Method for sequencing nucleic acid molecules

Abstract

The invention belongs to the technical field of gene sequencing, and particularly relates to a sequencing method of nucleic acid molecules, which comprises the following steps: determining the nucleotide type of a to-be-detected site of a sequencing template through two non-covalent binding reactions, and pairing the to-be-detected site with nucleotides through a covalent extension reaction to obtain the nucleic acid molecules. The types of the polymerase of the two non-covalent binding reactions are different from the types of the polymerase of the covalent extension reaction. Compared with a traditional sequencing method, the method has higher accuracy.

Description

Technical Field

[0001] The present application relates to the field of gene sequencing, and in particular to a method for sequencing nucleic acid molecules. Background Art

[0002] Next-generation sequencing includes Illumina's synthetic sequencing, Roche's pyrophosphate sequencing, Solid's ligase sequencing, and PacBio's combined sequencing. PacBio's combined sequencing determines the identity of the next correct nucleotide in the sequence by monitoring the interaction between nucleotides, polymerases, and template nucleic acids under different conditions without forming a phosphodiester bond.

[0003] Traditional binding sequencing (e.g. CN116287167A) uses the same polymerase to perform two biochemical reactions: one-step non-covalent binding and one-step covalent extension. Non-covalent binding of nucleotides is used to detect and determine the identity of the next nucleotide in the sequence; covalent extension of nucleotides is used to detect the identity of the next round of nucleotides. Regulating the activity of polymerases by polymerase inhibitors, non-catalytic metal ions that inhibit polymerization, etc. can make them bind but not extend dNTPs, that is, in a conformation that does not catalyze the formation of phosphodiester bonds. The accuracy of traditional sequencing methods needs to be improved.

[0004] In view of this, this application is hereby filed. Summary of the invention

[0005] Based on this, one or more embodiments of the present application provide a method for sequencing a nucleic acid molecule, including the following technical solutions:

[0006] One or more embodiments of the present application provide a method for sequencing a nucleic acid molecule, the sequencing method comprising the following steps:

[0007] A first round of binding reaction is performed with the nucleotides in the first group of nucleotides that match the sites to be tested in the sequencing template, the sequencing template, the sequencing primer, the first nucleic acid polymerase and the first non-catalytic competitive metal ion to prepare a first non-covalent five-membered complex; the first group of nucleotides includes a first dATP or an analog thereof, a first dTTP or an analog thereof, a first dCTP or an analog thereof and a first dGTP or an analog thereof, and each nucleotide or its analogue has a preset identifier independently; the preset identifier corresponding to the first non-covalent five-membered complex is detected to obtain first identifier information;

[0008] The first non-covalent five-membered complex is broken up, the sequencing template and the sequencing primer are retained, and a second round of binding reaction is performed with a nucleotide in the second group of nucleotides that matches the sequencing template to be tested site, a second nucleic acid polymerase, and a second non-catalytic competitive metal ion to prepare a second non-covalent five-membered complex; the second group of nucleotides includes a second dATP or an analog thereof, a second dTTP or an analog thereof, a second dCTP or an analog thereof, and a second dGTP or an analog thereof, and each nucleotide or its analogue independently has a preset identifier; the preset identifier corresponding to the second non-covalent five-membered complex is detected to obtain second identifier information;

[0009] Combining the first identification information and the second identification information in binary form, and clarifying the type of the nucleotide corresponding to the position to be tested of the sequencing template according to the obtained combination information, thereby determining the type of the nucleotide at the position to be tested;

[0010] The di-non-covalent five-membered complex is broken up, the sequencing template and the sequencing primer are retained, and a covalent extension reaction is performed with a third group of nucleotides, a third nucleic acid polymerase and a catalytic competitive metal ion, wherein each nucleotide in the third group of nucleotides or an analog thereof has a reversible terminator structure;

[0011] After the covalent extension reaction is completed, the reversible terminator structure paired with the nucleotide at the site to be tested is removed, and the next site is tested using the same method as that used to detect the site to be tested;

[0012] The first nucleic acid polymerase and the second nucleic acid polymerase are of different types from the third nucleic acid polymerase.

[0013] In some embodiments of the present application, the first nucleic acid polymerase and the second nucleic acid polymerase are of the same type.

[0014] In some embodiments of the present application, the preset identification includes a mark and a non-mark;

[0015] Optionally, the label includes one or more of a fluorescent label, a chemiluminescent label, a bioluminescent label, an electrochemiluminescent label, an electrical signal label and a magnetic signal;

[0016] Further optionally, the fluorescent label is selected from one or more of AF532, ATTO532, Cy3B, Cy3, Cy5, ATTO647N, ATTO647 and AF647.

[0017] In some implementations of the present application, the preset identifier is a mark, and the identification information is recorded as 1; the preset identifier is a non-mark, and the identification information is recorded as 0, with 1 and 0 being combined in binary.

[0018] In some embodiments of the present application, in the first group of nucleotides, the preset identifiers of the first dATP or its analogue and the first dCTP or its analogue are labeled, and the preset identifiers of the first dTTP or its analogue and the first dGTP or its analogue are non-labeled.

[0019] In some embodiments of the present application, in the second group of nucleotides, the preset identifiers of the second dATP or its analogue and the second dTTP or its analogue are labeled, and the preset identifiers of the second dCTP or its analogue and the second dGTP or its analogue are non-labeled.

[0020] In some embodiments of the present application, each nucleotide in the third group of nucleotides or its analogue does not have the label.

[0021] In some embodiments of the present application, each nucleotide in the third group of nucleotides or its analogue has a reversible terminator structure independently selected from one of 3'-benzyl azide, 3'-R-SS- and 3'-NH2-O-.

[0022] In some embodiments of the present application, the first non-catalytic competing metal ion and the second non-catalytic competing metal ion are each independently selected from one or more of calcium ions, strontium ions and barium ions.

[0023] In some embodiments of the present application, the catalytically competitive metal ion is a magnesium ion.

[0024] In some embodiments of the present application, the first nucleic acid polymerase, the second nucleic acid polymerase and the third nucleic acid polymerase are each independently selected from one or more of Taq DNA polymerase, KOD DNA polymerase, 9°N DNA polymerase and Klenow enzyme.

[0025] In some embodiments of the present application, the reagent for breaking up the first non-covalent five-membered complex includes a first ligand complexing the first non-catalytic competitive metal ion;

[0026] Optionally, the first ligand comprises one or more of EDTA, EGTA, NTA and HPTA;

[0027] Further optionally, the reagent for breaking up the first non-covalent five-membered complex comprises guanidine thiocyanate, sodium citrate and EDTA;

[0028] Further optionally, the reagent for breaking up the first non-covalent five-membered complex comprises water, 3.5M to 4.5M guanidine thiocyanate, 40mM to 45mM sodium citrate and 8mM to 12mM EDTA, with a pH value of 7.5 to 8.5.

[0029] In some embodiments of the present application, the reagent for breaking up the second non-covalent five-membered complex includes a second ligand complexing the second catalytic competitive metal ion;

[0030] Optionally, the second ligand comprises one or more of EDTA, EGTA, NTA and HPTA;

[0031] Further optionally, the reagent for breaking up the second non-covalent five-membered complex comprises guanidine thiocyanate, sodium citrate and EDTA;

[0032] Further optionally, the reagent for breaking up the second non-covalent five-membered complex comprises water, 3.5M to 4.5M guanidine thiocyanate, 40mM to 45mM sodium citrate and 8mM to 12mM EDTA, with a pH value of 7.5 to 8.5.

[0033] The details of one or more embodiments of the present application are set forth in the description below, and other features, objects, and advantages of the present application will be apparent from the description and its claims. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] In order to more clearly illustrate the technical solutions in the embodiments of the present application and to more completely understand the present application and its beneficial effects, the following is a brief introduction to the drawings required for the description of the embodiments. Obviously, the drawings described below are only some embodiments of the present application, and those skilled in the art can obtain other drawings based on these drawings without creative work.

[0035] Figure 1 This is a schematic diagram of the principle of single-color scarless sequencing;

[0036] Figure 2 Schematic diagram of the structure of a non-covalent five-membered complex. DETAILED DESCRIPTION

[0037] The present application will be further described in detail below in conjunction with the accompanying drawings, embodiments and examples. It should be understood that these embodiments and examples are only used to illustrate the present application and are not used to limit the scope of the present application. The purpose of providing these embodiments and examples is to make the understanding of the disclosure of the present application more thorough and comprehensive. It should also be understood that the present application can be implemented in many different forms, is not limited to the embodiments and examples described herein, and those skilled in the art can make various changes or modifications without violating the connotation of the present application, and the equivalent form obtained also falls within the protection scope of the present application. In addition, in the description below, a large number of specific details are given in order to provide a more comprehensive understanding of the present application, and it should be understood that the present application can be implemented without one or more of these details.

[0038] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art to which this application belongs. The terms used herein in the specification of this application are only for the purpose of describing implementation modes and embodiments and are not intended to limit this application.

[0039] the term

[0040] Unless otherwise specified or incompatible herewith, the terms and phrases used herein shall have the following meanings:

[0041] The terms "and / or", "or / and", and "and / or" used in this article include any one of two or more related listed items, and also include any and all combinations of related listed items, and the arbitrary and all combinations include any two related listed items, any more related listed items, or a combination of all related listed items. It should be noted that when at least three items are connected by at least two conjunctions selected from "and / or", "or / and", and "and / or", it should be understood that in this application, the technical solution undoubtedly includes technical solutions that are all connected by "logical and", and undoubtedly includes technical solutions that are all connected by "logical or". For example, "A and / or B" includes three parallel solutions of A, B and A+B. For example, the technical solution of "A, and / or, B, and / or, C, and / or, D" includes any one of A, B, C, and D (that is, the technical solution that is all connected by "logical OR"), and also includes any and all combinations of A, B, C, and D, that is, the combination of any two or any three of A, B, C, and D, and also includes the combination of four of A, B, C, and D (that is, the technical solution that is all connected by "logical AND").

[0042] In the present application, "plurality", "multiple", "multiple times", "multiples", etc., unless otherwise specified, refer to a number greater than 2 or equal to 2. For example, "one or more" means one or greater than or equal to two.

[0043] As used herein, "combination thereof", "any combination thereof", "any combination thereof" etc. include all suitable combinations of any two or more of the listed items.

[0044] Herein, the “suitable” mentioned in “suitable combination”, “suitable method”, “any suitable method”, etc., shall be based on the ability to implement the technical solution of this application, solve the technical problems of this application, and achieve the expected technical effects of this application.

[0045] Herein, “preferred”, “better”, “more preferred” and “suitable” are merely used to describe implementation methods or examples with better effects, and it should be understood that they do not constitute limitations on the scope of protection of this application.

[0046] In the present application, "further", "further", "particularly" and the like are used for descriptive purposes to indicate differences in content, but should not be construed as limiting the scope of protection of the present application.

[0047] In this application, "optionally", "optional", and "optional" mean optional or dispensable, that is, any one of the two parallel schemes of "yes" or "no". If multiple "options" appear in a technical solution, unless otherwise specified and there is no contradiction or mutual restriction, each "optional" is independent.

[0048] In the present application, the terms "first", "second", "third", "fourth", etc. in "the first aspect", "the second aspect", "the third aspect", "the fourth aspect", etc. are used only for descriptive purposes and cannot be understood as indicating or implying relative importance or quantity, nor can they be understood as implicitly indicating the importance or quantity of the indicated technical features. Moreover, "first", "second", "third", "fourth", etc. only serve the purpose of non-exhaustive enumeration and description, and it should be understood that they do not constitute a closed limitation on quantity.

[0049] In the present application, the technical features described in an open manner include closed technical solutions composed of the listed features, and also include open technical solutions containing the listed features.

[0050] In the present application, when it comes to numerical intervals (i.e., numerical ranges), unless otherwise specified, the optional numerical distribution is considered continuous within the above numerical interval, and includes the two numerical endpoints (i.e., the minimum and maximum values) of the numerical range, and each numerical value between the two numerical endpoints. Unless otherwise specified, when the numerical interval only refers to the integers within the numerical interval, it includes the two endpoint integers of the numerical range, and each integer between the two endpoints. In this article, it is equivalent to directly listing each integer, such as t is an integer selected from 1 to 10, indicating that t is any integer selected from the group of integers consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10. In addition, when multiple ranges are provided to describe features or characteristics, these ranges can be combined. In other words, unless otherwise specified, the ranges disclosed herein should be understood to include any and all subranges included therein.

[0051] The temperature parameters in this application, unless otherwise specified, are allowed to be either constant temperature treatment or to vary within a certain temperature range. It should be understood that the constant temperature treatment allows the temperature to fluctuate within the accuracy range controlled by the instrument. Fluctuations within the range of ±5°C, ±4°C, ±3°C, ±2°C, and ±1°C are allowed.

[0052] In the present application, % (w / w) and wt% both represent weight percentage, % (v / v) refers to volume percentage, and % (w / v) refers to mass volume percentage.

[0053] All documents mentioned in this application are cited as references in this application, just as each document is cited as reference separately. Unless they conflict with the application purpose and / or technical solution of this application, the cited documents involved in this application are cited with all contents and all purposes. When the cited documents are involved in this application, the definitions of relevant technical features, terms, nouns, phrases, etc. in the cited documents are also cited. When the cited documents are involved in this application, the examples and preferred methods of the cited relevant technical features can also be incorporated into this application as references, but are limited to the implementation of this application. It should be understood that when the cited content conflicts with the description in this application, the present application shall prevail or be modified adaptively according to the description of this application.

[0054] The gene sequencing method (iSBBSS: integrated Sequencing by Binary Basecalling and Scarless synthesis) described in the patent application document CN116287167A is referred to as the dynamic five-member complex sequencing method. The sequencing process is divided into template chain base recognition and sequencing chain extension. In the base recognition process, a polymerase can use fluorescently labeled or unlabeled bases to form a dynamic five-member complex for base-specific pairing. After monochromatic laser excitation, a high-resolution imaging system is used to collect the light signal, and then the fluorescent signal is converted into '1' and the dark signal is converted into '0' for digital recognition. Through the formation of two rounds of five-member complexes, the four bases are recognized by the monochrome fluorescence luminescence technology. The base added to the sequencing chain during the extension process is a reversible terminator base that has not been modified by any fluorescent group, and can achieve damage-free (scarless sequencing). This cycle is repeated to complete the sequence determination of the sequencing chain. In some sequencing schemes, two-color or four-color fluorescent labeled nucleotides may be used for base recognition combined with sequencing. In some extended sequencing schemes, after extension and detection using bases with fluorescent groups, a round of extension of nucleotides without fluorescent groups will be performed to fill in the gaps, considering that the polymerase may not extend the nucleotides with fluorescent groups sufficiently, to ensure sequencing synchronization and reduce chain lag (phasing) during sequencing. There are differences in polymerases when extending nucleotides with / without fluorescent groups, and there may also be differences in polymerases when binding to nucleotides with fluorescent groups and extending nucleotides without fluorescent groups. Therefore, the combination of a polymerase with stronger binding ability and a polymerase with stronger extension ability may have better sequencing performance in combined sequencing. Similarly, polymerases with strong extension ability are screened for nucleotides with fluorescent groups and nucleotides without fluorescent groups, respectively. Such a combined polymerase scheme may obtain better results in extended sequencing.

[0055] The present invention provides a method for sequencing a nucleic acid molecule, the method comprising the following steps:

[0056] A first round of binding reaction is performed with the nucleotides in the first group of nucleotides that match the sites to be tested in the sequencing template, the sequencing template, the sequencing primer, the first nucleic acid polymerase and the first non-catalytic competitive metal ion to prepare a first non-covalent five-membered complex; the first group of nucleotides includes a first dATP or an analog thereof, a first dTTP or an analog thereof, a first dCTP or an analog thereof and a first dGTP or an analog thereof, and each nucleotide or its analogue has a preset identifier independently; the preset identifier corresponding to the first non-covalent five-membered complex is detected to obtain first identifier information;

[0057] The first non-covalent five-membered complex is broken up, the sequencing template and the sequencing primer are retained, and a second round of binding reaction is performed with a nucleotide in the second group of nucleotides that matches the sequencing template to be tested site, a second nucleic acid polymerase, and a second non-catalytic competitive metal ion to prepare a second non-covalent five-membered complex; the second group of nucleotides includes a second dATP or an analog thereof, a second dTTP or an analog thereof, a second dCTP or an analog thereof, and a second dGTP or an analog thereof, and each nucleotide or its analogue independently has a preset identifier; the preset identifier corresponding to the second non-covalent five-membered complex is detected to obtain second identifier information;

[0058] Combining the first identification information and the second identification information in binary form, and clarifying the type of the nucleotide corresponding to the position to be tested of the sequencing template according to the obtained combination information, thereby determining the type of the nucleotide at the position to be tested;

[0059] The di-non-covalent five-membered complex is broken up, the sequencing template and the sequencing primer are retained, and a covalent extension reaction is performed with a third group of nucleotides, a third nucleic acid polymerase and a catalytic competitive metal ion, wherein each nucleotide in the third group of nucleotides or an analog thereof has a reversible terminator structure;

[0060] After the covalent extension reaction is completed, the reversible terminator structure paired with the nucleotide at the site to be tested is removed, and the next site is tested using the same method as that used to detect the site to be tested;

[0061] The first nucleic acid polymerase and the second nucleic acid polymerase are of different types from the third nucleic acid polymerase.

[0062] In some embodiments of the present application, the first nucleic acid polymerase and the second nucleic acid polymerase are of the same type.

[0063] In some embodiments of the present application, the preset identification includes a mark and a non-mark;

[0064] Optionally, the label includes one or more of a fluorescent label, a chemiluminescent label, a bioluminescent label, an electrochemiluminescent label, an electrical signal label and a magnetic signal;

[0065] Further optionally, the fluorescent label is selected from one or more of AF532, ATTO532, Cy3B, Cy3, Cy5, ATTO647N, ATTO647 and AF647.

[0066] In some implementations of the present application, the preset identifier is a mark, and the identification information is recorded as 1; the preset identifier is a non-mark, and the identification information is recorded as 0, with 1 and 0 being combined in binary.

[0067] In some embodiments of the present application, in the first group of nucleotides, the preset identifiers of the first dATP or its analogue and the first dCTP or its analogue are labeled, and the preset identifiers of the first dTTP or its analogue and the first dGTP or its analogue are non-labeled.

[0068] In some embodiments of the present application, in the second group of nucleotides, the preset identifiers of the second dATP or its analogue and the second dTTP or its analogue are labeled, and the preset identifiers of the second dCTP or its analogue and the second dGTP or its analogue are non-labeled.

[0069] In some embodiments of the present application, each nucleotide in the third group of nucleotides or its analogue does not have the label.

[0070] In some embodiments of the present application, each nucleotide in the third group of nucleotides or its analogue has a reversible terminator structure independently selected from one of 3'-benzyl azide, 3'-R-SS- and 3'-NH2-O-.

[0071] In some embodiments of the present application, the first non-catalytic competing metal ion and the second non-catalytic competing metal ion are each independently selected from one or more of calcium ions, strontium ions and barium ions.

[0072] In some embodiments of the present application, the catalytically competitive metal ion is a magnesium ion.

[0073] In some embodiments of the present application, the first nucleic acid polymerase, the second nucleic acid polymerase and the third nucleic acid polymerase are each independently selected from one or more of Taq DNA polymerase, KOD DNA polymerase, 9°N DNA polymerase and Klenow enzyme.

[0074] In some embodiments of the present application, the reagent for breaking up the first non-covalent five-membered complex includes a first ligand complexing the first non-catalytic competitive metal ion;

[0075] Optionally, the first ligand comprises one or more of EDTA, EGTA, NTA and HPTA;

[0076] Further optionally, the reagent for breaking up the first non-covalent five-membered complex comprises guanidine thiocyanate, sodium citrate and EDTA;

[0077] Further optionally, the reagent for breaking up the first non-covalent five-membered complex comprises water and 3.5M to 4.5M (for example, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5M) guanidine thiocyanate, 40mM to 45mM (for example, 40, 41, 42, 43, 44, 45mM) sodium citrate and 8mM to 12mM (for example, 8, 8.5, 9, 9.5, 10, 10.5, 11, 11.5, 12mM) EDTA, and the pH value is 7.5 to 8.5 (for example, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5).

[0078] In some embodiments of the present application, the reagent for breaking up the second non-covalent five-membered complex includes a second ligand complexing the second catalytic competitive metal ion;

[0079] Optionally, the second ligand comprises one or more of EDTA, EGTA, NTA and HPTA;

[0080] Further optionally, the reagent for breaking up the second non-covalent five-membered complex comprises guanidine thiocyanate, sodium citrate and EDTA;

[0081] Further optionally, the reagent for breaking up the second non-covalent five-membered complex comprises water and 3.5M to 4.5M (for example, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5M) guanidine thiocyanate, 40mM to 45mM (for example, 40, 41, 42, 43, 44, 45mM) sodium citrate and 8mM to 12mM (for example, 8, 8.5, 9, 9.5, 10, 10.5, 11, 11.5, 12mM) EDTA, and the pH value is 7.5 to 8.5 (for example, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5).

[0082] The embodiments of the present application will be described in detail below in conjunction with examples. It should be understood that these examples are only used to illustrate the present application and are not intended to limit the scope of the present application. The experimental methods for which specific conditions are not specified in the following examples are preferably referred to the guidance provided in the present application, and can also be based on the experimental manual or normal conditions in this area, can also be based on the conditions recommended by the manufacturer, or refer to experimental methods known in the art.

[0083] In the following specific embodiments, the measured parameters of raw material components may have slight deviations within the range of weighing accuracy unless otherwise specified. For temperature and time parameters, acceptable deviations caused by instrument test accuracy or operation accuracy are allowed.

[0084] Comparative Example 1: Sequencing scheme using the same enzyme for binding enzyme and extension enzyme

[0085] This comparative example provides a method for sequencing a nucleic acid molecule, involving the following contents:

[0086] The sequencing reaction was performed on the GenDow 500 sequencer developed by DaDao Sequencing, and the long-read length SE30 test was performed using the GenDow chip.

[0087] The double-stranded DNA library was denatured using 0.2 M NaOH solution, and the denaturation reaction was terminated using GHB diluent and the reaction product was diluted to a library concentration of 3.5 pM.

[0088] The library used in this comparative example is the E. coli whole genome library. The sequence of the sequencing primer used is as follows: 5'-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3' (SEQ ID NO. 1).

[0089] Combination Figure 1 , explain the sequencing process:

[0090] In the first step, after the first round of binding reaction, a paired base is introduced into the test site of the sequencing template chain to form the first non-covalent five-membered complex (polymerase, dNTP, calcium ion, sequencing template chain, sequencing primer, such as Figure 2 shown).

[0091] In the initial reaction solution of the first round of binding reaction, base A and base C carry the same fluorescent marker, base T and base G are not fluorescently labeled, and after monochromatic laser excitation, a high-resolution imaging system is used to collect the light signal, and the fluorescent signal is converted into "1" and the dark signal into "0" for digital identification. In the first round, A and C are identified as 1, and T and G are identified as 0. At this time, the 3' end of the sequencing primer is an extendable nucleotide (3'-OH). Since the initial reaction system contains non-catalytic metal ions (calcium ions), although the sequencing primer supports the extension reaction to introduce new nucleotides, new nucleotides cannot be introduced into the sequencing primer chain in this round of detection.

[0092] The initial reaction solution of the first round of binding reaction includes: 1μM dATP-AF532, 1μM dCTP-AF532, 2μM dTTP, 2μM dGTP, 0.007mg / mlL sequencing enzyme, and buffer. Among them, the initial reaction solution of the first round of binding reaction includes 50mM Tris, 50mM NaCl, 60mM (NH4)2SO4, 0.5mM CaCl2, 1M betaine, 50mM LiCl, 0.1mM EDTA, 0.05% Tween-20 and nuclease-free water, pH 7.5-8.8, temperature 50°C, reaction 10s.

[0093] In the second step, a disrupting buffer is used to destroy the first non-covalent five-membered complex to release the sites to be tested on the sequencing template chain. Disrupting buffer: 4M guanidine thiocyanate, 42mM sodium citrate, 10mM EDTA, sterile water, pH 8.0.

[0094] In the third step, after a second round of binding reaction, paired bases are introduced into the test site of the sequencing template chain to form a second five-membered complex (polymerase, dNTP, calcium ion, sequencing template chain, sequencing primer chain).

[0095] In the initial reaction solution of the second round of binding reaction, the A base and the T base have the same fluorescent label, and the C base and the G base are not fluorescently labeled. After monochromatic laser excitation, the light signal is collected by a high-resolution imaging system, and then the fluorescent signal is converted into 1 and the dark signal into 0 for digital identification. In the second round, A and T are converted into 1, and C and G are converted into 0.

[0096] The initial reaction solution for the second round of binding reaction includes: 1μM dATP-AF532, 1μM dTTP-AF532, 2μM dCTP, 2μM dGTP, 0.007mg / ml sequencing enzyme and buffer; wherein the buffer includes 50mM Tris, 50mM NaCl, 60mM (NH4)2SO4, 0.5mM CaCl2, 1M betaine, 50mM LiCl, 0.1mM EDTA, 0.05% Tween-20 and nuclease-free water, pH is 7.5-8.8, temperature is 50°C, and the reaction is carried out for 10s.

[0097] In the fourth step, the disrupting buffer destroys the second non-covalent five-membered complex and releases the sites to be tested on the sequencing template chain. The formula of the disrupting buffer is the same as that of the second step.

[0098] In the fifth step, after an extension reaction, unlabeled reversibly blocked nucleotides are introduced into the target site of the sequencing template chain by polymerase extension.

[0099] The initial reaction solution of the extension reaction includes: 2μM dATP-blocked, 2μM dTTP-blocked, 2μM dCTP-blocked, 2μM dGTP-blocked, 0.023mg / mL sequencing enzyme (with binding reaction) and buffer; wherein, the initial reaction solution of the extension reaction includes 50mM Tris, 50mM NaCl, 60mM (NH4)2SO4, 5mM MgSO4, 1mM EDTA, 0.05% Tween-20, 5% DMSO and nuclease-free water, pH 7.5-8.8, 60℃ reaction for 45s. "Blocked" refers to the blocking of the terminal azide group.

[0100] In the sixth step, a deblocking reagent is used to remove the blocking group of the nucleotide, and the next round of reaction is carried out by referring to the first to fifth steps above to realize the base recognition of the next site to be tested in the sequencing template chain.

[0101] Deblocking reagent: 50 mM Tris, 50 mM NaCl, 50 mM sodium ascorbyl palmitate, 50 mM THPP, 0.1% Tween-20, pH 9.0-9.4, 60°C, reaction time 20 seconds.

[0102] Table 1. Single-color fluorescence dynamic five-membered complex base recognition rules

[0103]

[0104] In both rounds of binding reaction photography, 1 is read as A base; in both rounds of photography, 0 is read as G base; 1 in the first round and 0 in the second round are read as C base; 0 in the first round and 1 in the second round are read as T base.

[0105] Sequenase is a DNA polymerase, and the DNA polymerase includes Klenow fragment, T4 polymerase, Bst polymerase, Taq polymerase, Vent polymerase, Deep Vent polymerase, Pfu polymerase, Tfl polymerase, 9°N polymerase and KOD polymerase, TaqGold, VENT (exo-), Pfu (exo-) and mutants or derivatives thereof. In this comparative example, 9°N polymerase mutant (sequenase 1) and KOD polymerase mutant (sequenase 2) among the above polymerases are selected for single enzyme binding and extension reaction as shown in Table 2 Sequenase combination, and SE30 sequencing is performed.

[0106] Table 2

[0107] Sequencing protocol Enzyme combination Binding enzyme Elongase Sequencing protocol 1 1 Sequenase 1 Sequenase 1 Sequencing protocol 2 2 Sequenase 2 Sequenase 2

[0108] Sequencer 1 is a 9°N DNA polymerase mutant (AAI) (DNA shown in SEQ ID NO.2 encodes the mutant). Anhui General Biotechnology Co., Ltd. was commissioned to perform full gene synthesis. In the gene synthesis service, pET28a(+) plasmid was used as a cloning vector. There were two His tags on the pET28a(+) vector. The gene sequence was inserted between the two His tags. A stop codon was carried at the end of the gene. The C-terminal His tag was not expressed, and only the N-terminal His tag was expressed. The recombinant plasmid E.coliBL21(DE3) was constructed, and the recombinant bacteria were obtained and the protein was expressed.

[0109] The sequence of SEQ ID NO.2 is as follows:

[0110] ATGATTCTCGATAACCGACTACATCACCGAGAACGGGAAGCCCGTGATAAGGGTCTTCAAGAAGGAGA

[0111] ACGGCGAGTTTAAAATCGAGTACGACAGAACCTTCGAGCCCTACTTCTACGCCCTTCTGAAGGACGAT

[0112] TCTGCGATAGAGGACGTCAAGAAGGTAACCGCAAAGAGGCACGGAACGGTTGTCAAGGTGAAGCGC

[0113] GCCGAGAAGGTGCAGAAGAAGTTCCTCGGCAGGCCGATAGAGGTCTGGAAGCTCTACTTCAACCATC

[0114] CTCAGGACGTCCCGGCGATTCGAGACAGGATACGCGCCCACCCCGCTGTCGTTGACATCTACGAGTAC

[0115] GACATACCCTTCGCCAAGCGCTACCTCATCGACAAGGGCCTGATTCCGATGGAGGGCGACGAGGAGC

[0116] TTACGATGCTCGCCTTCGCGATCGCAACGCTCTATCACGAGGGCGAGGAGTTCGGAACCGGGCCGATT

[0117] CTCATGATAAGCTACGCCGACGGGAGCGAGGCGAGGGTGATAACCTGGAAGAAGATTGACCTTCCGT

[0118] ACGTTGACGTCGTCTCGACCGAGAAGGAGATGATTAAGCGCTTCCTCCGCGTCGTCAGGGAGAAGGA

[0119] CCCCGACGTGCTCATCACCTACAACGGCGACAACTTCGACTTCGCCTACCTGAAGAAGCGCTGTGAG

[0120] GAACTCGGAATAAAGTTCACACTCGGCAGGGACGGGAGCGAGCCGAAGATACAGCGAATGGGCGAC

[0121] CGCTTTGCCGTTGAGGTGAAGGGCAGGATTCACTTCGACCTCTACCCCGTCATAAGGCGCACGATAAA

[0122] CCTCCCGACCTACACCCTTGAGGCCGTTTACGAGGCCGTCTTTGGAAAGCCCAAGGAGAAGGTTTAC

[0123] GCAGAGGAGATAGCGCAGGCCTGGGAGAGCGGGGAGGGCCTTGAAAGGGTTGCAAGATACTCGATG

[0124] GAGGACGCTAAGGTGACCTACGAGCTGGGAAGGGAGTTCTTCCCGATGGAGGCCCAGCTTTCGAGG

[0125] CTTATAGGCCAGAGCCTCTGGGACGTCTCGCGCTCGAGCACCGGAAATTTGGTGGAGTGGTTCCTCCT

[0126] GCGGAAGGCCTACAAGAGGAACGAGCTCGCCCCAAACAAGCCCGACGAGAGGGAGCTCGCGAGAC

[0127] GGCGCGGGGGCTACGCTGGCGGGTACGTTAAGGAACCAGAGCGGGGATTGTGGGACAACATTGTGTA

[0128] TTTAGACTTCCGCTCGGCGGCAATTAGCATCATCATAACCCACAACGTCTCGCCGGATACCCTCAACC

[0129] GCGAGGGCTGTAAAGAGTACGACGTCGCCCCTGAGGTTGGACACAAGTTCTGCAAGGACTTCCCCG

[0130] GCTTCATACCAAGCCTCCTGGGAGATTTGCTCGAGGAGAGGCAGAAGATAAAGCGGAAGATGAAGGC

[0131] AACGGTTGACCCGCTGGAGAAGAAACTCCTCGATTACAGGCAGAGGCTGATCAAAATCCTCGCCAAC

[0132] AGCTTCTACGGCTACTACGGCTACGCCAAGGCCCGGTGGTACTGCAAGGAGTGCGCCGAGAGCGTTA

[0133] CGGCCTGGGGAAGGGAGTATATAGAAATGGTTATCCGGGAACTCGAAGAAAAATTCGGTTTTAAAGTT

[0134] CTCTATGCCGATACAGACGGTCTCCATGCTACCATTCCCGGAGCAGACGCTGAAACAGTCAAGAAAA

[0135] AAGCAAAGGAGTTCTTAAAATACATTAATCCAAAACTGCCCGGCCTGCTCGAACTTGAGTACGAGGG

[0136] CTTCTACGTGAGGGGCTTCTTCGTCACGAAGAAGAAGTACGCTGTGATAGACGAGGAGGGCAAGATA

[0137] ACCACGAGGGGTCTTGAGATTGTGAGGCGCGACTGGAGCGAGATAGCGAAGGAGACCCAGGCCAGG

[0138] GTCTTAGAGGCGATACTCAAGCACGGTGACGTCGAGGAGGCCGTTAGGATAGTCAAGGAAGTGACGG

[0139] AAAAGCTGAGCAAGTATGAGGTCCCGCCCGAGAAGCTGGTAATCCACGAGCAGATAACGCGCGATTT

[0140] GAGGGATTACAAAGCCACCGGCCCGCACGTTGCCGTTGCGAAGAGGCTCGCGGCGCGTGGAGTGAA

[0141] AATCCGGCCCGGCACGGTGATAAGCTACATCGTCCTAAAGGGCTCTGGAAGGATAGGCGACAGGGCG

[0142] ATTCCAGCTGATGAGTTCGACCCGACGAAGCACCGCTACGATGCGGAATACTACATCGAGAACCAGG

[0143] TTCTCCCGGCGGTGGAGAGGATTCTAAAAGCCTTCGGCTATCGGAAGGAGGATTTGCGCTACCAGAA

[0144] GACGAAGCAGGTCGGCTTGGGCGCGTGGCTGAAGGTGAAGGGGAAGAAGTGA。

[0145] Sequenase 2 is a KOD DNA polymerase mutant (AIA)) (DNA shown in SEQ ID NO.3 encodes the mutant) and was commissioned to Anhui General Biotechnology Co., Ltd. for full gene synthesis. In the gene synthesis service, pET21a(+) plasmid was used as a cloning vector, which only expressed the C-terminal His tag, and the recombinant plasmid E.coli BL21(DE3) was constructed to obtain recombinant bacteria and express proteins.

[0146] SEQ ID NO.3 sequence:

[0147] TATGATCCTGGACACCGACTACATCACTGAAGATGGTAAACCGGTGATCCGCATTTTCAAAAAAGAAA

[0148] ACGGTGAATTTAAAATCGAATACGATCGTACCTTTGAACCGTACTTCTACGCGCTGCTGAAAGATGATA

[0149] GCGCGATTGAAGAAGTTAAGAAAATTACTGCTGAACGTCACGGCACCGTAGTTACCGTTAAACGCGT

[0150] GGAGAAAGTTCAGAAAAAAATTTCTGGGCCGTCCGGTTGAAGTTTGGAAACTGTACTTCACCCACCCG

[0151] CAAGATGTTCCGGCGATCCGTGACAAAATCCGTGAACACCCGGCGGTGATCGATATTTATGAATATGA

[0152] CATTCCGTTCGCGAAACGTTACCTGATCGATAAAGGTCTGGTCCCGATGGAAGGTGACGAAGAACTG

[0153] AAAATGCTGGCGTTCGCTATCGCTACCCTGTACCATGAAGGTGAAGAATTCGCTGAAGGCCCGATCCT

[0154] GATGATTTCCTACGCGGATGAAGAAGGTGCACGCGTGATTACCTGGAAAAACGTTGATCTGCCGTATG

[0155] TGGATGTGGTTTCTACGGAGCGTGAAATGATCAAACGTTTCCTGCGTGTTGTTAAAGAAAAAGACCC

[0156] GGATGTGCTGATCACCTACAACGGTGATAACTTCGACTTCGCGTACCTGAAAAAACGTTGCGAAAAA

[0157] CTGGGTATCAACTTCGCGCTGGGCCGTGATGGTTCTGAACCAAAAATCCAGCGTATGGGCGATCGCTT

[0158] CGCAGTCGAGGTTAAAGGTCGTATCCACTTCGACCTGTATCCGGTTATCCGCCGTACCATCAACCTGCC

[0159] GACCTACACCCTGGAAGCTGTTTATGAAGCTGTTTTCGGTCAGCCGAAAGAAAAAGTGTATGCAGAA

[0160] GAAATCACCACCGCGTGGGAAACCGGTGAGAACCTGGAGCGTGTGGCTCGTTACAGCATGGAAGAT

[0161] GCAAAAGTGACCTACGAACTGGGTAAAGAATTCCTGCCGATGGAAGCGCAGCTGAGTCGTCTGATCG

[0162] GCCAGAGCCTGTGGGACGTTTCTCGCTCTTCTACCGGCAACCTGGTTGAATGGTTTCTGCTGCGCAAA

[0163] GCGTACGAACGTAACGAACTGGCGCCGAATAAACCGGATGAAAAAGAACTGGCACGTCGTCGTCAG

[0164] TCCTATGAAGGCGGTTACGTGAAAGAACCGGAACGTGGCCTGTGGGAGAACATCGTTTACCTGGACT

[0165] TCCGTTCTATTGCGattTCCATCATCATCACCCACAACGTGAGTCCGGATACCCTGAACCGTGAAGGCTG

[0166] CAAAGAATACGATGTTGCGCCGCAGGTTGGTCACCGTTTCTGCAAAGATTTTCCGGGTTTCATCCCGT

[0167] CCCTGCTGGGTGACCTGCTGGAAGAACGTCAGAAAATCAAAAAGAAAATGAAAGCAACTATTGACC

[0168] CGATCGAACGTAAACTGCTGGACTACCGTCAGCGTCTGATTAAAATCCTGGCTAACTCCTACTACGGC

[0169] TATTACGGCTACGCCCGCGCCCGCTGGTATTGTAAAGAATGCGCGGAAAGCGTTACCGCGTGGGGCCG

[0170] TGAATACATCACCATGACCATCAAAGAAATTGAAGAAAAATACGGTTTCAAAGTGATTTACTCCGATA

[0171] CCGACGGCTTCTTCGCCACCATTCCGGGCGCAGATGCTGAAACCGTTAAGAAAAAAGCTATGGAATT

[0172] CCTGAAATACATCAACGCCAAACTGCCGGGCGCGCTGGAACTGGAATATGAAGGCTTCTATAAACGTG

[0173] GTTTCTTTGTGACTAAAAAGAAATACGCAGTGATCGATGAAGAAGGTAAAATCACCACGCGTGGCCT

[0174] GGAAATCGTGCGTCGTGACTGGAGCGAAATCGCTAAAGAGACCCAGGCACGCGTTCTGGAAGCTCTG

[0175] CTGAAAGACGGTGACGTGGAAAAAGCGGTCGCATCGTAAAAGAAGTGACCGAAAAACTGTCTAAA

[0176] TATGAAGTGCCGCCGGAAAAACTGGTGATCCACGAACAGATCACCCGTGATCTGAAAGACTACAAAG

[0177] CGACCGGTCCGCACGTTGCTGTCCGAAAACGCCTGGCTGCTCGTGGCGTTAAAATTCGTCCGGGCAC

[0178] CGTTATCTCTTACATCGTTCTGAAAGGTAGCGGTCGTATCGGTGACCGCGCTATCCCGTTTGATGAATT

[0179] CGATCCGACCAAACATAAATACGACGCAGAATACTACATCGAAAACCAGGTTCTGCCGGCGGTTGAA

[0180] CGCATCCTGCGCGCGTTCGGTTACCGTAAAGAAGATCTGCGTTACCAGAAAACCCGCCAGGTTGGCCTGTCCGCGTGGCTGAAACCGAAAGGCACCCATCATCATCACCACCACGAGGATCC.

[0181] As shown in Table 3 below, two groups of single enzymes were tested. When the same amount of enzyme was used for testing, the fluorescence signal (Int) of Sequenase 2 was higher. Table 4 shows the results of SE30 sequencing. The phasing and prephasing of Sequenase 1 were significantly higher than those of Sequenase 2, indicating that Sequenase 2 has better extension efficiency. The accuracy of Sequenase 2 is lower than that of Sequenase 1, indicating that the accuracy of the binding process of Sequenase 1 is higher.

[0182] Table 3

[0183] Single enzyme sequencing Int Sequenase 1 6888.47 Sequenase 2 7828.34

[0184] As shown in the table below, these are the sequencing results of two groups of single enzyme SE30

[0185] Table 4

[0186] Sequencing protocol 1 Sequencing solution 2 Phasing(%) 0.486 0.284 Prephasing(%) 0.501 0.205 MappingRate(%) 99.2639 97.8937 AvgErrorRate(%) 0.4054 0.7569

[0187] Example 1: Combination of enzyme and sequencing enzyme combination

[0188] The improvement of this embodiment over comparative example 1 is only that a combination of Sequenase 1 and Sequenase 2 is used for sequencing, and the rest is the same as comparative example 1.

[0189] Considering that different polymerases have different preferences for dNTPs (Cold dNTPs and Hot dNTPs) with different labels and structures, there are also differences in the recognition ability of the same polymerase for the four bases. The polymerase in the sequencing process of this sequencing scheme participates in two biochemical reactions, non-covalent binding and covalent extension. Non-covalent binding includes Hot dNTP, and all covalent binding uses Cold dNTP. And the binding process also has differences in the needs of enzymes and the extension process. It is speculated that the sequencing results and quality of different polymerases used in the binding process and the extension process will be better. The base combination used in this embodiment also needs to be specifically considered according to the binding polymerase used. Based on the sequencing process of Comparative Example 1, this embodiment provides an improved sequencing scheme (i.e., the enzyme used in the binding reaction is different from the enzyme type used in the extension reaction). Sequencer 1 suitable for binding (same as comparative example 1) was selected for binding reaction and Sequenase 2 suitable for extension (same as comparative example 1) was selected for extension reaction, and combined enzyme SE30 sequencing was performed. The combination types are shown in Table 5. Compared with the single enzyme in comparative example 1, the combined enzyme sequencing method of the embodiment of the present application can improve the sequencing quality and reduce the error rate.

[0190] The enzyme combination used in this example and the results are shown in the following table.

[0191] Table 5

[0192] Sequencing protocol Enzyme combination Binding enzyme Elongase Sequencing solution 3 1 Sequenase 1 Sequenase 2

[0193] Table 6-SE30

[0194] Enzyme combination 1: Phasing 0.307 Prephasing 0.349 MappingRate(%) 99.777 AvgErrorRate(%) 0.1161

[0195] The sequencing process of the embodiment of the present application includes a binding process and an extension process. Taking into account the different characteristics of different enzymes, by using a combination of enzymes in the binding and extension reactions, the two-step reactions of the binding sequencing are optimized separately, which helps to improve the accuracy and reliability of sequencing.

[0196] The technical features of the above-mentioned implementation modes and examples can be combined in any appropriate manner. To make the description concise, not all possible combinations of the technical features in the above-mentioned implementation modes and examples are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0197] The above-described embodiments only express several implementation methods of the present application, which is convenient for understanding the technical solution of the present application in detail, but it cannot be understood as a limitation on the scope of protection of the patent application. It should be pointed out that for ordinary technicians in this field, without departing from the concept of the present application, several deformations and improvements can be made, which all belong to the protection scope of the present application. In addition, it should be understood that after reading the above-mentioned teaching content of the present application, the technicians in this field can make various changes or modifications to the present application, and the equivalent forms obtained also fall within the protection scope of the present application. It should also be understood that the technical solutions obtained by the technicians in this field through logical analysis, reasoning or limited experiments on the basis of the technical solutions provided in the present application are all within the protection scope of the claims attached to the present application. Therefore, the protection scope of the patent of the present application shall be based on the content of the attached claims, and the description and drawings can be used to explain the content of the claims.

Claims

1. A method for sequencing nucleic acid molecules, characterized in that: The sequencing method comprises the following steps: A first round of binding reaction is performed with the nucleotides in the first group of nucleotides that match the sites to be tested in the sequencing template, the sequencing template, the sequencing primer, the first nucleic acid polymerase and the first non-catalytic competitive metal ion to prepare a first non-covalent five-membered complex; the first group of nucleotides includes a first dATP or an analog thereof, a first dTTP or an analog thereof, a first dCTP or an analog thereof and a first dGTP or an analog thereof, and each nucleotide or its analogue has a preset identifier independently; the preset identifier corresponding to the first non-covalent five-membered complex is detected to obtain first identifier information; The first non-covalent five-membered complex is broken up, the sequencing template and the sequencing primer are retained, and a second round of binding reaction is performed with a nucleotide in the second group of nucleotides that matches the sequencing template to be tested site, a second nucleic acid polymerase, and a second non-catalytic competitive metal ion to prepare a second non-covalent five-membered complex; the second group of nucleotides includes a second dATP or an analog thereof, a second dTTP or an analog thereof, a second dCTP or an analog thereof, and a second dGTP or an analog thereof, and each nucleotide or its analogue independently has a preset identifier; the preset identifier corresponding to the second non-covalent five-membered complex is detected to obtain second identifier information; Combining the first identification information and the second identification information in binary form, and clarifying the type of the nucleotide corresponding to the position to be tested of the sequencing template according to the obtained combination information, thereby determining the type of the nucleotide at the position to be tested; The di-non-covalent five-membered complex is broken up, the sequencing template and the sequencing primer are retained, and a covalent extension reaction is performed with a third group of nucleotides, a third nucleic acid polymerase and a catalytic competitive metal ion, wherein each nucleotide in the third group of nucleotides or an analog thereof has a reversible terminator structure; After the covalent extension reaction is completed, the reversible terminator structure paired with the nucleotide at the site to be tested is removed, and the next site is tested using the same method as that used to detect the site to be tested; The first nucleic acid polymerase and the second nucleic acid polymerase are of different types from the third nucleic acid polymerase.

2. The method for sequencing nucleic acid molecules according to claim 1, characterized in that: The first nucleic acid polymerase and the second nucleic acid polymerase are of the same type.

3. The method for sequencing nucleic acid molecules according to claim 1, characterized in that: The preset identification includes marking and non-marking; Optionally, the label includes one or more of a fluorescent label, a chemiluminescent label, a bioluminescent label, an electrochemiluminescent label, an electrical signal label and a magnetic signal; Further optionally, the fluorescent label is selected from one or more of AF532, ATTO532, Cy3B, Cy3, Cy5, ATTO647N, ATTO647 and AF647.

4. The method for sequencing nucleic acid molecules according to claim 3, characterized in that: The preset mark is a mark, and the mark information is recorded as 1; the preset mark is a non-mark, and the mark information is recorded as 0, and 1 and 0 are combined in binary.

5. The method for sequencing nucleic acid molecules according to claim 4, characterized in that: In the first group of nucleotides, the preset identifiers of the first dATP or its analogue and the first dCTP or its analogue are labeled, and the preset identifiers of the first dTTP or its analogue and the first dGTP or its analogue are non-labeled.

6. The method for sequencing nucleic acid molecules according to claim 4, characterized in that: In the second group of nucleotides, the preset identifiers of the second dATP or its analogue and the second dTTP or its analogue are labeled, and the preset identifiers of the second dCTP or its analogue and the second dGTP or its analogue are non-labeled.

7. The method for sequencing nucleic acid molecules according to claim 4, characterized in that: Each nucleotide in the third group of nucleotides or its analogue does not have the label.

8. The method for sequencing nucleic acid molecules according to claim 1, characterized in that: Each nucleotide or its analog in the third group of nucleotides has a reversible terminator structure independently selected from one of 3'-benzyl azide, 3'-R-SS- and 3'-NH2-O-.

9. The method for sequencing a nucleic acid molecule according to any one of claims 1 to 8, characterized in that: The first non-catalytic competitive metal ion and the second non-catalytic competitive metal ion are each independently selected from one or more of calcium ions, strontium ions and barium ions.

10. The method for sequencing a nucleic acid molecule according to any one of claims 1 to 8, characterized in that: The catalytic competitive metal ion is a magnesium ion.

11. The method for sequencing a nucleic acid molecule according to any one of claims 1 to 8, characterized in that: The first nucleic acid polymerase, the second nucleic acid polymerase and the third nucleic acid polymerase are each independently selected from one or more of Taq DNA polymerase, KOD DNA polymerase, 9°N DNA polymerase and Klenow enzyme.

12. The method for sequencing a nucleic acid molecule according to any one of claims 1 to 8, characterized in that: The reagent for breaking up the first non-covalent five-membered complex includes a first ligand complexing the first non-catalytic competing metal ion; Optionally, the first ligand comprises one or more of EDTA, EGTA, NTA and HPTA; Further optionally, the reagent for breaking up the first non-covalent five-membered complex comprises guanidine thiocyanate, sodium citrate and EDTA; Further optionally, the reagent for breaking up the first non-covalent five-membered complex comprises water, 3.5M to 4.5M guanidine thiocyanate, 40mM to 45mM sodium citrate and 8mM to 12mM EDTA, with a pH value of 7.5 to 8.

5.

13. The method for sequencing a nucleic acid molecule according to any one of claims 1 to 8, characterized in that: The reagent for breaking up the second non-covalent five-membered complex includes a second ligand complexing the second catalytic competitive metal ion; Optionally, the second ligand comprises one or more of EDTA, EGTA, NTA and HPTA; Further optionally, the reagent for breaking up the second non-covalent five-membered complex comprises guanidine thiocyanate, sodium citrate and EDTA; Further optionally, the reagent for breaking up the second non-covalent five-membered complex comprises water, 3.5M to 4.5M guanidine thiocyanate, 40mM to 45mM sodium citrate and 8mM to 12mM EDTA, with a pH value of 7.5 to 8.5.

Images