A recombinant yeast and a method for constructing the same
By introducing supernatant protein factor SPF into Saccharomyces cerevisiae, an efficient squalene transport system was constructed, which solved the problems of low squalene accumulation and oxidation efficiency, improved the yield and synthesis efficiency of triterpenoids and sterols, and reduced cytotoxicity and fermentation costs.
Patent Information
- Application Number
- CN202211594364.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-12-13
- Publication Date
- 2025-12-19
- Estimated Expiration
- 2042-12-13
AI Technical Summary
Existing brewing yeasts suffer from problems such as squalene accumulation and low oxidation efficiency in the synthesis of triterpenoids and sterols, leading to cellular metabolic burden and toxicity, and limiting compound yield.
By introducing supernatant protein factor (SPF) into Saccharomyces cerevisiae and constructing an efficient squalene transport system through inducible expression, the relationship between transport proteins and key enzymes in the endometrial system and mevalonate pathway was regulated, thereby optimizing the synthesis of triterpenoids and sterols.
It increased the yield of triterpenoids and sterols, reduced cytotoxicity, shortened the culture period, reduced fermentation costs, and promoted the synthesis of squalene derivatives and sterols.
Smart Images

Figure CN115927030B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of bioengineering, and particularly relates to a recombinant yeast for synthesizing triterpenoid compounds and / or sterol compounds and a construction method thereof. BACKGROUND
[0002] Squalene is an open-chain triterpenoid compound and an important intermediate for synthesizing many compounds with bioactive ingredients. Squalene can be used to synthesize β-amyrin, ergosterol, lanosterol and other derivative compounds, and thus plays a key role in the synthesis of triterpenoids and sterols.
[0003] β-amyrin is a pentacyclic triterpenoid compound, and has the effects of anti-inflammation, antibacterial and antifungal, anti-virus and cancer cell prevention and treatment, and good effects in reducing blood sugar and blood lipid.
[0004] Saccharomyces cerevisiae is a eukaryotic model microorganism, and has the advantages of clear genetic background, mature gene operation, complete membrane structure and the like, and is considered to be a suitable chassis host for the synthesis of terpenes. The heterologous synthesis of terpenes in Saccharomyces cerevisiae will cause metabolic burden on the strain, and the intracellular accumulation of the final product or intermediate product of the synthesis may have toxic effects on the cell, thereby limiting the ability of the cell to synthesize terpenes.
[0005] In the synthesis of triterpenoids in Saccharomyces cerevisiae, the oxidation of squalene and the cyclization of 2,3-oxidized squalene are key factors limiting the synthesis of products, and the catalytic efficiency directly affects the yield of downstream compounds and causes the accumulation of squalene. In addition, squalene is also a key node in the metabolic pathway of farnesyl pyrophosphate (FPP) to form triterpenoids and directly participate in the synthesis of 2,3-oxidized squalene, and its direct precursor FPP has a great toxic effect on the cell. SUMMARY
[0006] In order to solve the problems in the prior art, the supernatant protein factor (SPF) is introduced into the yeast to transport squalene and 2,3-oxidosqualene to the vicinity of the membrane for further oxidation, so that the accumulation of squalene and 2,3-oxidosqualene can be reduced, the intracellular metabolic rate can be accelerated, and the yield of target compounds can be improved. Specifically, the exogenous SPF is introduced into the yeast to verify the influence of the exogenous SPF on the synthesis of triterpenoid compounds and / or sterol compounds in the yeast. The function of the exogenous SPF is identified in the yeast by an inducible expression mode; the influence of the SPF on the growth and metabolism of the yeast cells is studied, and the SPF is applied to the production of triterpenoid compounds (especially squalene or β-amyrin) and / or sterol compounds (especially ergosterol and / or lanosterol). By studying the adaptability of the SPF to the yeast cells, the optimal expression mode of the protein is determined; by adjusting the relationship between the transport protein and the inner membrane system (for example, the phospholipid synthesis transcription factor INO2), the key enzyme (for example, ERG1) of the mevalonic acid pathway, and the product synthase (for example, the β-amyrin synthase, the ergosterol synthase and / or the lanosterol synthase), an efficient squalene transport system is constructed, the synthesis of the product (especially the β-amyrin, the ergosterol and / or the lanosterol) is strengthened, and the yield of the product is improved. Valuable reference materials are provided for the synthesis of terpenoids which also need a transport system.
[0007] In order to achieve the above object, the present application adopts the following technical solutions:
[0008] In a first aspect of the present application, a recombinant yeast for synthesizing triterpenoid compounds and / or sterol compounds is provided.
[0009] Preferably, the recombinant yeast expresses a supernatant protein factor.
[0010] Further preferably, the supernatant protein factor is derived from Peromyscus maniculatus, Homo sapiens and / or Gallus gallus.
[0011] In a specific embodiment of the present application, the coding gene of the supernatant protein factor derived from Peromyscus maniculatus comprises SEQ ID NO: 1, or comprises a nucleotide sequence having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% identity with SEQ ID NO: 1.
[0012] In a specific embodiment of the present application, the coding gene of the supernatant protein factor derived from Homo sapiens comprises SEQ ID NO: 2, or comprises a nucleotide sequence having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% identity with SEQ ID NO: 2.
[0013] In an embodiment of the present application, the gene encoding the supernatant protein factor derived from Gallus gallus comprises SEQ ID NO: 3, or a nucleotide sequence having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9% identity to SEQ ID NO: 3.
[0014] Preferably, the recombinant yeast further expresses a key enzyme of the mevalonate pathway, a phospholipid synthesis transcription factor, and / or a product synthase.
[0015] Preferably, the key enzyme of the mevalonate pathway includes, but is not limited to, one or more than two combinations of squalene monooxygenase, HMG synthase, FPP synthase, or squalene synthase.
[0016] In an embodiment of the present application, the key enzyme of the mevalonate pathway includes squalene monooxygenase.
[0017] Preferably, the product synthase includes, but is not limited to, one or more than two combinations of a-amyrin synthase, β-amyrin synthase, dammarenediol synthase, lupeol synthase, cycloartanol synthase, ergosterol synthase, or lanosterol synthase.
[0018] In an embodiment of the present application, the product synthase is β-amyrin synthase, ergosterol synthase, and / or lanosterol synthase.
[0019] In an embodiment of the present application, the recombinant yeast expresses any one of the following groups:
[0020] A) the supernatant protein factor;
[0021] B) the supernatant protein factor and squalene monooxygenase ERG1;
[0022] C) the supernatant protein factor and phospholipid synthesis transcription factor INO2;
[0023] D) the supernatant protein factor and product synthase;
[0024] E) the supernatant protein factor, squalene monooxygenase ERG1, and phospholipid synthesis transcription factor INO2;
[0025] F) the supernatant protein factor, squalene monooxygenase ERG1, and product synthase;
[0026] G) the supernatant protein factor, phospholipid synthesis transcription factor INO2, and product synthase;
[0027] H) the supernatant protein factor, squalene monooxygenase ERG1, phospholipid synthesis transcription factor INO2, and product synthase.
[0028] In one embodiment of the present application, the recombinant yeast expresses supernatant protein factor, squalene monooxygenase ERG1, phospholipid synthesis transcription factor IN02 and product synthase (preferably β-amyrin synthase, ergosterol synthase and / or lanosterol synthase) derived from southern multi-mouse.
[0029] In one embodiment of the present application, the recombinant yeast expresses supernatant protein factor, squalene monooxygenase ERG1, phospholipid synthesis transcription factor IN02 and product synthase (preferably β-amyrin synthase, ergosterol synthase and / or lanosterol synthase) derived from Homo sapiens.
[0030] In one embodiment of the present application, the recombinant yeast expresses supernatant protein factor, squalene monooxygenase ERG1, phospholipid synthesis transcription factor IN02 and product synthase (preferably β-amyrin synthase, ergosterol synthase and / or lanosterol synthase) derived from Gallus gallus.
[0031] Preferably, the triterpenoid compound includes one or more than two combinations of lupeol, cycloartenol, dammarenediol, α-amyrin, squalene or β-amyrin.
[0032] In one embodiment of the present application, the triterpenoid compound is squalene or β-amyrin.
[0033] Preferably, the sterol compound includes lanosterol and / or ergosterol.
[0034] Preferably, the recombinant yeast includes but is not limited to one or more than two combinations of Saccharomyces cerevisiae, Pichia pastoris, Candida tropicalis, Candida utilis, Hansenula polymorpha, Schizosaccharomyces pombe, Rhodotorula mucilaginosa, Candida tropicalis or Candida utilis.
[0035] In one embodiment of the present application, the recombinant yeast is Saccharomyces cerevisiae.
[0036] Preferably, the recombinant yeast is obtained by introducing genes into the recombinant yeast. The introduction can be any method known in the art.
[0037] Preferably, the introduced genes include the coding gene of supernatant protein factor, and can also include the coding gene of key enzyme of mevalonate pathway, the coding gene of phospholipid synthesis transcription factor, and / or the coding gene of product synthase.
[0038] Preferably, the introduced genes can be single copy or multiple copies.
[0039] Preferably, the introduced gene is expressed in a plasmid or expressed on a chromosome.
[0040] In a second aspect of the present application, a plasmid for constructing the recombinant yeast is provided.
[0041] Preferably, the plasmid comprises a gene encoding a supernatant protein factor. The supernatant protein factor can be derived from Peromyscus maniculatus, Homo sapiens and / or Gallus gallus.
[0042] In an embodiment of the present application, the gene encoding the supernatant protein factor derived from Peromyscus maniculatus comprises SEQ ID NO: 1, or comprises a nucleotide sequence having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% identity to SEQ ID NO: 1.
[0043] In an embodiment of the present application, the gene encoding the supernatant protein factor derived from Homo sapiens comprises SEQ ID NO: 2, or comprises a nucleotide sequence having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% identity to SEQ ID NO: 2.
[0044] In an embodiment of the present application, the gene encoding the supernatant protein factor derived from Gallus gallus comprises SEQ ID NO: 3, or comprises a nucleotide sequence having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% identity to SEQ ID NO: 3.
[0045] Preferably, the plasmid further comprises a gene encoding a key enzyme of the mevalonate pathway, a gene encoding a phospholipid synthesis transcription factor and / or a gene encoding a product synthase.
[0046] Preferably, the key enzyme of the mevalonate pathway includes, but is not limited to, one or more than two combinations of squalene monooxygenase, HMG synthase, FPP synthase or squalene synthase.
[0047] In an embodiment of the present application, the key enzyme of the mevalonate pathway includes squalene monooxygenase.
[0048] Preferably, the product synthase includes, but is not limited to, one or more than two combinations of a-amyrin synthase, β-amyrin synthase, dammarenediol synthase, lupeol synthase, cycloartanol synthase, ergosterol synthase or lanosterol synthase.
[0049] In one embodiment of the application, the product synthase is a β-amyrin synthase, a lovastatin synthase and / or a lanosterol synthase.
[0050] In one embodiment of the application, the plasmid comprises any one of the following groups:
[0051] A) a gene encoding a supernatant protein factor;
[0052] B) a gene encoding a supernatant protein factor and a gene encoding a squalene monooxygenase ERG1;
[0053] C) a gene encoding a supernatant protein factor and a gene encoding a phospholipid synthesis transcription factor IN02;
[0054] D) a gene encoding a supernatant protein factor and a gene encoding a product synthase;
[0055] E) a gene encoding a supernatant protein factor, a gene encoding a squalene monooxygenase ERG1 and a gene encoding a phospholipid synthesis transcription factor IN02;
[0056] F) a gene encoding a supernatant protein factor, a gene encoding a squalene monooxygenase ERG1 and a gene encoding a product synthase;
[0057] G) a gene encoding a supernatant protein factor, a gene encoding a phospholipid synthesis transcription factor IN02 and a gene encoding a product synthase;
[0058] H) a gene encoding a supernatant protein factor, a gene encoding a squalene monooxygenase ERG1, a gene encoding a phospholipid synthesis transcription factor IN02 and a gene encoding a product synthase.
[0059] In one embodiment of the application, the plasmid comprises a gene encoding a supernatant protein factor, a gene encoding a squalene monooxygenase ERG1, a gene encoding a phospholipid synthesis transcription factor IN02 and a gene encoding a product synthase (preferably a β-amyrin synthase, a lovastatin synthase and / or a lanosterol synthase) derived from a southern multis.
[0060] In one embodiment of the application, the plasmid comprises a gene encoding a supernatant protein factor, a gene encoding a squalene monooxygenase ERG1, a gene encoding a phospholipid synthesis transcription factor IN02 and a gene encoding a product synthase (preferably a β-amyrin synthase, a lovastatin synthase and / or a lanosterol synthase) derived from a Homo sapiens.
[0061] In one embodiment of the present application, the plasmid comprises a gene encoding supernatant protein factor derived from Gallus gallus, a gene encoding squalene monooxygenase ERG1, a gene encoding phospholipid synthesis transcription factor IN02, and a gene encoding product synthase (preferably β-amyrin synthase, ergosterol synthase and / or lanosterol synthase).
[0062] In a third aspect of the present application, a cell comprising the above-mentioned plasmid is provided.
[0063] In a fourth aspect of the present application, a method for constructing a recombinant yeast for synthesizing triterpenoid compounds and / or sterol compounds is provided.
[0064] Preferably, the method for constructing comprises introducing a gene encoding supernatant protein factor into the recombinant yeast. The supernatant protein factor can be derived from Peromyscus maniculatus, Homo sapiens and / or Gallus gallus.
[0065] In one embodiment of the present application, the gene encoding supernatant protein factor derived from Peromyscus maniculatus comprises SEQ ID NO: 1, or comprises a nucleotide sequence having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% identity to SEQ ID NO: 1.
[0066] In one embodiment of the present application, the gene encoding supernatant protein factor derived from Homo sapiens comprises SEQ ID NO: 2, or comprises a nucleotide sequence having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% identity to SEQ ID NO: 2.
[0067] In one embodiment of the present application, the gene encoding supernatant protein factor derived from Gallus gallus comprises SEQ ID NO: 3, or comprises a nucleotide sequence having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.9% identity to SEQ ID NO: 3.
[0068] Preferably, the method for constructing further comprises introducing a gene encoding key enzyme of mevalonate pathway, a gene encoding phospholipid synthesis transcription factor, and / or a gene encoding product synthase into the recombinant yeast.
[0069] Preferably, the key enzyme of mevalonate pathway includes, but is not limited to, one or more than two combinations of squalene monooxygenase, HMG synthase, FPP synthase or squalene synthase.
[0070] In one embodiment of the present application, the mevalonate pathway key enzyme comprises squalene monooxygenase.
[0071] Preferably, the product synthase comprises, but is not limited to, one or a combination of two or more of α-amyrin synthase, β-amyrin synthase, dammarenediol synthase, lupeol synthase, cycloartenol synthase, ergosterol synthase, or lanosterol synthase.
[0072] In one embodiment of the present application, the product synthase is β-amyrin synthase, ergosterol synthase, and / or lanosterol synthase.
[0073] In one embodiment of the present application, the construction method comprises introducing into the recombinant yeast the coding genes of any one of the following groups:
[0074] A) the coding gene of the supernatant protein factor;
[0075] B) the coding gene of the supernatant protein factor and the coding gene of squalene monooxygenase ERG1;
[0076] C) the coding gene of the supernatant protein factor and the coding gene of phospholipid synthesis transcription factor IN02;
[0077] D) the coding gene of the supernatant protein factor and the coding gene of the product synthase;
[0078] E) the coding gene of the supernatant protein factor, the coding gene of squalene monooxygenase ERG1, and the coding gene of phospholipid synthesis transcription factor IN02;
[0079] F) the coding gene of the supernatant protein factor, the coding gene of squalene monooxygenase ERG1, and the coding gene of the product synthase;
[0080] G) the coding gene of the supernatant protein factor, the coding gene of phospholipid synthesis transcription factor IN02, and the coding gene of the product synthase;
[0081] H) the coding gene of the supernatant protein factor, the coding gene of squalene monooxygenase ERG1, the coding gene of phospholipid synthesis transcription factor IN02, and the coding gene of the product synthase.
[0082] In one embodiment of the present application, the construction method comprises introducing into the recombinant yeast the coding gene of the supernatant protein factor derived from the southern multi-mouse, the coding gene of squalene monooxygenase ERG1, the coding gene of phospholipid synthesis transcription factor IN02, and the coding gene of the product synthase (preferably β-amyrin synthase, ergosterol synthase, and / or lanosterol synthase).
[0083] In one embodiment of the present application, the construction method comprises introducing into the recombinant yeast a gene encoding supernatant protein factor derived from Homo sapiens, a gene encoding squalene monooxygenase ERG1, a gene encoding phospholipid synthesis transcription factor IN02, and a gene encoding product synthase (preferably β-amyrin synthase, ergosterol synthase, and / or lanosterol synthase).
[0084] In one embodiment of the present application, the construction method comprises introducing into the recombinant yeast a gene encoding supernatant protein factor derived from Gallus gallus, a gene encoding squalene monooxygenase ERG1, a gene encoding phospholipid synthesis transcription factor IN02, and a gene encoding product synthase (preferably β-amyrin synthase, ergosterol synthase, and / or lanosterol synthase).
[0085] Preferably, the construction method comprises constructing a vector (preferably a plasmid) containing the genes to be introduced, and then transforming into the recombinant yeast.
[0086] Preferably, each of the introduced genes is single copy or multiple copies.
[0087] Preferably, each of the introduced genes is expressed on a vector or on a chromosome.
[0088] Preferably, the triterpenoid compound comprises one or a combination of two or more of lupeol, cycloartenol, dammarenediol, α-amyrin, squalene, or β-amyrin. In one embodiment of the present application, the triterpenoid compound is squalene or β-amyrin.
[0089] Preferably, the sterol compound comprises lanosterol and / or ergosterol.
[0090] Preferably, the recombinant yeast comprises one or a combination of two or more of Saccharomyces cerevisiae, Pichia pastoris, Candida tropicalis, Candida utilis, Hansenula polymorpha, Schizosaccharomyces pombe, Rhodotorula mucilaginosa, Candida utilis, or Candida utilis.
[0091] In one embodiment of the present application, the recombinant yeast is Saccharomyces cerevisiae.
[0092] In one embodiment of the present application, the recombinant yeast is the recombinant yeast of the first aspect described above.
[0093] In a fifth aspect of the present application, a method for synthesizing a triterpenoid compound and / or a sterol compound is provided.
[0094] Preferably, the method comprises fermenting the recombinant yeast described above.
[0095] Preferably, the fermentation medium comprises carbon source (e.g. glucose), nitrogen source (including organic nitrogen source or inorganic nitrogen source), inorganic salt, phosphorus source, amino acid and other conventional medium components as long as the necessary components for the growth of the strain and / or the synthesis of the product are provided.
[0096] Preferably, the fermentation is a two-stage fermentation, for example, the first stage is for cell growth and the second stage is for product synthesis.
[0097] The low temperature induction can be used in the process of product synthesis. Preferably, the low temperature is any value between 20-26°C, preferably any value between 22-25°C, for example, 20, 21, 22, 23, 24, 25 or 26°C.
[0098] In one embodiment of the present application, the low temperature is 24°C.
[0099] Preferably, the triterpenoid compound comprises one or more than two combinations of lupeol, cycloartenol, dammaradienol, α-amyrin, squalene or β-amyrin. In one embodiment of the present application, the triterpenoid compound is squalene or β-amyrin.
[0100] Preferably, the sterol compound comprises lanosterol and / or ergosterol.
[0101] In the sixth aspect of the present application, the recombinant yeast obtained by the above-mentioned recombinant yeast and / or the above-mentioned construction method is used for the synthesis of triterpenoid compound and / or sterol compound.
[0102] The present application identifies the function of SPF proteins from different sources in Saccharomyces cerevisiae (e.g. verifies the effect on the synthesis of terpenoids and sterols in the metabolic pathway by fermentation), adaptive expression and regulation (e.g. the regulated expression of SPF proteins under the action of different strength constitutive and inducible promoters and the adaptive expression in different chassis hosts, which significantly improves the growth state of the cells), studies the effect of SPF proteins on the growth and metabolism of yeast cells, and applies them in the production of terpenoids (especially β-amyrin) and sterols (especially ergosterol and / or lanosterol). By adjusting the relationship between SPF and the inner membrane system (e.g. phospholipid synthesis transcription factor INO2), key enzymes in the pathway (e.g. ERG1), and product synthases (e.g. β-amyrin synthase, ergosterol synthase, and / or lanosterol synthase), a high-efficiency squalene transport system is constructed to strengthen the synthesis of terpenoids (especially β-amyrin) and sterols (especially ergosterol and / or lanosterol). Finally, the yield of terpenoids (especially β-amyrin) and sterols (especially ergosterol and / or lanosterol) synthesized by yeast is improved through pathway regulation combined with fermentation optimization.
[0103] Among them, the introduction of exogenous SPF protein can enhance the ability of Saccharomyces cerevisiae to synthesize terpenoids (especially β-amyrin) and sterols (especially ergosterol and / or lanosterol) by transporting squalene, an important precursor in the synthesis pathway of terpenoids (especially β-amyrin) and sterols, and improving the growth state of the strain.
[0104] The "comprising" or "including" described in the present application is an open description containing the specified steps described and other steps that do not materially affect. When used to describe the sequence of a protein or nucleic acid, the protein or nucleic acid can be composed of the sequence, or at one end or both ends of the protein or nucleic acid, there can be additional amino acids or nucleotides, but still have the same or similar activity as the original sequence.
[0105] The "and / or" described in the present application contains all combinations of the items connected by the term, which should be considered as each combination has been listed separately herein. For example, "A and / or B" includes "A", "A and B", and "B". For another example, "A, B, and / or C" includes "A", "B", "C", "A and B", "A and C", "B and C", and "A and B and C".
[0106] The abbreviations and full names of the present application, and the Chinese and English translations are as follows:
[0107] SPF: Supernatant protein factor, squalene transport protein, also known as supernatant protein factor;
[0108] NTS: nontranscribed spacer, non-transcribed spacer;
[0109] rDNA: Saccharomyces cerevisiae genome multicopy site;
[0110] ERG1: squalene monooxygenase;
[0111] INO2: phospholipid synthesis transcription factor;
[0112] YPD: yeast extract powder peptone glucose medium;
[0113] bAS: beta-amyrin synthase.
[0114] The Saccharomyces cerevisiae engineering bacteria of the present application have the following advantages:
[0115] 1. The yeast strain containing McSPF in the present application can express exogenous SPF protein at a specific stage by using low-temperature induction at 24℃, effectively reducing the metabolic burden of heterologous protein expression on Saccharomyces cerevisiae itself. The yield of beta-amyrin produced by the WZ48 strain after introducing SPF protein in the present application can reach 750.64±54.47mg / L, and the yield of beta-amyrin produced by 5L fermenter fermentation can reach 2112.48±90.86mg / L, promoting the industrialized production of beta-amyrin.
[0116] 2. After introducing SPF protein into Saccharomyces cerevisiae, the present application accelerates the secondary metabolic process from FPP (FPP has a greater toxic effect on cells) to 2,3-oxidosqualene, significantly improves the growth state of the strain, reduces cell toxicity, effectively shortens the culture period, and to a certain extent, can reduce the fermentation cost of the strain.
[0117] 3. The Saccharomyces cerevisiae engineering bacteria in the present application use the strategy of strengthening the mass transfer efficiency of intermediate squalene to realize the efficient synthesis of triterpenoids including squalene and beta-amyrin, and also have a certain promoting effect on the synthesis of sterol compounds such as lanosterol and ergosterol. It can be applied to the efficient synthesis of other downstream metabolic products (such as oleanolic acid, glycyrrhizic acid, diosgenin, etc.) using beta-amyrin or sterol compounds as precursors. BRIEF DESCRIPTION OF DRAWINGS
[0118] Figure 1 : Expression effect diagram of SPF from different sources in BA17 strain;
[0119] Figure 2: Fermentation results of squalene and its derivatives production after introduction of SPF protein;
[0120] Figure 3 : Fermentation results of SPF protein under different promoters and adaptive expression in different chassis hosts;
[0121] Figure 4 : Fermentation results of strains after SPF protein, phospholipid synthesis transcription factor and squalene monooxygenase are synergistically adapted;
[0122] Figure 5 : Production of β-amyrin, ergosterol and lanosterol in WZ48 strain with the extension of fermentation time;
[0123] Figure 6 : Production results of β-amyrin by Saccharomyces cerevisiae engineering strain containing high-efficiency squalene transport system. DETAILED DESCRIPTION
[0124] The application will be further described below in conjunction with specific examples. It should be understood that the following examples are only used to illustrate the application but not limit the scope of the application. The experimental methods used in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained from commercial channels unless otherwise specified.
[0125] Saccharomyces cerevisiae BA17 used in the present application (see reference Liu H, Fan J, Wang C, Li C, Zhou X. Enhanced β-Amyrin Synthesis in Saccharomyces cerevisiae by Coupling An Optimal Acetyl-CoA Supply Pathway. J Agric Food Chem. 2019 Apr 3;67(13):3723-3732. doi: 10.1021 / acs.jafc.9b00653. Epub 2019 Mar 19. PMID: 30808164.):
[0126] Example 1: Construction of plasmids of SPF gene sequences from different sources and corresponding Saccharomyces cerevisiae
[0127] The application first completes the screening and functional identification of SPF proteins from different sources in Saccharomyces cerevisiae: including squalene transporter McSPF from Mastomys coucha (protein registration sequence number XP_031197361.1), squalene transporter HsSPF from Homo sapiens (protein registration sequence number NP_036561.1) and squalene transporter GgSPF from Gallus gallus (protein registration sequence number NP_001026025.1). After Saccharomyces cerevisiae codon optimization by means of online codon analysis website (http: / / www.jcat.de / ), the SPF protein coding gene McSPF (Mastomys coucha) sequence from Mastomys coucha corresponding to the above is shown as SEQ ID NO: 1, the squalene transporter coding gene HsSPF (Homo sapiens) sequence from Homo sapiens is shown as SEQ ID NO: 2, and the squalene transporter coding gene GgSPF (Gallus gallus) sequence from Gallus gallus is shown as SEQ ID NO: 3. The strong galactose inducible promoter GAL1p in yeast is selected, and the above three SPF genes are expressed by high copy plasmid pESC-Leu, and the above genes are constructed into the multiple cloning site of plasmid pESC-Leu.
[0128] McSPF:
[0129] ATGTCTGGTAGAGTCGGTGACTTGAGTCCAAAGCAAGCTGAGACTTTGGCCAAGTTTAGAGAAAACG
[0130] TCCAAGATGTCCTTCCAGCCTTGCCAAACCCAGATGACTACTTCTTGTTGAGGTGGTTGAGGGCTAGA
[0131] AACTTCGACCTTCAAAAGAGTGAGGCCATGTTGAGGAAATATATGGAATTCAGAAAGACCATGGATAT
[0132] CGACCACATCTTGGACTGGCAGCCACCAGAAGTCATCCAGAAGTACATGCCCGGTGGACTTTGTGGT
[0133] TACGATAGAGACGGTTGCCCAGTCTGGTACGACATCATCGGACCTCTTGACCCAAAGGGTTTGTTGTT
[0134] TTCTGTTACCAAGCAAGATTTGCTTAAAACCAAGATGAGAGACTGCGAGAGAATTTTGCATGAGTGCG
[0135] ACCTTCAGACTGAGAGGTTGGGTAGGAAGATCGAGACCATTGTCATGAGTGCG
[0136] GGATTGAAGCATTTCTGGAAGCCATTGGTCGAGGTCTACCAAGAATTCTTTGGTTTGCTTGAGGAAAA
[0137] CTACCCAGAAACTTTGAAATTTATGTTGATCGTCAAGGCCACCAAGTTGTTCCCAGTTGGTTACAACT
[0138] TGATGAAACCTTTTCTTTCTGAGGACACCAGAAGGAAAATCGTCGTCTTGGGTAACAGTTGGAAGGA
[0139] GGGTCTTTTGAAATTGATCAGTCCAGAAGAGTTGCCAGCCCATTTCGGAGGAACCTTGACTGACCCA
[0140] GACGGAAACCCAAAGTGCTTGACTAAGATCAACTACGGAGGTGAGATCCCAAAGTCTATGTACGTTA
[0141] GAGACCAAGTTAAGACCCAATACGAGCACTCTGTCCAGATCTCTAGGGGAAGTTCTCACCAAGTTGA
[0142] GTACGAGATCTTGTTCCCCGGTTGCGTCTTGAGGTGGCAATTCTCTAGTGACGGTGCCGACATCGGAT
[0143] TTGGTGTTTTCTTGAAAACTAAGATGGGAGAGAGACAAAAAGCCGGTGAGATGACCGAGGTCTTGAC
[0144] CTCTCAGAGATACAACGCCCACATGGTTCCAGAAGACGGTAGTTTGACTTGTACCGAGGCTGGTGTTT
[0145] ACGTCTTGAGGTTCGACAACACCTACTCTTTCGTCCACGCCAAGAAGGTCTCTTTCACCGTCGAGGTCTTGCTTCCAGATGAGGGTATGCAGAAGTACGACGAAGAGCTTACCCCTATCTAA (SEQ ID NO: 1) HsSPF:
[0146] ATGAGTGGTAGGGTCGGAGACTTGTCTCCAAGACAGAAGGAAGCCTTGGCCAAGTTTAGAGAGAAC
[0147] GTCCAAGATGTTTTGCCAGCCTTGCCTAACCCAGATGACTACTTCTTGCTTAGGTGGCTTAGGGCTAG
[0148] AAGTTTCGACTTGCAGAAGAGTGAGGCTATGCTTAGGAAGCACGTCGAGTTTAGAAAGCAGAAAGA
[0149] CATCGACAACATCATCTCTTGGCAACCTCCAGAAGTCATCCAGCAGTACTTGTCTGGAGGTATGTGCG
[0150] GTTACGATTTGGACGGATGCCCAGTCTGGTACGACATCATTGGTCCTTTGGACGCCAAGGGTTTGTTG
[0151] TTCTCTGCCTCTAAGCAAGATTTGTTGAGAACCAAAATGAGAGAATGCGAGTTGTTGCTTCAAGAATG
[0152] CGCCCACCAGACCACTAAGTTGGGTAGGAAGGTCGAGACCATCACCATCATCTACGACTGCGAGGGA
[0153] CTTGGTTTGAAGCACTTGTGGAAGCCAGCCGTCGAAGCTTACGGTGAGTTCCTTTGCATGTTCGAGG
[0154] AAAACTACCCAGAGACCTTGAAGAGGTTGTTCGTCGTCAAGGCCCCTAAGTTGTTCCCAGTCGCCTA
[0155] CAACCTTATTAAACCTTTCCTTTCTGAAGACACTAGAAAAAAAATCATGGTCCTTGGTGCCAACTGGA
[0156] AGGAAGTTCTTTTGAAGCATATCTCTCCAGATCAAGTTCCAGTCGAGTATGGTGGAACCATGACCGAC
[0157] CCAGACGGTAATCCTAAGTGCAAAAGTAAAATCAATTACGGAGGAGATATCCCTAGGAAGTACTACGT
[0158] TAGAGACCAAGTTAAACAACAGTACGAGCACTCTGTTCAGATCAGTAGGGGTTCTTCTCATCAAGTTG
[0159] AGTATGAAATCCTTTTTCCCGGTTGCGTCTTGAGGTGGCAGTTTATGAGTGACGGTGCCGACGTTGGT
[0160] TTTGGTATCTTCCTTAAAACCAAGATGGGTGAAAGACAGAGGGCCGGTGAGATGACTGAGGTCCTTC
[0161] CAAACCAGAGGTACAACTCTCACTTGGTCCCAGAAGACGGTACTTTGACTTGTAGTGACCCCGGTATC
[0162] TACGTCTTGAGGTTCGACAACACTTATTCTTTCATCCATGCCAAAAAGGTCAACTTCACCGTCGAGGT
[0163] TCTTCTTCCAGACAAGGCCTCTGAGGAGAAGATGAAACAGTTGGGAGCCGGAACTCCAAAGTAA(SEQ ID NO: 2)
[0164] GgSPF:
[0165] ATGTCTGGTGATAGTGACTGCACTAGAACTTCTCCATCTGCTGGTTCTCCTTCTGACCCAGAAGCTTTG
[0166] CCAGATAGACCACAGTACGTCTGCAGTTTGAGTGCCGACTTGGTTACCAAGGCCAGAGAGGAATTGC
[0167] AAGAAAAGCCAGAATGGAGGTTGAGGGACGTCCAAGCCTTGAGAGACATGGTCTGCAAGGACTACC
[0168] CTTCTCTTGGAACTTGTTTGGACGACGCCTTCCTTTTGAGGTTCCTTAGGGCCAGAAAGTTCGACTAC
[0169] GATAGAGCCTTGCAGTTGTTGGTCAACTACCACTCTTGTAGGAGGTCTTGGCCAGAAGTCTTTAACAA
[0170] CTTGAAACCATCTGCCATCAAGCCAGTTCTTGAGAGTGGTTTCGTCACCGTCTTGCCAAGGCTTGATC
[0171] CAGAGGGTAGGCATGTCGTTTGCATTAGACCAGATAGATGGACCCCATCTCACTACCCAATTACCGAA
[0172] AATATTAGAGCTATTTACCTTACCCTTGAGAAGTTGATCCAGAGTGAGGAGACCCAAGTCAACGGAAT
[0173] CGTCATCTTGGCCGACTACAAAGGTGTCTCTCTTTCTAAAGCTTCTCACTTCGGTCCATTCGTCGCCAA
[0174] GAAGGTCATCGGAATCTTGCAAGATGGATTCCCAATTAGAATCAAGGCCGTCAATATTATTAATGAACC
[0175] TAGAATTTTTAAGGGGTATTTTCGCTATTATTAAACCTTTTTTGAAAGAAAAAATTGCTAATAGATTTTTC
[0176] TTGCATGGTTCTGACTTGAATTCTTTGCACCAAAACATCCCACCAGTTATCCTTCCAGAAGAATACGGT
[0177] GGTACCGCTGGAAAGTTGGACATCTCTGCTTGGAACGAGCTTTTGCTTGCCTCTGAAGAAGATTTTTTGCATGATTTTTCTTAA (SEQ ID NO: 3)
[0178] Empty plasmids and those containing P GAL1 -HsSPF-T CYC1 P GAL1 -McSPF-T CYC1 and P GAL1 -GgSPF-T CYC1 The pESC-Leu recombinant plasmid of the expression cassette was transformed into Saccharomyces cerevisiae BA17 using the LiAc transformation method. The transformed plasmid was plated on SD-Leu deficient plates and incubated at 30℃ for 2-3 days. The preparation method of the yeast transformation system is shown in Table 1. Among them, P... GAL1 Represents the promoter; T CYC1 This represents the terminator.
[0179] Table 1 Yeast Conversion (LiAc Conversion Method) Mixture
[0180] Reagents Volume (μL) ddH2O 74-X DNA fragments X SS-DNA (10.0 mg / mL) 10 PEG 3350 (50% w / v) 240 1.0 M LiAc 36
[0181] Single colonies were picked and streaked onto new SD-Leu plates. After colony PCR verification, the successfully transformed Saccharomyces cerevisiae strains containing the above-mentioned plasmid vectors were obtained and named WZ14 (empty plasmid + BA17), WZ15 (HsSPF + BA17), WZ16 (McSPF + BA17), and WZ17 (GgSPF + BA17) respectively. The primers used for colony PCR verification are shown in Table 2.
[0182] Table 2 Primers for screening positive clones of strains
[0183]
[0184] The positive recombinant colonies after transformation were screened and verified by colony PCR using 2xM5 HiPer plus Taq HiFi PCR mix from Beijing Joinnoble Biotech Co., Ltd. The PCR reaction system is shown in Table 3, the reaction program is shown in Table 4, and the PCR reaction conditions can be set according to the actual situation of primer composition and amplified fragment size, etc.
[0185] Table 3 Colony PCR reaction system (2xM5 HiPer plus Taq HiFi PCR mix)
[0186] Ingredients Volume (μL) 2x M5 HiPer plus Taq HiFi PCR mix 7.5 ddH2O 6.5 Upstream primer (5.0 μM) 0.5 Downstream primer (5.0 μM) 0.5 Total volume 15
[0187] PCR reaction conditions: steps 2 to 4, repeat 30 cycles.
[0188] Table 4 Colony PCR reaction program (2xM5 HiPer plus Taq HiFi PCR mix)
[0189] Note: During the yeast transformation process, each component must be added in order, and the DNA should be added in an amount of about 400 ng. Before the yeast colony PCR, the bacteria should be fully lysed in boiling water, then diluted with an appropriate amount of water before being used as a template.
[0190] By Figure 1 It can be seen that the BA17 strain introduced with HsSPF and GgSPF did not detect β-amyrin alcohol, while the BA17 strain introduced with McSPF could produce β-amyrin alcohol, and the yield was significantly higher than that of the control group.
[0191] Example 2: Regulation of SPF by different promoters and adaptive expression in different chassis hosts
[0192] Using pESC-McSPF plasmid as a template, the McSPF gene expression cassette P TDH3 -McSPF-T CYC1
[0193] (WZ35), P TEF1 -McSPF-T CYC1 (WZ36), P PFY1 -McSPF-T CYC1 (WZ37), P VMA6 -McSPF-T CYC1 (WZ38), P YKT6 -McSPF-T CYC1 (WZ39), P MYO4 -McSPF-T CYC1 (WZ40), P CCW12S -McSPF-TCYC1 (WZ41)
[0194] P PDC1 -McSPF-T CYC1 (WZ42), P GAL1 -McSPF-T CYC1 (WZ43), and simultaneously using pESC-Ura plasmid as a template, PCR amplification of the Ura selection gene expression cassette P URA3 -Ura-T URA3 Using yeast genomic DNA as a template, PCR amplification of rDNA homologous arms was performed. The primers used are shown in Table 5. Specific information about the strains is as follows:
[0195] Step Temperature Time Pre-denaturation 94℃ 10 min Denaturation 94℃ 30s Annealing 55℃ 30s Extension 72℃ 1 min / 4 kb Final extension 72℃ 10 min Incubation 16℃ -
[0196] The chassis strain WZ21 was modified from S. cerevisiae EBY102-100 (see: Boder, ET, & Wittrup, KD (1997). Yeast surface display for screening combinatorial polypeptide libraries.). First, the endogenous Gal4 gene in S. cerevisiae EBY102-100 was knocked out, and simultaneously, P was integrated into the GAL4 site of the yeast genome. GAL10 -GgbAS-P ACT1 -GAL4M9_TRP1 expression cassette, in which GgbAS is β-amysinol synthase derived from Glycyrrhiza glabra (protein registration number Q9MB42.1), and GAL4M9 protein is derived from a plasmid provided by Professor Hongwei Yu's research group at Zhejiang University. (See: Zhou P, Xie W, Yao Z, et al. Development of a temperature-responsive yeast cell factory using engineered Gal4 as a protein switch[J]. Biotechnology and Bioengineering, 2018, 115(5):1321-1330.)
[0197] WZ22: P is introduced at the delta site of WZ21. GAL1 -tHMG1-P GAL10 -thSQE-P GAL2 -tErg9-P GAL7 -Erg20-P TEF1tNCP1 expression cassette, which locates the key enzyme of the synthesis pathway to the cytoplasm, so as to construct a cytoplasmic squalene high-yield strain. The squalene in the chassis strain is mainly distributed in the cytoplasm, which can be used to explore the transport effect of SPF on squalene in the cytoplasm.
[0198] WZ23: P TPI1 tHMG1-P TEF1 Erg20-P GPM1 Erg9-P TYS1 Erg1 expression cassette, which locates the key enzyme of the synthesis pathway to the membrane system, so as to construct an inner membrane system squalene high-yield strain. The squalene in the chassis strain is mainly distributed in the inner membrane system, which can be used to explore the transport effect of SPF on squalene in the inner membrane system.
[0199] WZ33: P GAL1 McSPF-T CYC1 expression cassette.
[0200] WZ34: P GAL1 McSPF-T CYC1 expression cassette.
[0201] WZ35: P TDH3 McSPF-T CYC1 expression cassette.
[0202] WZ36: P TEF1 McSPF-T CYC1 expression cassette.
[0203] WZ37: P PFY1 McSPF-T CYC1 expression cassette.
[0204] WZ38: P VMA6 McSPF-T CYC1 expression cassette.
[0205] WZ39: P YKT6 McSPF-T CYC1 expression cassette.
[0206] WZ40: P MYO4 McSPF-T CYC1 expression cassette.
[0207] WZ41: P CCW12S -McSPF-T CYC1 expression cassette.
[0208] WZ42: P PDC1 -McSPF-T CYC1 expression cassette.
[0209] WZ43: P GAL1 -McSPF-T CYC1 expression cassette.
[0210] Table 5 yeast homologous recombination construction primers
[0211]
[0212] In Table 5, P URA3 represents a promoter, and T URA3 represents a terminator.
[0213] The purified expression cassette fragments were co-transformed into the Saccharomyces cerevisiae competent cells, assembled on the yeast genome by homologous recombination, screened by using the SD-His-Leu-Trp-Ura-G418 solid medium, and the positive engineering bacteria were verified by colony PCR.
[0214] The results show that the production of squalene and its derivatives of the strain after introducing SPF by fermentation is significantly higher than that of the wild type strain (see Figure 2 ), the cell density is not much different when using each exogenous promoter to start the expression of the McSPF gene, and is higher than that of the control group (see Figure 3 The upper left and right graphs, in which the introduced exogenous promoter name represents the strain, for example, TDH3 represents WZ35; TEF1 represents WZ36; PFY1 represents WZ37; VMA6 represents WZ38; YKT6 represents WZ39; MYO4 represents WZ40; CCW12S represents WZ41; PDC1 represents WZ42; and GAL1 represents WZ43.
[0215] By Figure 3 The lower left and right graphs show that when the McSPF gene is introduced into different sites of the strain, the production of the products (β-amyrin and ergosterol) is improved.
[0216] Example 3: Synergistic adaptation of SPF protein with phospholipid synthesis transcription factor IN02, squalene monooxygenase ERG1, and bAS
[0217] The gene expression cassette was PCR amplified with the Saccharomyces cerevisiae WZ33 genome in Example 3 as the template
[0218] P GAL1 -McSPF-T CYC1 -P URA3 -Ura-T URA31 , and the phospholipid synthesis transcription factor INO2 (derived from Saccharomyces cerevisiae, protein registration sequence number NP_010408.1), ERG1 (derived from Candida albicans, protein registration sequence number KAG8204682.1), bAS (derived from Glycyrrhiza glabra, protein registration sequence number Q9MB42.1) were assembled into expression cassette P TDH3 -INO2-T TRPL41B , P TYS1 -ERG1-T TYS1 , P TDH3 -INO2-T TRPL41B -P TYS1 -ERG1-T TYS1 . The HO site homologous arm and gene expression cassette P TYS1 -McSPF-T TYS1 were amplified by PCR using yeast genomic DNA as a template, and the primers used are shown in Table 6. Then strains WZ44, WZ45, WZ46, WZ47, WZ48 were constructed, and the specific information of the strains is as follows:
[0219] WZ44: P TDH3 -INO2-T TRPL41B was introduced into the HO site of the WZ33 strain.
[0220] WZ45: P TYS1 -ERG1-T TYS1 was introduced into the HO site of the WZ33 strain.
[0221] WZ46: P TDH3 -INO2-T TRPL41B -P TYS1 -ERG1-T TYS1 was introduced into the HO site of the WZ33 strain.
[0222] WZ47: P GAL1 -McSPF-T CYC1 -P TYS1 -ERG1-T TYS1 was introduced into the NTS site of the WZ22 strain.
[0223] WZ48: P was introduced into the NTS site of strain WZ22. GAL1 -McSPF-T CYC1 -P TYS1 -ERG1-T TYS1 -P FBA1 -bAS-T CYC1 .
[0224] Table 6 Primers for yeast homologous recombination construction
[0225]
[0226]
[0227] In Table 6, P TEF P TYS1 Represents the promoter, T TYS1 This represents the terminator.
[0228] After purification, the fragments obtained from the PCR amplification were co-transformed into competent Saccharomyces cerevisiae cells using the LiAc transformation method. The cells were then screened using SD-His-Leu-Trp-Ura-G418-HygR solid medium, and the colony PCR was used to verify the positive engineered bacteria.
[0229] The results are as follows Figure 4 As shown, the phospholipid synthesis transcription factor INO2 can increase the endoplasmic reticulum area, helping to accommodate more enzymes located on the endoplasmic reticulum and ultimately producing more product. However, the strain with only the INO2 gene introduced had a lower yield of β-amyrin, while the strain with both the INO2 and ERG1 genes introduced showed an increased yield of β-amyrin. The strain with only the ERG1 gene introduced had a significantly higher yield of β-amyrin than the other groups, especially after 120 hours of fermentation.
[0230] Example 4: Fermentation optimization of shake-flask conditions and product detection of engineered brewing yeast for efficient synthesis of β-amyrin.
[0231] The β-amyrin-producing engineered bacterium WZ48 obtained in Example 3 was streaked onto a corresponding resistance plate and activated for 36 hours. Single colonies after activation were picked and placed in test tubes to prepare primary seed culture for fermentation. Secondary seed culture was prepared by culturing in a shaker at 30°C, and the OD of the secondary seed culture was rapidly measured. 600 The seed culture was transferred to 100 mL shake flasks containing 25 mL of glucose (containing 2% glucose) after inoculation, ensuring that the initial OD of fermentation in each flask was maintained. 600For 0.1, a two-stage fermentation strategy was adopted, first culturing at 30℃, 200rpm shaker for 24h, then switching to 24℃ low temperature to induce expression product, continuous culturing for 7 days. Fermentation process sampling and dilution of appropriate times, rapid determination of its absorbance at 600nm wavelength.
[0232] After the end of fermentation, centrifugal 5min to collect bacteria in 2mL centrifugal tube, discard the supernatant, add equal volume of 0.45-0.55mm glass beads, add 500μL saturated sodium chloride solution, bead breakage 1h, after the end of bead beating, add equal volume of ethyl acetate vortex extraction 10min, 12000rpm centrifugal 5min, the organic phase was transferred to another new centrifugal tube with a pipette, vacuum concentrator evaporated, add equal volume of ethyl acetate repeated extraction three times, completely evaporated, add 500μL ethyl acetate dissolved, take 200μL in the liquid phase vial containing sleeve dilution appropriate times for detection of squalene, another 200μL in the liquid phase vial with vacuum concentrator evaporated, add 100μL pyridine and 100μL N,O-bis(methylsilyl) trifluoroacetamide, carefully mixed and placed in 80℃ water bath reaction 30min, the reaction liquid was transferred to the liquid phase vial containing sleeve using GC-MS detection.
[0233] Using Shimadzu GCMS-QP2010 PLUS (Shimadzu) gas chromatography-mass spectrometry analysis system, with DB-5mS column (Agilent), qualitative and quantitative analysis. The initial temperature before loading was 80℃, first heated to 290℃ at a rate of 20℃ / min, maintained for 14.5min, the sample injection amount was set to 1μL, using 10:1 split mode, the product was detected.
[0234] The results are shown in Figure 5 As shown in the table, the yield of β-amyrin of WZ48 strain reached 750.64±54.47mg / L after 24h of shake flask fermentation.
[0235] Example 5: Process scale-up and optimization of engineered Saccharomyces cerevisiae for the production of β-amyrin
[0236] The secondary seed liquid obtained in Example 4 was transferred to a 5L fermenter containing 2L fermentation medium using a flame inoculation ring at a 10% inoculation amount. The high-density fermentation parameters were set as follows: first culturing at 30℃ for 29h, then switching to 24℃ low temperature to induce expression product, stirring speed 300-800r / min, using ammonia to control pH 5.5, dissolved oxygen concentration control 30%, feeding strategy for glucose feeding 37h, then switching to ethanol for feeding, continuous culturing to 132h for product extraction, additional addition of vitamin solution and trace metal solution during the culturing process, sample treatment and product detection method see Example 4.
[0237] The fermentation medium (1 L) is as follows: yeast extract 30 g / L, tryptone 60 g / L, glucose 60 g / L, 8 g / L KH2PO4, 3 g / L MgSO4, 0.72 g / L ZnSO4·7H2O, 10 mL / L trace metal solution, and 12 mL / L vitamin solution.
[0238] The fed-batch medium (1 L) is as follows: yeast extract 10 g / L, tryptone 20 g / L, glucose 500 g / L, 9 g / L KH2PO4, 2.5 g / L MgSO4, 3.5 g / L K2SO4, 0.28 g / L Na2SO4, 10 mL / L trace metal solution, and 12 mL / L vitamin solution.
[0239] The vitamin solution (1 L) is as follows: biotin 0.05 g, calcium pantothenate 1 g, nicotinic acid 1 g, myo-inositol 25 g, thiamine hydrochloride 1 g, pyridoxal hydrochloride 1 g, and p-aminobenzoic acid 0.2 g.
[0240] The trace metal solution (1 L) is as follows: EDTA 15 g, ZnSO4·7H2O 5.75 g, MnCl2·4H2O 0.32 g, anhydrous CuSO4 0.5 g, CoCl2·6H2O 0.47 g, Na2MoO4·2H2O 0.48 g, CaCl2·2H2O 2.9 g, and FeSO4·7H2O 2.8 g.
[0241] The results, as shown in Table 1, show that the yield of β-amyrin produced by the WZ48 strain in a 5 L fermenter reached 2112.48 ± 90.86 mg / L. Figure 6 The results, as shown in Table 1, show that the yield of β-amyrin produced by the WZ48 strain in a 5 L fermenter reached 2112.48 ± 90.86 mg / L.
Claims
1. A recombinant yeast for synthesizing triterpenoids and / or sterols, characterized in that, The recombinant yeast expressed any of the following groups: A) Protein factors in the supernatant; B) Supernatant protein factors and squalene monooxygenase ERG1; C) Supernatant protein factors, squalene monooxygenase ERG1, and phospholipid synthesis transcription factor INO2; or, D) Supernatant protein factors, squalene monooxygenase ERG1, and β-amysinol synthase; The supernatant protein factor was derived from Southern multi-lactate rats, and the squalene monooxygenase ERG1 was derived from... Candida albicans The phospholipid synthesis transcription factor INO2 is derived from Saccharomyces cerevisiae The gene encoding the protein factor derived from the supernatant of the southern multi-lactated rat is the nucleotide sequence shown in SEQ ID NO: 1, and the β-amysinol synthase is derived from... Glycyrrhiza glabra ; The triterpenoid compound mentioned is β-amyrin; The sterol compounds mentioned are lanosterol and / or ergosterol; The yeast mentioned is brewer's yeast.
2. A method for constructing recombinant yeast for synthesizing triterpenoids and / or sterols, characterized in that, The construction method includes introducing any one of the following groups into recombinant yeast: A) Genes encoding protein factors in the supernatant; B) The coding genes for supernatant protein factors and squalene monooxygenase ERG1; C) The coding genes for supernatant protein factors, squalene monooxygenase ERG1, and phospholipid synthesis transcription factor INO2; or, D) The coding genes for supernatant protein factors, squalene monooxygenase ERG1, and β-amysinol synthase. The supernatant protein factor was derived from Southern multi-lactate rats, and the squalene monooxygenase ERG1 was derived from... Candida albicans The phospholipid synthesis transcription factor INO2 is derived from Saccharomyces cerevisiae The gene encoding the protein factor derived from the supernatant of the southern multi-lactated rat is the nucleotide sequence shown in SEQ ID NO: 1, and the β-amysinol synthase is derived from... Glycyrrhiza glabra ; The triterpenoid compound mentioned is β-amyrin; The sterol compounds mentioned are lanosterol and / or ergosterol; The yeast mentioned is brewer's yeast.
3. A method for synthesizing triterpenoids and / or sterols, characterized in that, The method includes fermenting and culturing the recombinant yeast of claim 1, and / or the recombinant yeast obtained by the construction method of claim 2, wherein the triterpenoid compound is β-amyrin; and the sterol compound is lanosterol and / or ergosterol.