopherol methyltransferase VTE4;

[0011] a2) biological material overexpressing tocopherol methyltransferase VTE4;

[0012] a3) an agent that targets and increases the expression of tocopherol methyltransferase VTE4;

[0013] 1) Prevent and control tomato chlorosis virus;

[0014] 2) preparing products for preventing and controlling tomato chlorosis virus in plants;

[0015] 3) Cultivate new plant varieties resistant to tomato chlorosis virus;

[0016] 4) Preparation and cultivation of new varieties of plants resistant to tomato chlorosis virus;

[0017] The amino acid sequence of the tocopherol methyltransferase VTE4 is shown in SEQ ID NO.1, and the plant is a Solanaceae plant.

[0018] Furthermore, the biological material overexpressing tocopherol methyltransferase VTE4 in a2) is selected from at least one of the following b1) to b5):

[0019] b1) a nucleic acid molecule encoding tocopherol methyltransferase VTE4;

[0020] b2) an expression cassette containing the nucleic acid molecule described in b1);

[0021] b3) an expression vector containing the nucleic acid molecule described in b1);

[0022] b4) a recombinant microorganism containing the expression vector described in b3);

[0023] b5) A recombinant cell containing the expression vector described in b3).

[0024] Furthermore, the Solanaceae plant is a plant of the genus Nicotiana or Solanum;

[0025] Preferably, the Solanaceae plant is tobacco or tomato.

[0026] On the other hand, the present invention also provides a method for controlling tomato chlorosis virus in plants, the method comprising: transferring an overexpression vector containing a tocopherol methyltransferase VTE4 gene into a plant, wherein the nucleotide sequence of the tocopherol methyltransferase VTE4 gene is shown in SEQ ID NO.2, and the plant is a Solanaceae plant.

[0027] Furthermore, the Solanaceae plant is a plant of the genus Nicotiana or Solanum;

[0028] Preferably, the Solanaceae plant is tobacco or tomato.

[0029] Another aspect of the present invention provides use of a tocopherol methyltransferase VTE4 inhibitor in regulating plant resistance to tomato chlorosis virus. The amino acid sequence of the tocopherol methyltransferase VTE4 is shown in SEQ ID NO.1, and the plant is a Solanaceae plant.

[0030] Furthermore, the Solanaceae plant is a plant of the genus Nicotiana or Solanum;

[0031] Preferably, the Solanaceae plant is tobacco or tomato.

[0032] Furthermore, the tocopherol methyltransferase VTE4 inhibitor is a substance that reduces the expression level of tocopherol methyltransferase VTE4;

[0033] Preferably, the tocopherol methyltransferase VTE4 inhibitor is selected from at least one of shRNA, siRNA, dsRNA, miRNA, cDNA, and antisense RNA / DNA;

[0034] Preferably, the tocopherol methyltransferase VTE4 inhibitor is an RNA encoded by the nucleotide sequence shown at positions 763-1062 of SEQ ID NO.2 or an RNA encoded by the nucleotide sequence shown at positions 763-1065 of SEQ ID NO.2.

[0035] In the specific implementation process, the content or activity of NbVTE4 protein in plant cells is regulated by biotechnology methods including but not limited to using Ti plasmid, plant virus vector, direct DNA transformation, microinjection, electroporation, etc.

[0036] Compared with the prior art, the present invention has the following beneficial effects:

[0037] The present invention finds that NbVTE4 protein and its encoding gene play an important role in ToCV infection and proliferation, and is a dominant antiviral gene encoded by the host plant to resist ToCV, which can be used to prevent and treat the tomato chlorotic virus disease caused by ToCV, and can be used for molecular breeding of resistance / tolerance to ToCV, etc. The present invention can provide a basis for studying the role of plant proteins in virus infection, antiviral breeding and other fields, improve the level of antiviral research on Solanaceae vegetables, and ensure and promote the production safety of Solanaceae vegetables. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 Chlorotic symptoms on leaves of N. benthamiana plants with NbVTE4 gene silenced after inoculation with ToCV;

[0039] Figure 2The accumulation levels of NbVTE4 and ToCV in N. benthamiana plants with NbVTE4 gene silenced after inoculation with ToCV. DETAILED DESCRIPTION

[0040] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Unless otherwise specified, the examples are all based on conventional experimental conditions, such as Sambrook et al. Molecular Cloning Laboratory Manual (Sambrook J & Russell DW, Molecular Cloning: a Laboratory Manual, 2001), or the conditions recommended by the manufacturer's instructions.

[0041] The quantitative tests in the following examples were all repeated three times, and the results were averaged.

[0042] The biological materials used in the present invention are as follows:

[0043] Nicotiana benthamiana: see Goodin MM, Zaitlin D, Naidu RA, Lommel SA. 2008. Nicotianabenthamiana: its history and future as a model for plant-pathogeninteractions. Molecular Plant-Microbe Interactions 21:1015-1026.

[0044] Vector ToCV-BJ: See Zhao, R., Wang, N., Liu, S., Ling, K., Fan, Z., and Zhou, T. 2016. P22 of tomato chlorosis virus, an RNA silencing suppressor, is naturally expressed in the infected plant. ActaVirologica 60, 423-425.

[0045] Vector CA and βM2 see: Jia Q., Liu N., Xie K., Dai Y., Han S., Zhao X., Qian L., Wang Y., Zhao J., Gorovits R., Xie D., Hong Y., Liu Y. 2016CLCuMuBβC1 subvertsubiquitination by interacting with NbSKP1s to enhance geminivirus infection in Nicotiana benthamiana.PLoS Pathogens 12(6):e1005668.

[0046] Tomato chlorosis virus (ToCV) See: Zhao, R., Wang, N., Wang, R., Chen, H., Shi, Y., Fan, Z., and Zhou, T. 2014. Characterization and full genome sequence analysis of a Chinese isolate of tomato chlorosis virus. Actavirologica 58, 92-94.

[0047] Example 1: Discovery of NbVTE4 protein and its encoding gene

[0048] The inventors used the method of immunoprecipitation combined with mass spectrometry (IP-MS) to screen out a host protein that interacts with the p22 protein based on ToCVp22 transgenic tobacco, and identified it as tocopherol methyltransferase (NbVTE4). The amino acid sequence of tocopherol methyltransferase is shown in SEQ ID NO.1, and the nucleotide sequence encoding it is shown in SEQ ID NO.2.

[0049] The amino acid sequence of tocopherol methyltransferase SEQ ID NO.1:

[0050] MGSTCYSAYSIQSLNHTCPSSLIFTLHKPQLQQIHNIKETTTRSVRTCNSNTRTRRRMKGVAAMNGVSTPEVDVQKQQELKKGIAELYDESSGIWEDIWGDHMHHGFYEPQSSVSLSDHRAAQIRMIEEALRFASVSDDPAKKPRSIVDVGCGIGGSSRYLAKKYGATAQGITLSPVQAERAQALAAAQGLGDKASFQVADALNQPFPDGQFDLVWSMESGEHMPDKQKFVGELARVAAPGGTIILVTWCHRDLSPLEESLLPEENELLNKICKSFYLPAWCSTADYMKLLQSNSLRDIKAADWSENVAPFWPAVIKSALTWKGFTSILRSGWKTIKAALAMPLMIEGYKKGLIKFAIITCRKPE

[0051] Nucleotide sequence encoding tocopherol methyltransferase SEQ ID NO.2:

[0052] ATGGGCAGCACGTGCTATTCTGCTTATTCTATCCAATCACTTAACCACACGTGTCCCTCTTCCCTTATCTTCACTCTCCATAAACCCCAGTTGCAACAGATTCACAATATCAAAGAAACAACAACAAGAAGTGTTAGAACTTGTAATAGTAATACTAGAACAAGAAGAAGAATGAAAGGTGTTGCTGCAATGAATGGTGTCTCAACACCAGAAGTTGATGTACAGAAACAACAGGAGTTGAAAAAAGGAATAGCAGAATTATATGATGAGTCATCAGGGATTTGGGAAGATATTTGGGGTGACCATATGCATCATGGATTTTATGAACCTCAATCATCTGTTTCACTTTCTGATCATCGTGCTGCTCAGATCCGTATGATTGAAGAGGCTCTACGTTTTGCTTCTGTTTCTGATGATCCGGCAAAGAAACCAAGGTCCATAGTTGATGTTGGATGTGGGATAGGAGGCAGTTCTAGGTACCTTGCAAAGAAATATGGCGCTACAGCTCAAGGCATCACGTTGAGTCCTGTACAAGCCGAGAGGGCTCAAGCTCTTGCTGCTGCTCAAGGATTAGGCGATAAGGCTTCTTTTCAAGTTGCAGACGCCTTGAATCAGCCATTTCCAGATGGGCAATTTGACTTGGTTTGGTCCATGGAGAGTGGAGAACACATGCCGGACAAACAAAAGTTTGTTGGCGAATTAGCTCGAGTGGCTGCACCAGGAGGCACAATCATACTTGTGACATGGTGCCACAGGGATCTTTCCCCTTTAGAGGAATCTCTGCTTCCAGAGGAGAATGAGTTGTTAAATAAGATATGTAAATCCTTCTATCTTCCTGCATGGTGTTCCACTGCTGATTATATGAAGTTACTTCAATCTAACTCTCTTCGGGATATCAAGGCAGCAGATTGGTCTGAGAATGTCGCTCCATTTTGGCCAGCAGTTATAAAATCTGCACTGACATGGAAGGGATTCACATCAATCCTGCGCAGTGGATGGAAGACAATCAAAGCTGCACTTGCAATGCCACTGATGATTGAAGGATACAAGAAGGGTCTGATCAAATTTGCTATCATCACATGTCGTAAAACCTGAATAA

[0053] Example 2: Construction of recombinant plasmid βM2-NbVTE4

[0054] The construction of the recombinant plasmid βM2-NbVTE4 includes the following steps:

[0055] 1) Total RNA was extracted from Nicotiana benthamiana and reverse transcribed into cDNA.

[0056] 2) Using the cDNA obtained in step 1) as a template and βM2-NbVTE4-F and βM2-NbVTE4-R as a primer pair, PCR amplification is performed to obtain a PCR amplification product of the NbVTE4 coding region gene fragment; and the PCR amplification product of the NbVTE4 gene fragment is recovered.

[0057] βM2-NbVTE4-F SEQ ID NO.3:

[0058] 5'-AGCAGATGGATCTGGCCGCCTCCCCTTTAGAGGAATCTCTG-3'

[0059] βM2-NbVTE4-R SEQ ID NO.4:

[0060] 5'-GGTTTGTGTTTGTTATCTAGAGATCAGACCCTTCTTGTATCC-3'

[0061] 3) The PCR amplification product of step 2) is digested with restriction endonucleases Asc I and Xba I, and the digestion product is recovered.

[0062] 4) The vector βM2 was digested with restriction endonucleases Asc I and Xba I to recover the vector backbone.

[0063] 5) Connecting the enzyme digestion product of step 3) and the vector backbone of step 4) to obtain the recombinant plasmid βM2-NbVTE4.

[0064] The recombinant plasmid βM2-NbVTE4 was sequenced, and based on the sequencing results, the structure of the recombinant plasmid βM2-NbVTE4 was described as follows: a double-stranded DNA molecule shown in positions 763-1062 of SEQ ID NO.2 was inserted between the Asc I and Xba I restriction sites of the vector βM2.

[0065] Embodiment 3:

[0066] 1. Silencing the NbVTE4 gene in N. benthamiana plants using Agrobacterium infiltration

[0067] (1) The CA vector and the constructed recombinant plasmid βM2-NbVTE4 were transformed into Agrobacterium GV3101 competent cells respectively and cultured at 28°C for about 48 hours. A single colony on the LB plate was picked and inoculated into 3-4 mL of LB liquid medium (containing 50 μg / mL Kan and 50 μg / mL Rif) and cultured at 28°C and 180 rpm for 14-18 hours.

[0068] (3) Transfer 1 mL of the bacterial solution obtained in step (1) to 10 mL of LB liquid culture medium (containing 50 μg / mL Kan and 50 μg / mL Rif) at a ratio of 1:100 and culture at 28°C and 180 rpm for 10 to 12 h.

[0069] (4) Centrifuge at 4000 rpm for 10 min at room temperature to collect the cells, suspend the precipitate in 3 mL of infiltration buffer (10 mM MES, pH 5.7, 10 mM MgCl2, 200 μM acetosyringone), measure the concentration of the bacterial suspension with a spectrophotometer, and finally dilute the bacterial suspension to obtain the OD value. 600 =0.5.

[0070] (5) Mix equal volumes of the bacterial suspension carrying CA and the bacterial suspension carrying βM2-NbVTE4 and place them in the dark at room temperature for 2-3 hours. Use a 1 mL syringe to infiltrate the lower epidermis of Nicotiana benthamiana leaves (3-4 leaf stage).

[0071] (6) The infiltrated Nicotiana benthamiana was cultured in an artificial climate chamber under conditions of 16 h / 25°C light and 8 h / 20°C darkness for 5 days.

[0072] 2. ToCV-BJ inoculation of Nicotiana benthamiana plants

[0073] (1) Streak the Agrobacterium strains carrying ToCV-BJRNA1 and ToCV-BJRNA2 stored at -80°C on LB plates (containing 50 μg / mL Kan, 50 μg / mL Rif) and culture at 28°C for about 48 h. Pick a single colony on the LB plate and inoculate it into 3-4 mL of LB liquid medium (containing 50 μg / mL Kan, 50 μg / mL Rif) and culture it at 28°C, 180 rpm for 14-18 h.

[0074] (2) Transfer 100 μL of the bacterial solution obtained in step (1) to 10 mL of LB liquid culture medium (containing 50 μg / mL Kan and 50 μg / mL R Fif) at a ratio of 1:100 and culture at 28°C, 180 rpm for 10 to 12 h.

[0075] (3) At room temperature, centrifuge at 4000 rpm for 10 min to collect the cells, suspend the precipitate in 3 mL of infiltration buffer (10 mM MES, pH 5.7, 10 mM MgCl2, 200 μM acetosyringone), measure the concentration of the bacterial suspension with a spectrophotometer, and finally dilute the bacterial suspension to obtain the OD value. 600 =0.5.

[0076] (4) Mix equal volumes of bacterial suspensions carrying ToCV-BJ RNA1 and ToCV-BJ RNA2 and place at room temperature for 2-3 hours. Use a 1 mL syringe to infiltrate the lower epidermis of Nicotiana benthamiana leaves 5 days after inoculation with CA+βM2-NbVTE4 obtained in step 1 and inject the petiole.

[0077] (5) The infiltrated Nicotiana benthamiana was cultured in an artificial climate chamber under conditions of 16 h / 25°C light and 8 h / 20°C darkness for 21 days.

[0078] 3. Detection of the accumulation levels of NbVTE4 and ToCV in N. benthamiana plants

[0079] The disease situation of the upper systemic leaves of N. benthamiana after inoculation with ToCV was continuously observed. On the 21st day after ToCV inoculation, the systemically infected leaves were taken, and the total RNA was extracted and reverse transcribed into cDNA. Using cDNA as a template and the Kangwei Century Fluorescence Quantitative PCR Kit, the Actin gene was used as an internal reference gene, and RT-qPCR was used to identify the relative expression level of the NbVTE4 gene and the content of ToCV genomic RNA. At the same time, the total protein of N. benthamiana leaves was extracted to detect the accumulation of ToCVCP protein.

[0080] The primer pairs used to identify the NbVTE4 gene are as follows:

[0081] NbVTE4-qRT-F (SEQ ID NO.5): 5'-GCACCAGGAGGCACAATCATACT-3'

[0082] Nb VTE4-qRT-R(SEQ ID NO.6):5'-GGAGCGACATTCTCAGACCAATCT-3'

[0083] The primer pairs used to identify the Actin gene are as follows:

[0084] NbActin-qRT-F (SEQ ID NO.7): 5'-TGCATTCTCCGTCTTGACT-3'

[0085] NbActin-qRT-R (SEQ ID NO.8): 5'-TGCAGTCTCGAGTTCCTGTT-3'

[0086] The primer pairs used to identify ToCV RNA1 are as follows:

[0087] ToCV-RNA1-qRT-F (SEQ ID NO.9): 5'-AGACACGGACTGCCTTAT-3'

[0088] ToCV-RNA1-qRT-R (SEQ ID NO.10): 5'-CACAACTCAAGATACACTCTG-3'

[0089] The primer pairs used to identify ToCV RNA2 are as follows:

[0090] ToCV-RNA2-qRT-F (SEQ ID NO.11): 5'-TAGATGATGGCGTAGATGAC-3'

[0091] ToCV-RNA2-qRT-R (SEQ ID NO.12): 5'-CTAGTGGAGTGTACCTTCAAT-3'

[0092] The obtained data were analyzed using the 2-ΔΔCT method, with the following steps:

[0093] First, the C of the reference gene (ref) was used to compare the experimental group samples (test) and the control group samples (calibrator). T The C value of the target gene is normalized T value:

[0094] ΔC T(test) =C T(target,test) -C T(ref,test)

[0095] ΔC T(calibrator) =C T(target,calibrator) -C T(ref,calibrator)

[0096] Secondly, the △CT value of the control group samples was normalized to the △C T value:

[0097] ΔΔC T =ΔC T(test) -ΔC T(calibrator)

[0098] Finally, the expression level ratio is calculated: 2 -ΔΔCT = expression ratio

[0099] The results showed that on the 21st day after ToCV inoculation, the chlorosis symptoms on the leaves of N. benthamiana systemically infected with the NbVTE4 gene silenced experimental group (βM2-NbVTE4) were more severe than those in the control group (βM2-GFP). Figure 1 Compared with the control group, the expression level of NbVTE4 in the plants with NbVTE4 gene silenced was reduced to about 0.5 times. Figure 2 (A); The accumulation of ToCV genomic RNA1 and RNA2 increased to about 3 times and 2.5 times, respectively. Figure 2 (B).

[0100] Western blot analysis was performed using ToCV CP antiserum as the primary antibody and HRP-labeled goat anti-rabbit antibody as the secondary antibody. The results showed that compared with the control group, the accumulation of ToCVCP in N. benthamiana plants with NbVTE4 gene silenced increased by about 1.8 times. Figure 2 (C, D).

[0101] The above research results show that by silencing the NbVTE4 gene of N. benthamiana, the chlorosis symptoms caused by ToCV on the leaves of N. benthamiana were enhanced, and the levels of ToCV genomic RNA and CP protein were significantly increased. These results show that the NbVTE4 protein and its encoding gene play an important role in the replication and proliferation of ToCV, and are dominant host antiviral genes against ToCV, and can be used for molecular breeding against ToCV. Since the NbVTE4 gene of N. benthamiana is highly conserved with VTE4 in Solanaceae economic crops such as tomatoes, the present invention can also be used in dicotyledonous host plants of Solanaceae such as tomatoes.

[0102] Although the present invention has been described in detail above with general descriptions and specific embodiments, it is obvious to those skilled in the art that some modifications or improvements can be made based on the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention.

Claims

1. Application of overexpression of tocopherol methyltransferase VTE4 gene in the prevention and treatment of tomato chlorosis virus in plants, characterized in that: The nucleotide sequence of the tocopherol methyltransferase VTE4 gene is shown in SEQ ID NO.2, and the plant is a Solanaceae plant.

2. The use according to claim 1, characterized in that: The Solanaceae plant is a plant of the genus Nicotiana or Solanum; Preferably, the Solanaceae plant is tobacco or tomato.

3. Application of any one of a1) to a3) in at least one of the following 1) to 4): a1) Tocopherol methyltransferase VTE4; a2) biological material overexpressing tocopherol methyltransferase VTE4; a3) an agent that targets and increases the expression of tocopherol methyltransferase VTE4; 1) Prevent and control tomato chlorosis virus; 2) preparing products for preventing and controlling tomato chlorosis virus in plants; 3) Cultivate new plant varieties resistant to tomato chlorosis virus; 4) Preparation and cultivation of new varieties of plants resistant to tomato chlorosis virus; in, The amino acid sequence of the tocopherol methyltransferase VTE4 is shown in SEQ ID NO.1, and the plant is a plant of the Solanaceae family.

4. The use according to claim 3, characterized in that: The biological material overexpressing tocopherol methyltransferase VTE4 in a2) is selected from at least one of the following b1) to b5): b1) a nucleic acid molecule encoding tocopherol methyltransferase VTE4; b2) an expression cassette containing the nucleic acid molecule described in b1); b3) an expression vector containing the nucleic acid molecule described in b1); b4) a recombinant microorganism containing the expression vector described in b3); b5) A recombinant cell containing the expression vector described in b3).

5. The use according to claim 3, characterized in that: The Solanaceae plant is a plant of the genus Nicotiana or Solanum; Preferably, the Solanaceae plant is tobacco or tomato.

6. A method for preventing and controlling tomato chlorotic virus in plants, characterized in that: The method comprises: transferring an overexpression vector containing a tocopherol methyltransferase VTE4 gene into a plant, wherein the nucleotide sequence of the tocopherol methyltransferase VTE4 gene is shown in SEQ ID NO.2, and the plant is a Solanaceae plant.

7. The method according to claim 6, characterized in that The Solanaceae plant is a plant of the genus Nicotiana or Solanum; Preferably, the Solanaceae plant is tobacco or tomato.

8. Use of a tocopherol methyltransferase VTE4 inhibitor in regulating plant resistance to tomato chlorosis virus, characterized in that: The amino acid sequence of the tocopherol methyltransferase VTE4 is shown in SEQ ID NO.1, and the plant is a plant of the Solanaceae family.

9. The use according to claim 8, characterized in that: The Solanaceae plant is a plant of the genus Nicotiana or Solanum; Preferably, the Solanaceae plant is tobacco or tomato.

10. The use according to claim 8, characterized in that: The tocopherol methyltransferase VTE4 inhibitor is a substance that reduces the expression level of tocopherol methyltransferase VTE4; Preferably, the tocopherol methyltransferase VTE4 inhibitor is selected from at least one of shRNA, siRNA, dsRNA, miRNA, cDNA, and antisense RNA / DNA; Preferably, the tocopherol methyltransferase VTE4 inhibitor is an RNA encoded by the nucleotide sequence shown at positions 763-1062 of SEQ ID NO.2 or an RNA encoded by the nucleotide sequence shown at positions 763-1065 of SEQ ID NO.2.

Images