A Structural Variant Molecular Marker Related to the Feather Color Variation of Wenchang Chicken and Its Application
By screening the structural variant marker sequences in the Wenchang chicken genome, the problem of difficulty in screening out molecular markers suitable for Wenchang chicken feather color breeding in the prior art is solved, and efficient reference for directed feather color breeding is achieved, and breeding efficiency is improved.
Patent Information
- Application Number
- CN202510000539.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-02
- Publication Date
- 2025-06-20
- Estimated Expiration
- 2045-01-02
AI Technical Summary
It is difficult for the prior art to screen out effective molecular markers suitable for Wenchang chicken feather breeding through detection of variants, resulting in low efficiency of feather breeding.
By screening the structural variant marker sequences in the Wenchang chicken genome, it was found that the presence and deletion of this sequence would lead to a significant difference in the depth of feather color, providing a molecular marker for directional breeding.
This structural variant marker sequence can effectively screen out individuals whose plume color is deeper than that of the sequence, providing a powerful reference for directional plume breeding and improving breeding efficiency.
Smart Images

Figure CN119391876B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biological gene detection, in particular to a structural variation molecular marker related to the plumage color variation of Wenchang chickens and its application. Background Art
[0002] Wenchang chickens generally refer to Hainan Wenchang chickens, which are a breed of broiler chickens native to Hainan Province, China. Compared with other chicken breeds, Wenchang chickens have relatively prominent characteristics in terms of appearance and meat quality. Studying the plumage color traits of chickens helps to strengthen breed differentiation and identification, and it is particularly important to establish significant markers between breeds and ensure the uniform appearance of the same breed in breeding work. In nature, birds exhibit a rich variety of plumage colors, and plumage color traits play important roles in aspects such as avoiding natural enemies, predation, courtship, and resisting ultraviolet rays. Therefore, there is a great market demand for the plumage color selection of Wenchang chickens. The market has a uniform requirement for the plumage color of Wenchang chicken breeds. In order to meet the market demand, a method is needed to screen through the detection of variations and apply it as a molecular marker in the breeding of Wenchang chickens. The present invention solves such a problem by detecting and screening a structural variation marker sequence that can be applied as a molecular marker in the plumage color selection of Wenchang chickens, and can provide a strong reference for the directional selection of plumage color in actual breeding work. Summary of the Invention
[0003] To solve the deficiencies of the prior art, the purpose of the present invention is to provide a structural variation molecular marker related to the plumage color variation of Wenchang chickens and its application. The present invention discovers that the plumage color of Wenchang chickens containing the structural variation marker sequence in the genome is darker than that of individuals lacking this sequence. Such a molecular marker can be applied to the breeding detection kit of Wenchang chickens and provide a strong reference for the directional selection of plumage color.
[0004] To achieve the above objectives, the present invention adopts the following technical solutions:
[0005] A structural variation molecular marker related to the plumage color variation of Wenchang chickens, the structural variation marker sequence is SEQ ID No: 01, and the deletion site is on the reference genome ASM4043665v1 of Wenchang chicken genes, Gallus gallus chicken; the position in Genbank: GCA_040436655.1 is CM080655.1: 9712333 - 9712763.
[0006] The aforementioned structural variation molecular marker related to the plumage color variation of Wenchang chickens. The structural variation marker sequence is located in the LOC107052320 gene on chromosome chr1. The flanking sequences of the structural variation breakpoint in the Wenchang chicken genome ASM4043665v1 are as follows: the 30 bp upstream sequence is GGAGGGTTCCAAGTTCAGATGACATTCTCC SEQ ID No:04, and the 30 bp downstream sequence is CTGGGCCTCAGGCCCTCAAAAACAAAGGA SEQ ID No:05.
[0007] The aforementioned structural variation molecular marker related to the plumage color variation of Wenchang chickens. The detection primers for the structural variation marker sequence include:
[0008] The forward primer F is 5’-TACGCCAACCAAGTCACCAG 3’ SEQ ID No:02;
[0009] The reverse primer R is 5’-GTGAAGGGAAGAGACCTGGG 3’ SEQ ID No:03.
[0010] The aforementioned structural variation molecular marker related to the plumage color variation of Wenchang chickens. The plumage color of Wenchang chickens containing the structural variation marker sequence in their genomes is darker than that of individuals lacking this sequence.
[0011] An application of a structural variation molecular marker related to the plumage color variation of Wenchang chickens. The structural variation marker sequence is SEQID No:01, and the deletion site is on the reference genome ASM4043665v1 of Wenchang chickens, Gallus gallus chicken; its position in Genbank: GCA_040436655.1 is CM080655.1:9712333-9712763; it is applied to the detection kit for the directional breeding of Wenchang chicken plumage color.
[0012] The beneficial effects of the present invention are as follows:
[0013] The present invention screens, through the newly disclosed Wenchang chicken genome ASM4043665v1, Gallus gallus chicken, molecular markers that can provide a strong reference for the directional breeding of plumage color.
[0014] The present invention discovers that the plumage color of individuals lacking the structural variation marker sequence of SEQ No: 01 in Wenchang chickens is significantly different from that of individuals without the deletion of the structural variation marker sequence, and the plumage color of Wenchang chickens containing this structural variation marker sequence in their genomes is darker than that of individuals lacking this sequence.
[0015] Professional terms:
[0016] Flanking sequence refers to a segment of non-translated nucleotide sequence located outside the first exon and the last exon of the coding region;
[0017] Genome ASM4043665v1: The reference genome of Wenchang chicken ASM4043665v1, Gallus gallus chicken; Genbank: GCA_040436655.1. Brief Description of the Drawings
[0018] Figure 1 It is the genotype frequency of the structural variation marker sequence of the present invention in various breeds of chickens; (Genotye: Genotype; Proportion: Proportion;)
[0019] Figure 2 It is the electrophoresis result of the deletion verification of the structural variation marker sequence of the present invention; (Pearl, Silver, Golden, White, Marker, Yellow)
[0020] Figure 3 It is the detection situation of this locus for each feather color of the present invention and the schematic diagram of this deletion locus. (Chromosome: Chromosome, Conserved region: Conserved region, Exon: Exon, Repeat domain: Region of DNA sequence that repeats in the genome, SV: Structural variation, Hap-colored: Hap-colored, Hap-white: Hap-white, Structure: Structure, annotation: Annotation, Colored feather: Colored feather, White feather: White feather). Detailed Embodiment
[0021] The present invention will be specifically introduced below in conjunction with the drawings and specific embodiments.
[0022] The screening process and detection process of the molecular marker of the present invention are fully demonstrated below to verify the technical effects of the present invention:
[0023] The samples and their sources are shown in Table 1:
[0024] Table 1
[0025]
[0026] A total of 354 individuals, among which Wenchang chickens come from 3 chicken farms.
[0027] Detection Process of Structural Variation (SV)
[0028] 1. SV Identification by Second-generation Sequencing
[0029] Illumina paired-end sequencing data of 354 individuals were obtained, and the following algorithms were used to detect SVs: Read-pair (RP), Split-read (SR), Read depth (RD), and Assembly (AS). By using six detection software: Manta, Delly, Wham, Smoove, Dysgu, and GRIDS2, and each software has at least two integrated methods of algorithms, we combined multiple SV detection algorithms to maximize sensitivity. The SVs obtained for each sample were merged using the SURVIVOR software with the following parameters: 50 1 1 1 0 50. Then, the merged SVs were filtered using the following parameters: NA 50 100000 0 -1. Next, their breakpoints were refined according to the highest frequency positions of the SVs.
[0030] 2. Assembly-based SV Identification
[0031] In addition to the genome ASM4043665v1, published assembled genomes of 30 samples from NCBI were also used to detect assembly-based structural variations by constructing a pan-genome variation map. This step was completed using the Pggb software with the parameters: -p 95 -s 10000 -T 20 --poa-params 1,9,16,2,41,1. Next, in the deconstruct mode with default parameters, the vg toolkit was used to identify SVs on all autosomes and the Z chromosome of ASM4043665v1. The generated vcf file contains SVs of all 31 assembled genomes.
[0032] The deletion site range is located at chr1: 9712333-9712763 in the genome ASM4043665v1;
[0033] The position in the genome ASM4043665v1 (GCA_040436655.1) is CM080655.1:9712333-9712763.
[0034] The structural variation marker sequence is located in the LOC107052320 gene on chromosome chr1, and the flanking sequences of the structural variation breakpoint in the Wenchang chicken genome ASM4043665v1 are: 30bp upstream GGAGGGTTCCAAGTTCAGATGACATTCTCC SEQID No:04, and 30bp downstream CTGGGCCTCAGGCCCTCAAAAACAAAGGA SEQ ID No:05.
[0035] 3. Pan-genome graph construction
[0036] ASM4043665v1 was used as the backbone of the pan-genome graph. Without deleting any alternative alleles, the construct module of the vg toolkit was used to merge the previously identified second-generation sequencing-based and assembly-based SVs into the pan-genome variant graph. Then, "vg index" was used to index the generated pan-genome graph in XG and GCSA formats, and the "-L" parameter was enabled for both formats. SVs are described as bubbles in the graph, and the paths represent the corresponding alleles. These paths include the start and end nodes of the reference sequence, as well as the paths traversing these nodes.
[0037] 4. Graph-based SV genotyping
[0038] The pan-genome graph was used to genotype 354 high-depth sequencing (>10×) samples. "vgGiraffe" was used to align the clean reads of each sample to the graph genome, and a result file in GAM format was obtained, excluding alignments with alignment quality <5 or base quality <5. Subsequently, under default parameters, "vg pack" was used to build the index. On the constructed pan-genome graph, "vg call" was used to generate the SV genotyping results for 354 samples with the parameters -v --bias-mode --het-bias 2,4.
[0039] 5. GWAS of SV
[0040] GWAS was performed using the linear mixed model of GEMMA96 (v1.0.3) on the SV dataset, and gender, kinship, and population structure were used as auxiliary factors for adjustment. The kinship matrix was calculated using all SNPs in GEMMA, and the population structure was determined using the top 10 principal components. A unified threshold of 0.05 / n was used to determine the genome-wide significance threshold, where n represents the effective number of independent SVs and SNPs calculated using a genetic type I error calculator.
[0041] 6. Structural variant marker sequences
[0042] A structural variant marker sequence was screened and applied as a molecular marker in the breeding of Wenchang chickens. As shown in Table 2, the genotyping results showed three genotypes: 0 / 0 (no deletion), 0 / 1 (heterozygous deletion), and 1 / 1 (homozygous deletion).
[0043] Table 2
[0044] gene position chromosome deletion site deletion length SEQ ID No: deleted base sequence LOC107052320 exon chr1 9712333-9712763 430bp 01 TCTGGGCCTCAGGCCCTCAAAGACAATGGAGGAGGTCACACAATTTGTTGCATCACAGACACTCCTGGGTCCCTGCCCAGGTCTCTTCCCTTCACTTCCGTGCCCTCTGTCCTGCCCTCTTACCTCTGCCGCTGTTCACCATCCTGCTCTCCTCTGGCCTGGGCGAGCAGAGGGTGCAGCTCTTTCCTTGATCTACCTATGCCAACCATCTCGCCAATGCCTGTGTGAAACAGGAACTGCCAATGTTCTGCCTGCTGTGACATGACCACAGCATCACCAAGGCAGTTGCTAGCAGCTGATGCCCAAATTACAGCCAGGCTGGTGTTATTTTCATTACTTATCTTTGTATTGATGTCCACGTAGAAGGTGGGACATCTCTCCAGCTAAGCAGCAGAAGACAGGAGGGTTCCATGTTCAGAGGATGTTCTCCA
[0045] The gene frequencies of the structural variant marker sequences in each chicken breed are asFigure 1 As shown in:
[0046] Experimental verification process of structural variation marker sequence deletion:
[0047] 1. The length of the structural variation marker sequence is 430bp. Therefore, detection primers are designed within the deletion sequence. Using the Primer-BLAST function of NCBI (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / index.cgi?LINK_LOC=BlastHome), the target fragment is 430bp long and specific.
[0048] Forward primer F is 5’-TACGCCAACCAAGTCACCAG 3’ SEQ ID No:02;
[0049] Reverse primer R is 5’-GTGAAGGGAAGAGACCTGGG 3’ SEQ ID No:03;
[0050] 2. The blood samples used for verification were collected from Wenchang Longquan Wenchang Chicken Industry Co., Ltd. in Wenchang, Hainan. The TIANGEN KG204-01 Blood Direct PCR Kit was used to directly prepare the PCR reaction system as shown in Table 3:
[0051] Table 3
[0052] component volume blood sample template 1.25 μl forward primer F (10 μM) 0.625 μl reverse primer R (10 μM) 0.625 μl 2× Blood Direct PCR MasterMix 12.5 μl RNase-Free ddH2O 10 μl
[0053] 3. PCR reaction conditions: Pre-denaturation at 95℃ for 3 minutes, denaturation at 95℃ for 15 seconds, annealing at 54℃ for 20 seconds, extension at 72℃ for 30 seconds, 30 cycles from denaturation to extension, and extension at 72℃ for 5 minutes
[0054] 4. Electrophoresis: ① Prepare a 2.0% agarose gel: Dissolve 2.00g of agarose in 100ml of 1% TAE and add 8μl of Sparkred fluorescent nucleic acid staining reagent. ② Use a pipette to sequentially add 5μl of the PCR amplification product into the gel wells, and at the same time add 5μl of DNA Maker (D2000) as a reference. ③ After electrophoresis at a constant voltage of 100V for 30 minutes, observe and photograph under ultraviolet light.
[0055] 5. The electrophoresis results are as Figure 2 shown,
[0056] A band at 430bp indicates that there is no deletion of the structural variation marker sequence, and no band indicates that there is a deletion of the structural variation marker sequence.
[0057] From left to right in the gel wells, the plumage color information is shown in Table 4:
[0058] Table 4
[0059] gel wells from left to right 1-3 4-6 7-9 10-16 17 18-24 feather color Pearl Silver Golden White Marker Yellow
[0060] It can be seen from the above experiments that at the same week age, from Table 4 and Figure 2 it can be known that the plumage color of individuals lacking the structural variation marker sequence is significantly different from that of individuals without deletion. The plumage color of Wenchang chickens containing the structural variation marker sequence of the present invention in their genomes is darker than that of individuals lacking this sequence.
[0061] The above shows and describes the basic principles, main features and advantages of the present invention. Those skilled in the art should understand that the above embodiments do not limit the present invention in any form. Any technical solutions obtained by using equivalent replacements or equivalent transformations all fall within the protection scope of the present invention.
Claims
1. Use of a primer for detecting a structural variation molecular marker associated with Wenchang chicken feather color variation in the preparation of a Wenchang chicken feather color directional detection kit, characterized in that: The structural variation molecular marker is a deletion mutation in Wenchang chicken that lacks the sequence shown in SEQ ID No:
01. The sequence of the structural variation molecular marker is located on the LOC107052320 gene on chromosome chr1. The flanking sequences of the breakpoints of the structural variation are: the upstream flanking sequence is GGAGGGTTCCAAGTTCAGATGACATTCTCC, and the downstream flanking sequence is CTGGGCCTCAGGCCCTCAAAAACAAAGGA. The feather color of the individuals containing the sequence shown in SEQ ID No: 01 in the Wenchang chicken genome is darker than the feather color of the individuals lacking the sequence shown in SEQ ID No:
01.
2. The use according to claim 1, characterized in that The primers include: a forward primer F and a reverse primer R; Forward primer F was 5′-TACGCCAACCAAGTCACCAG 3′; The reverse primer R was 5'-GTGAAGGGAAGAGACCTGGG 3'.
Citation Information
Patent Citations
Wenchang chicken white spot phenotype related molecular marker and application of molecular marker
CN104962636A
Chicken feather color character related gene MC1R molecular marker and application thereof
CN113308549A