A PTX3 expression modulator; prophylactic or therapeutic agent for vasculitis or skin sclerosis associated with rheumatoid arthritis and autoimmune disease, or method for improving same

Abstract

The present invention relates to a novel PTX3 expression regulating agent, in which the expression regulating agent comprises microparticles, the microparticles comprise miRNA having a gene related to the expression of PTX3 as a target gene, and the expression regulating agent of PTX3 can regulate the expression of PTX3 using the miRNA from the microparticles; a prophylactic or therapeutic agent for vasculitis or skin sclerosis associated with rheumatoid arthritis and autoimmune diseases; the present invention relates to a method for improving vasculitis or skin sclerosis associated with rheumatoid arthritis and autoimmune diseases. The microparticles are preferably exosomes.

Description

Technical Field

[0001] The present invention relates to a PTX3 expression regulator; a preventive or therapeutic drug for rheumatoid arthritis, vasculitis or skin sclerosis associated with autoimmune diseases; and a method for improving rheumatoid arthritis, vasculitis or skin sclerosis associated with autoimmune diseases. Background Art

[0002] Pentraxin 3 (PTX3) is also known as TSG-14 (TNF-induced gene 14 protein). PTX3 is a member of the pentraxin superfamily, which is composed of an evolutionarily conserved group of proteins characterized by the pentraxin domain as a structural motif. PTX3 is produced by various cell types such as endothelial cells, smooth muscle cells, adipocytes, fibroblasts, mononuclear macrophages, dendritic cells, etc. The expression of PTX3 is induced by primary inflammatory signals such as IL-1, TNF (Tumor necrosis factor), and microorganisms. PTX3 is an acute phase glycoprotein that plays a role in innate immune resistance to pathogens, inflammation, tissue remodeling and repair, female reproductive capacity, and cancer regulation. In addition, pentraxin 3 is a biomarker for cardiovascular disease, and elevated plasma pentraxin 3 concentrations have been found in patients with cardiovascular disease.

[0003] In recent years, it has been known that PTX3 is associated with rheumatoid arthritis (Non-Patent Document 1). Non-Patent Document 1 describes that PTX3 increases in synovial fluid of rheumatoid arthritis and that the progression of rheumatoid arthritis can be suppressed by inhibiting PTX3.

[0004] In addition, PTX3 is known to inhibit vasculitis associated with autoimmune diseases (Non-Patent Document 2).

[0005] On the other hand, research on microRNA (miRNA) has been conducted, but the functions and target genes of miRNA related to PTX3 are still unclear.

[0006] Prior art literature

[0007] Non-patent literature

[0008] Non-patent literature 1: Int. J. Med. Sci., (2021) 18(8): 1886-1898;

[0009] Non-patent literature 2: Front. Immunol., (2019) 10, 1135. Summary of the invention

[0010] Problems to be solved by the invention

[0011] Non-Patent Documents 1 and 2 do not describe miRNA.

[0012] The problem to be solved by the present invention is to provide a novel PTX3 expression regulator that can regulate the expression of PTX3 using microparticle-derived miRNA.

[0013] Means for solving problems

[0014] The present inventors have discovered that microparticles containing specific microRNAs can regulate (inhibit or inhibit, etc.) the expression of PTX3 protein and / or PTX3 gene (Ptx3).

[0015] Specifically, the present invention and preferred configurations of the present invention are as follows.

[0016] [1] A PTX3 expression regulator, wherein the expression regulator comprises microparticles,

[0017] The microparticles contain miRNAs that target genes related to PTX3 expression.

[0018] [2] The PTX3 expression regulator according to [1], wherein the microparticles are exosomes.

[0019] [3] The PTX3 according to [1], comprising at least one of hsa-miR-224-5p, has-miR-374c-5p and hsa-miR-655-3p as a miRNA having a gene related to the expression of PTX3 as a target gene.

[0020] [1] The PTX3 expression regulator according to [1], wherein the miRNA targeting a gene related to PTX3 expression contains at least hsa-miR-224-5p.

[0021] [5] The PTX3 expression regulator according to [1], wherein the miRNA targeting a gene related to PTX3 expression comprises hsa-miR-224-5p and hsa-miR-655-3p.

[0022] [6] The PTX3 expression regulator according to [1], wherein the microparticles contain miRNA at a higher concentration than that in the culture supernatant of dental pulp-derived stem cells, and the miRNA targets a gene related to PTX3 expression.

[0023] [7] The PTX3 expression regulating agent according to [1], wherein the microparticles are microparticles purified and separated from the culture supernatant of stem cells derived from dental pulp,

[0024] The microparticles do not contain components obtained by removing exosomes from the culture supernatant of dental pulp-derived stem cells.

[0025] [8] A preventive or therapeutic agent for rheumatoid arthritis, vasculitis associated with autoimmune diseases, or skin sclerosis, comprising the PTX3 expression regulator according to [1] as an active ingredient.

[0026] [9] The preventive or therapeutic drug for rheumatoid arthritis, vasculitis associated with autoimmune diseases, or skin sclerosis according to [8], which is a preventive or therapeutic drug for skin sclerosis and is a skin ointment.

[0027]

[10] A method for improving rheumatoid arthritis, vasculitis associated with autoimmune diseases, or skin sclerosis, comprising administering an effective amount of the PTX3 expression regulator according to [1] or an effective amount of the preventive or therapeutic drug for rheumatoid arthritis, vasculitis associated with autoimmune diseases, or skin sclerosis according to [8] to a subject suffering from rheumatoid arthritis, vasculitis associated with autoimmune diseases, or skin sclerosis.

[0028] Effects of the Invention

[0029] According to the present invention, a novel PTX3 expression regulator can be provided, which can regulate the expression of PTX3 using miRNA derived from microparticles. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] [ Figure 1 ] Figure 1 It is a heat map showing the expression level of miRNA which targets genes related to PTX3 expression and is expressed in exosomes purified from the culture supernatant of dental pulp-derived stem cells (expression regulator of Example 1).

[0031] [ Figure 2 ] Figure 2 It is a heat map showing the expression level of miRNAs that target genes related to TSP1 expression and are expressed in exosomes purified from the culture supernatant of dental pulp-derived stem cells (expression regulator of Example 1).

[0032] [ Figure 3 ] Figure 3 It is a graph showing the quantitative expression levels of PTX3 gene and TSP-1 gene in each case. DETAILED DESCRIPTION

[0033] Hereinafter, the present invention will be described in detail. The description of the constituent elements described below is sometimes based on representative embodiments or specific examples, but the present invention is not limited to such embodiments. It should be noted that in this specification, the numerical range represented by "to" means a range including the numerical values ​​described before and after "to" as the lower limit and the upper limit.

[0034] [PTX3 expression regulator]

[0035] In the PTX3 expression regulating agent of the present invention, the expression regulating agent includes microparticles, and the microparticles include miRNA that targets a gene related to the expression of PTX3.

[0036] The PTX3 expression regulator of the present invention can regulate the expression of PTX3 using miRNA from microparticles. As a result, the PTX3 expression regulator of the present invention can preferably improve, more preferably prevent or treat rheumatoid arthritis, vasculitis or skin sclerosis associated with autoimmune diseases.

[0037] The preferred embodiment of the PTX3 expression regulator of the present invention is described below. It should be noted that, when the preferred embodiment of the TSP-1 expression regulator is not described separately, the description of the preferred embodiment of the PTX3 expression regulator of the present invention is also applicable to the description of the preferred embodiment of the TSP-1 expression regulator.

[0038] <Rheumatoid arthritis and vasculitis associated with autoimmune diseases>

[0039] First, the use of the PTX3 expression regulating agent of the present invention for improving rheumatoid arthritis and vasculitis associated with autoimmune diseases will be described.

[0040] In the present invention, vasculitis is a general term for diseases in which inflammation is observed in blood vessels themselves, and as a result, bleeding, blood flow disorders, and infarctions occur, leading to organ disorders. Vasculitis is also called vasculitis syndrome or systemic vasculitis.

[0041] (According to the classification of CHCC2012)

[0042] Vasculitis is sometimes classified according to the diameter of the blood vessels that produce the main inflammation. In the classification based on the blood vessel diameter, it is usually classified according to the following CHCC (Chapel Hill Consensus Conference) 2012. The PTX3 expression modulator of the present invention is used to improve rheumatoid arthritis included in "VI. Vasculitis associated with systemic diseases" and vasculitis associated with various autoimmune diseases even in these vasculitis.

[0043] As vasculitis associated with various autoimmune diseases, it is used to improve Takayasu's arteritis included in "I. Large vessel vasculitis", microscopic polyangiitis (MPA) and immune complex small vessel vasculitis (cryoglobulinemia vasculitis, etc.) as vasculitis associated with autoimmune diseases included in "III. Small vessel vasculitis", Behcet's disease included in "IV. Vasculitis invading various blood vessels", and vasculitis associated with autoimmune diseases (except rheumatoid arthritis) included in "VI. Vasculitis associated with systemic diseases".

[0044] I. Large vessel vasculitis

[0045] (I-1) Takayasu's arteritis: It is mostly granulomatous vasculitis, invading the aorta and its main branches. The main features are systemic inflammation, pain caused by vasculitis, and vascular stenosis / blockage / dilation. Even after the inflammation subsides, various organ disorders and aneurysms caused by blood flow obstruction remain a problem. The mechanism of occurrence is speculated as follows: With genetic factors as the background and environmental factors such as infection as the opportunity, elastic arteries, mainly aortas, are destroyed by autoimmune mechanisms. The pathological characteristics of Takayasu's arteritis are erosion images of elastic fibers in the media starting from the adventitia side. CD4-positive T cells, CD8-positive T cells, macrophages, NK cells, γδT cells, etc. were found in the infiltrating cells, and some macrophages were observed as multinucleated giant cells that phagocytized fragmented elastic fibers. It is believed that these cells damage the vascular wall accompanied by cytokine abnormalities. As therapeutic drugs, steroids, immunosuppressants, biological agents (tocilizumab, TNF inhibitors, etc.), antiplatelet drugs, etc. are used.

[0046] (I-2) Giant cell vasculitis: It is mostly granulomatous vasculitis, invading the large arteries and their main branches. It often invades the carotid artery, the branches of the vertebral artery or the temporal artery.

[0047] II. Medium-vessel vasculitis (mostly inflammatory aneurysm or stenosis)

[0048] (II-1) Polyarteritis nodosa (PAN): This is a necrotizing small-vessel vasculitis that does not cause glomerulonephritis, arteritis, capillaritis, or venulitis. It is not associated with antineutrophil cytoplasmic antibodies (ANCA).

[0049] (II-2) Kawasaki disease: It is a vasculitis associated with mucocutaneous lymph node syndrome. It mainly affects small and medium-sized blood vessels. It frequently affects coronary arteries. Sometimes it also affects large arteries or large blood vessels.

[0050] III. Small vessel vasculitis

[0051] (III-1) ANCA-associated vasculitis: including microscopic polyangiitis (MPA), granulomatosis with polyangiitis (GPA) (formerly known as Wegener's granulomatosis), and eosinophilic granulomatosis with polyangiitis (EGPA) (formerly known as Churg-Strauss syndrome).

[0052] Microscopic polyangiitis (MPA) is a necrotizing vasculitis with small blood vessels as the main body, with almost no immune complex deposition. As the main symptoms, they can be listed as: acute progressive glomerulonephritis, pulmonary hemorrhage or interstitial pneumonia, organ symptoms other than kidney / lung (purpura, subcutaneous hemorrhage, gastrointestinal bleeding, multiple mononeuritis, fever, weight loss, fatigue). As the mechanism of occurrence, it is speculated that the autoimmune mechanism is involved, that is, the so-called genetic factors and environmental factors interact with each other, producing ANCA as an autoantibody, causing vascular endothelial disorder. In the pathological state of vascular endothelial cell disorder caused by MPA, it is believed that inflammatory cytokines such as TNF-α, ANCA, MPO, and neutrophil activation are involved. It is speculated that the ANCA produced by the autoimmune mechanism overactivates inflammatory cytokines and neutrophils together, releases a fine fiber network (chromatin fiber) such as neutrophil extracellular traps containing proteolytic enzymes located in neutrophils, and damages the vascular endothelium. The mainstay of treatment is glucocorticoids (GC) and immunosuppressants including rituximab.

[0053] (III-2) Immune complex small vessel vasculitis: including anti-glomerular basement membrane antibody disease (anti-GBM disease), cryoglobulinemia vasculitis, IgA vasculitis (formerly known as Henlein-Schönlein purpura) and low complement urticarial vasculitis (anti-C1q vasculitis).

[0054] The group of patients who present with immune complex vasculitis syndromes containing cryoglobulinemia vasculitis (CG) is referred to as cryoglobulinemia vasculitis. CGemia is frequently found in autoimmune diseases.

[0055] IV. Vasculitis affecting various blood vessels

[0056] (IV-1) Behcet's disease: Vasculitis that occurs in patients with Behcet's disease (characterized by recurrent stomatitis and genital ulcers, combined with inflammatory lesions of the skin, eyes, joints, digestive tract, and central nervous system), invading arteries or veins, causing small vessel vasculitis, thrombosis, arteritis, and aneurysm.

[0057] Two mechanisms, autoimmunity and autoinflammation, contribute to the pathological state.

[0058] (IV-2) Cogan syndrome: Vasculitis that occurs in patients with Cogan syndrome (characterized by inflammatory eye diseases such as interstitial keratitis, uveitis, and episcleritis, and inner ear diseases such as sensorineural hearing loss and vestibular dysfunction). Arteritis (small vessels, medium vessels, and large vessels), large arteritis, large artery aneurysms, large artery valvulitis, and mitral valvulitis may occur.

[0059] V. Vasculitis affecting a single organ

[0060] Including cutaneous leukocytoclastic vasculitis, cutaneous arteritis, cutaneous small vessel vasculitis, localized vasculitis of the central nervous system, sporadic large arteritis, testicular arteritis, etc.

[0061] VI. Vasculitis associated with systemic disease

[0062] Including lupus vasculitis, rheumatoid vasculitis, sarcoid vasculitis, etc. Including vasculitis associated with autoimmune diseases (autoimmune diseases with vasculitis).

[0063] (VI-1) Rheumatoid vasculitis (RA) includes rheumatoid vasculitis (RV) of small and medium vascular vasculitis. The pathogenesis of rheumatoid vasculitis is unclear, but the mechanism is believed to be the participation of autoantibodies targeting blood vessels, inflammation caused by immune complex deposition, activation of local cellular immunity, etc. There are deposits of immunoglobulins, C3, and C4 in the inflammatory local area of ​​vasculitis. High rheumatoid factor levels, positive immune complexes, low complement values, etc. in serum are found in RV, and it is believed that there are immunological abnormalities stronger than RA. Treatment strategies include: steroids, steroid pulse therapy, methotrexate (MTX), azathioprine (AZA), cyclophosphamide (CY), TNF inhibitors, tocilizumab (TCZ), rituximab (RTX), and abatacept.

[0064] (VI-2) Vasculitis associated with autoimmune diseases includes Buerger's disease, etc. Buerger's disease is a segmental lesion of the arteries and veins of the limbs that is common in men aged 20 to 40. The mechanism of occurrence includes infection, malnutrition, autoimmunity, etc. in addition to smoking.

[0065] VII. Vasculitis of known cause

[0066] Including hepatitis C virus (HCV)-related cryoglobulinemia vasculitis; hepatitis B virus (HBV)-related vasculitis; syphilis-related Takayasu arteritis; drug-related immune complex vasculitis; drug-related ANCA-associated vasculitis; cancer-related vasculitis; hydralazine-related microscopic polyangiitis, etc.

[0067] <Skin Hardening>

[0068] Next, the case where the PTX3 expression regulating agent of the present invention is used to improve skin sclerosis will be described.

[0069] Skin sclerosis refers to the occurrence of skin fibrosis, the occurrence of dermal sclerosis, other scleroderma, etc. It should be noted that other scleroderma include systemic scleroderma and localized scleroderma.

[0070] Skin fibrosis refers to a phenomenon in which a substance called extracellular matrix such as collagen fibers (collagen) increases in the skin or internal organs, resulting in hardening of the skin or internal organs.

[0071] Dermal sclerosis refers to the entire process of dermal hardening. For example, dermal sclerosis develops with age. Dermal sclerosis caused by age increase occurs due to atrophy of surface blood vessels, etc. Dermal sclerosis associated with age increase induces age-related changes in epidermal stem cells such as fragility of hemidesmosomes, abnormal division axis, and early differentiation. In contrast, if surface blood vessels are artificially induced, the dermis of aging skin softens, and the hardness of tissues that rely on blood vessels can be improved. In addition, age-related changes in epidermal stem cells can also be improved.

[0072] Systemic sclerosis occurs due to a combination of immune abnormalities (autoimmune diseases), fibrosis, vascular abnormalities, etc. In systemic sclerosis, skin hardening begins from the fingers and progresses continuously from the back of the hand to the forearm toward the proximal end (the side close to the trunk).

[0073] Localized scleroderma is a disease in which a clear-cut sclerosis appears on a localized area of ​​skin, which is completely different from systemic scleroderma. Localized scleroderma is an autoimmune disease caused by an autoimmune response to somatic cell mosaicism.

[0074] The PTX3 expression modulator of the present invention is preferably used to improve at least the sclerosis of the dermis even in these skin sclerosis. PTX3 is a factor that has the effect of inhibiting angiogenesis, and its expression increases with age. By regulating the expression of PTX3, the atrophy or degeneration of the surface blood vessels accompanying the increase in age is alleviated, the dermis is softened, and the skin sclerosis can be improved. In addition, since the PTX3 expression modulator of the present invention can improve autoimmune diseases, it can also improve systemic scleroderma and localized scleroderma.

[0075] <Microparticles>

[0076] The PTX3 expression regulating agent of the present invention comprises microparticles.

[0077] In the present invention, the microparticles contain miRNA targeting a gene related to the expression of PTX3.

[0078] Microparticles are derived from stem cells from the dental pulp, etc., and leached, released or fallen into the cell culture medium, for example, by secretion, budding or dispersion of mesenchymal stem cells such as stem cells from the dental pulp. Microparticles are preferably contained in the culture supernatant of stem cells from the dental pulp, etc., and more preferably microparticles derived from the culture supernatant of stem cells from the dental pulp. However, microparticles derived from the culture supernatant of stem cells from the dental pulp do not necessarily need to be obtained from the culture supernatant of stem cells from the dental pulp. For example, even if microparticles are obtained by separating microparticles inside stem cells from the dental pulp by any method, as long as they are the same microparticles as those that can be separated from the culture supernatant of stem cells from the dental pulp, they can be called microparticles derived from the culture supernatant of stem cells from the dental pulp.

[0079] The microparticles derived from the culture supernatant of dental pulp-derived stem cells or the like may be used in a state contained in the culture supernatant or in a state purified from the culture supernatant. The microparticles are preferably microparticles purified from the culture supernatant.

[0080] The source of the microparticles can be determined by known methods. For example, the method described in J Stem Cell Res Ther (2018) 8:2 can be used to determine whether the microparticles are derived from dental pulp stem cells, adipose stem cells, bone marrow stem cells, umbilical cord stem cells, etc. Specifically, the source of each microparticle can be determined based on the miRNA pattern of the microparticles.

[0081] (miRNA)

[0082] In the present invention, the microparticles contain miRNA targeting a gene related to the expression of PTX3.

[0083] In the present invention, miRNA (microRNA) is, for example, an RNA molecule of 21 to 25 bases (nucleotides). MiRNA can regulate gene expression by degradation of target gene mRNA or inhibition in the decoding stage.

[0084] In the present invention, miRNA may be, for example, single-stranded (monomer) or double-stranded (dimer). In the present invention, miRNA is preferably a mature miRNA obtained by cleavage by ribonucleases such as Dicer.

[0085] It should be noted that the sequence of the miRNA recorded in this specification such as hsa-miR-224-5p is associated with the accession number and logged in a known database (such as miRBase database), and a person skilled in the art can uniquely determine the sequence. For example, the accession number of hsa-miR-224-5p is MIMAT0000281, and a sequence is logged in the miRBase database. Below, the accession number of each miRNA is omitted.

[0086] However, the miRNA in this specification also includes variants with 1 to 5 bases different from mature miRNAs such as hsa-miR-224-5p. In addition, each miRNA in this specification includes a polynucleotide having the function of the miRNA in the present invention, which is a polynucleotide consisting of a base sequence having the same identity as the base sequence of each miRNA (e.g., hsa-miR-224-5p), or a polynucleotide consisting of their complementary base sequences. "Identity" refers to the degree of identity when the sequences to be compared are appropriately aligned with each other, meaning the correct consistent occurrence rate (%) of the amino acids between the above sequences. Alignment can be performed using any algorithm such as BLAST, for example. Identity is, for example, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or about 99%. A polynucleotide consisting of a base sequence having identity may have a point mutation, deletion and / or addition in the base sequence of the miRNA, for example. The number of bases of the above-mentioned point mutations, etc. is, for example, 1 to 5, 1 to 3, 1 to 2 or 1. In addition, the polynucleotide consisting of the complementary base sequence, for example, includes a polynucleotide having the function of the miRNA in the present invention, which hybridizes with the polynucleotide consisting of the base sequence of the miRNA under strict conditions. As stringent conditions, there are no particular limitations, and for example, the conditions described in

[0028] of Japanese Patent Publication No. 2017-184642 can be cited, and the contents of the publication are incorporated into this specification as a reference.

[0087] In the present invention, the microparticles preferably contain miRNA targeting a gene related to the expression of PTX3 at a concentration higher than that in the culture supernatant of dental pulp stem cells. In addition, the microparticles preferably contain miRNA targeting a gene related to the expression of TSP-1 at a concentration higher than that in the culture supernatant of dental pulp stem cells. The preferred embodiment of the miRNA contained in the microparticles is described below.

[0088] (1) miRNA targeting genes related to PTX3 expression

[0089] Non-patent document 1 (Int. J. Med. Sci., (2021) 18(8): 1886-1898) states that PTX3 increases in the synovial fluid of rheumatoid arthritis; or that the progression of rheumatoid arthritis can be inhibited by inhibiting PTX3.

[0090] In addition, PTX3 can block vasculitis associated with autoimmune diseases (Non-patent document 2: Front. Immunol., (2019) 10, 1135).

[0091] PTX3 is an acute inflammatory protein that is expressed in vascular endothelial cells, macrophages, fibroblasts, smooth muscle cells, etc., and its expression is enhanced depending on inflammatory stimulation. Therefore, PTX3 has become a marker for ischemic heart diseases such as myocardial infarction and arteriosclerosis.

[0092] Therefore, miRNAs that target genes related to PTX3 expression (known examples include hsa-miR-224-5p, has-miR-374c-5p, and hsa-miR-655-3p) can effectively serve as preventive or therapeutic drugs for rheumatoid arthritis, vasculitis associated with autoimmune diseases, or skin sclerosis.

[0093] It should be noted that the reduced expression of miR-224 promotes the formation of fragile atherosclerotic plaques and vascular remodeling in acute coronary syndrome (ACS) through the activation of the TGF-β / Smad pathway (J. Cell. Physiol. (2018) 234, 2537-2551).

[0094] When studying the role of lncRNA AK087124 and miR-224-5p in atherosclerosis, AK087124 was upregulated in the plasma and plaques of atherosclerotic mice compared with normal mice, while miR-224-5p was downregulated. MiR-224-5p inhibits PTEN to suppress apoptosis and inflammatory response (Archives of Biochemistry and Biophysics, (2021) 705, 15: 108916).

[0095] In the present invention, when the microparticles contain miRNA targeting a gene related to PTX3 expression (preferably PTX3 gene), the microparticles preferably function as expression regulators of the gene related to PTX3 expression. The microparticles are preferably PTX3 expression inhibitors.

[0096] In this case, in the present invention, the microparticles preferably contain at least one of hsa-miR-224-5p, has-miR-374c-5p and hsa-miR-655-3p, more preferably contain at least hsa-miR-224-5p, particularly preferably contain hsa-miR-224-5p and hsa-miR-655-3p, and even more particularly preferably contain all of hsa-miR-224-5p, has-miR-374c-5p and hsa-miR-655-3p.

[0097] The microparticles preferably contain at least one of the miRNAs with a gene related to the expression of PTX3 as a target gene at a Log2Ratio of 2.0 or more, more preferably 4.0 or more, and particularly preferably 6.0 or more of the read counts obtained by IMOTA analysis. The microparticles preferably contain hsa-miR-224-5p and hsa-miR-655-3p at a Log2Ratio of 4.0 or more of the read counts obtained by IMOTA analysis, and more preferably contain hsa-miR-224-5p at a Log2Ratio of 6.0 or more.

[0098] The expression level of hsa-miR-224-5p in the microparticles is preferably 1.1 times or more, more preferably 1.5 times or more, and particularly preferably 2 times or more, compared to exosomes obtained from the culture supernatant of adipose-derived stem cells or exosomes obtained from the culture supernatant of umbilical cord-derived stem cells.

[0099] When the microparticles are PTX3 expression inhibitors, the expression of the PTX3 gene in any cell can be suppressed preferably by 0.8 times or less, more preferably by 0.7 times or less, and particularly preferably by 0.6 times or less, compared to normal (untreated) cells.

[0100] (2) miRNA targeting genes related to thrombospondin 1 expression

[0101] Thrombospondin 1 is widely known as an angiogenesis inhibitor. miR-18 and miR-19 regulate the expression of connective tissue growth factor (CTGF) and thrombospondin 1 (TSP-1) proteins in the extracellular matrix (ECM) in age-related heart failure. Due to aging, miR-18 and miR-19 decrease, and if the levels of CTGF and TSP-1 increase, heart damage is more likely to occur (Aging Cell, 10, 5, 769-779 (2011)).

[0102] Thrombospondin 1 (TSP1) is a target of miR-221. MiR-221 significantly inhibits Nx-induced upregulation of TSP1 and p-SMAD3 in the heart, reduces myocardial fibrosis (picro-sirius), and improves cardiac function (Mol. Ther. Nucleic Acids (2020) 22; 803-814).

[0103] Therefore, miRNAs targeting genes related to thrombospondin 1 expression (hereinafter referred to as TSP1-related miRNA group) are effective as therapeutic agents for vasculitis.

[0104] TSP1-related miRNA group:

[0105] hsa-let-7a-5p, hsa-let-7b-5p, hsa-let-7c-5p, hsa-let-7d-5p, hsa-let-7e-5p,

[0106] hsa-let-7f-5p, hsa-let-7g-5p, hsa-let-7i-5p, hsa-miR-101-3p, hsa-miR-125a-3p,

[0107] hsa-miR-1273g-3p, hsa-miR-132-3p, hsa-miR-139-5p, hsa-miR-141-3p, hsa-miR-143-3p,

[0108] hsa-miR-144-3p, hsa-miR-155-5p, hsa-miR-182-5p, hsa-miR-194-5p, hsa-miR-198,

[0109] hsa-miR-19a-3p, hsa-miR-19b-3p, hsa-miR-205-5p, hsa-miR-206, hsa-miR-211-3p,

[0110] hsa-miR-212-3p, hsa-miR-221-3p, hsa-miR-222-3p, hsa-miR-27b-3p, hsa-miR-297,

[0111] hsa-miR-300, hsa-miR-30a-3p, hsa-miR-30a-5p, hsa-miR-3149, hsa-miR-331-3p,

[0112] hsa-miR-338-3p, hsa-miR-340-5p, hsa-miR-3609, hsa-miR-3665, hsa-miR-377-3p,

[0113] hsa-miR-377-5p, hsa-miR-381-3p, hsa-miR-382-5p, hsa-miR-410-3p, hsa-miR-411-3p,

[0114] hsa-miR-4257, hsa-miR-4270, hsa-miR-4450, hsa-miR-4458, hsa-miR-4495,

[0115] hsa-miR-4500, hsa-miR-455-3p, hsa-miR-4655-5p, hsa-miR-4739, hsa-miR-491-5p,

[0116] hsa-miR-493-3p, hsa-miR-493-5p, hsa-miR-5003-5p, hsa-miR-509-5p, hsa-miR-5096

[0117] hsa-miR-543, hsa-miR-582-5p, hsa-miR-613, hsa-miR-650, hsa-miR-657,

[0118] hsa-miR-675-3p, hsa-miR-7-1-3p, hsa-miR-766-5p, hsa-miR-98-5p.

[0119] In the TSP1-related miRNA group, in addition to the above-mentioned miR-19 and miR-221, the following specific miRNAs are known to also improve vasculitis.

[0120] (2-1) hsa-let-7a-5p, hsa-let-7b-5p, hsa-let-7f, hsa-miR-132-3p related

[0121] Overexpression of let-7a and let-7b inhibits endothelial cell apoptosis, NO deficiency, excessive production of reactive oxygen species, increased expression of LOX-1, and downregulation of endothelial nitric oxide synthase (eNOS) caused by oxLDL. Let-7a and let-7b have a protective effect against endothelial cell damage caused by oxidized low-density lipoprotein (Plos one (2014) 9, (9): e106540).

[0122] The secreted exosomal miRs (miR-210, miR-23a-3p, miR-424, let-7f, miR-30b, miR-30c, miR-126, miR-21, miR-132, miR-130a-3p, miR-214, miR-378, miR-126, miR-133, let-7b-5p) induce angiogenesis and vascular regeneration in the heart, thereby increasing blood flow to the ischemic myocardium and protecting against myocardial ischemia (Heart Failure Revies, (2021) 26(1), 205-213).

[0123] Extracellular vesicles (hADSC-EVs) derived from human adipose-derived stem cells promote exogenous angiogenesis and enhance proliferation, migration, tube formation, and VEGF secretion of vascular endothelial cells. The let-7 family, one of the hypoxia-related microRNAs, is enriched in hypoxic hADSC-EVs that contribute to angiogenesis via the let-7 / Argonaute 1 (AGO1) / VEGF signaling pathway (Sci. Rep. (2020) 10(1):5313).

[0124] Let-7a-5p targets IGF2BP3 and inhibits cardiomyocyte death (Int. J. Mol. Med. (2020) 45(2): 451-460).

[0125] (2-2) hsa-miR-143-3p related

[0126] miR-143-3p mimics further improved the expression of TC, TG and LDLC in the blood of rabbits with coronary heart disease (CHD) (AM J Trans Res (2019) 11(6): 3610-3619).

[0127] Although miR-143-3p regulates both cellular and exosome-mediated responses of pulmonary vascular cells, inhibition of miR-143-3p blocked experimental pulmonary hypertension (Circ Res. (2015) 117:870-883).

[0128] miR-145 and miR-143 are direct transcriptional targets of serum response factor, myocardin and Nkx2-5 (NK2 transcription factor related, locus 5), and are downregulated in damaged or atherosclerotic blood vessels containing proliferating poorly differentiated smooth muscle cells. miR-145 and miR-143 use a network of transcription factors such as Klf4 (Kruppel-like factor 4), myocardin, and Elk-1 (ELK1, a member of the ETS oncogene family) as synergistic targets to promote smooth muscle differentiation and inhibit proliferation (Nature (2009) 460, 705-710).

[0129] (2-3) hsa-miR-221-3p related

[0130] miR-221 exhibits significant cardioprotective and anti-apoptotic properties, improving the efficiency of cardiomyocyte transplantation and cardiac regeneration, and is therefore considered to be beneficial (BioMed Research International (2015) Vol. 2015, 354517, p. 18).

[0131] The fact that precursor cells from human blood, endothelial precursor cells, umbilical vein endothelial cells (ECs) and resting endothelial cells express miR-221 / 222 at high levels suggests an important role for this miRNA cluster in endothelial (pathological) physiology (Curr. Vasc. Pharmacol. (2017) 15(1):40-46).

[0132] (2-4) Correlation between hsa-miR-30a-3p and hsa-miR-30a-5p

[0133] Apo E- / - mice treated with miR-30a-5p-ago significantly reduced the lesion area of ​​the aorta and the base of the aorta, reduced the levels of lipoproteins and inflammatory cytokines, and increased the levels of anti-inflammatory cytokines. In Apo E- / - mice treated with miR-30a-5p-ago and RAW264.7 macrophages treated with LPS, the ratio of M1 / M2 macrophages was reduced by regulating Smad-1 / 2 phosphorylation (Mol. Ther. Nucleic Acids (2021) 26: 1303-1317).

[0134] HPostC protects the survival of senescent cardiomyocytes against H / R injury through the activation of DNMT3b-dependent miR-30a. miR-30a may become a therapeutic target for ischemic myocardial infarction (Circ. J. (2020) 84: 616-625).

[0135] In the present invention, when the microparticles contain miRNA targeting a gene related to thrombospondin 1 expression (preferably TSP1 gene), the microparticles preferably function as expression regulators of the gene related to thrombospondin 1 expression. The microparticles are preferably thrombospondin 1 expression inhibitors.

[0136] In this case, the microparticles preferably contain at least one of hsa-let-7a-5p, hsa-let-7b-5p, hsa-let-7f-5p, hsa-miR-132-3p, hsa-miR-143-3p, hsa-miR-19a-3p, hsa-miR-19b-3p, hsa-miR-221-3p, hsa-miR-30a-3p and hsa-miR-30a-5p, and more preferably contain at least hsa-miR-19a-3p, hsa-miR-19b-3p and hsa-miR-221-3p, and more particularly preferably all of hsa-let-7a-5p, hsa-let-7b-5p, hsa-let-7f-5p, hsa-miR-132-3p, hsa-miR-143-3p, hsa-miR-19a-3p, hsa-miR-19b-3p, hsa-miR-221-3p, hsa-miR-30a-3p and hsa-miR-30a-5p.

[0137] The microparticles preferably contain at least one of the miRNAs with a gene related to the expression of thrombospondin 1 as a target gene, with a Log2Ratio of the read counts obtained by IMOTA analysis being 2.0 or more, more preferably 4.0 or more, and particularly preferably 6.0 or more. The microparticles preferably contain hsa-miR-19a-3p, hsa-miR-19b-3p, and hsa-miR-221-3p, each independently, with a Log2Ratio of the read counts obtained by IMOTA analysis being 2.0 or more, more preferably 4.0 or more, and particularly preferably 5.0 or more. It is more preferred that hsa-miR-221-3p be contained at a Log2Ratio of 12.0 or more.

[0138] The expression level of at least one of hsa-miR-19a-3p, hsa-miR-19b-3p and hsa-miR-221-3p in the microparticles is preferably 1.1 times or more, more preferably 1.5 times or more, and particularly preferably 2 times or more, compared to exosomes obtained from the culture supernatant of adipose-derived stem cells or exosomes obtained from the culture supernatant of umbilical cord-derived stem cells.

[0139] When the microparticles are thrombospondin 1 expression inhibitors, they can preferably suppress thrombospondin 1 gene expression in any cell to 0.8 times or less of the normal level (in the case of untreated cells), more preferably 0.7 times or less, and particularly preferably 0.6 times or less.

[0140] (Types of miRNA)

[0141] Here, in the microparticles derived from the culture supernatant of stem cells from dental pulp, there are about 2,600 small RNAs. About 1,800 of them are miRNAs. Among these miRNAs, there are 180 to 200 types of miRNAs with high content. The characteristic of the high content of miRNAs in microparticles derived from stem cells from dental pulp is that there are many microRNAs related to the treatment of cranial nerve diseases or vasculitis, which was previously unknown and is a newly discovered insight of the inventors. This feature is very different from the types of high content of miRNAs in microparticles of other mesenchymal stem cells. For example, among the high content of miRNAs in microparticles of stem cells from fat or microparticles of stem cells from the umbilical cord, there are almost no microRNAs related to the treatment of cranial nerve diseases or vasculitis.

[0142] The microparticles preferably contain two or more microRNAs that can regulate the expression of proteins and / or genes associated with vasculitis (hereinafter also referred to as vasculitis-related microRNAs), more preferably contain 10 or more, more preferably contain 30 or more, particularly preferably contain 50 or more, and even more particularly preferably contain 100 or more.

[0143] (Type of particles)

[0144] The microparticles are preferably at least one selected from exosomes, microvesicles, membrane particles, membrane vesicles, ectosomes, exovesicles, or microvesicles, and are more preferably exosomes.

[0145] The diameter of the fine particles is preferably 10 to 1000 nm, more preferably 30 to 500 nm, and particularly preferably 50 to 150 nm.

[0146] In addition, it is desirable that molecules called tetraspanins such as CD9, CD63, and CD81 exist on the surface of the microparticles. These molecules may be CD9 alone, CD63 alone, CD81 alone, or any combination of two or three of them.

[0147] Hereinafter, a preferred embodiment in the case of using exosomes as microparticles is sometimes described, but the microparticles used in the present invention are not limited to exosomes.

[0148] Exosomes are preferably extracellular vesicles released from cells when multivesicular bodies fuse with the plasma membrane.

[0149] The surface of exosomes preferably contains lipids and proteins derived from the cell membrane of dental pulp-derived stem cells.

[0150] The interior of the exosome preferably contains intracellular substances derived from dental pulp stem cells, such as nucleic acids (microRNA, messenger RNA, DNA, etc.) and proteins.

[0151] Exosomes are known to be used for cell-to-cell communication by transporting genetic information from one cell to another. Exosomes can be easily tracked and can be targeted to specific areas.

[0152] (Content of particles)

[0153] There is no particular limitation on the content of the microparticles in the microparticle composition. The microparticle composition preferably contains 0.5×10 8 More than 1.0×10 8 More than 2.0×10 8 More preferably, it contains 2.5×10 8 More preferably, it contains 1.0×10 9 More than one.

[0154] In addition, there is no particular limitation on the concentration of the fine particles in the fine particle composition. The fine particle composition preferably contains 1.0×10 8 More preferably, the particles contain 2.0×10 8 pcs / mL or more, particularly preferably 4.0×10 8 More preferably, it contains 5.0×10 8 More preferably, it contains 2.0×10 9 More than pcs / mL.

[0155] A preferred embodiment of the expression regulator of the present invention can maintain the amount of miRNA targeting a gene related to the expression of PTX3 or a gene related to the expression of TSP-1 at a high level by containing microparticles in such a large amount or at a high concentration.

[0156] <Other ingredients>

[0157] In addition to the microparticles, the microparticle composition may contain other ingredients, depending on the type of animal to be administered or the purpose, within the range that does not impair the effects of the present invention. Examples of other ingredients include nutrients, antibiotics, cytokines, protective agents, carriers, excipients, disintegrants, buffers, emulsifiers, suspending agents, analgesics, stabilizers, preservatives, preservatives, and the like.

[0158] Examples of nutritional components include fatty acids and vitamins.

[0159] Examples of the antibiotics include penicillin, streptomycin, and gentamicin.

[0160] Examples of the carrier include materials known as pharmaceutically acceptable carriers.

[0161] The microparticle composition may be the culture supernatant of dental pulp-derived stem cells or microparticles themselves, or may be a pharmaceutical composition further comprising a pharmaceutically acceptable carrier or excipient, etc. The purpose of the pharmaceutical composition is to facilitate administration of microparticles to a subject.

[0162] The pharmaceutically acceptable carrier is preferably a carrier (including a diluent) that does not cause significant irritation to the subject of administration and does not inhibit the biological activity and properties of the administered compound. Examples of carriers are: propylene glycol; (physiological) saline; emulsion; buffer; culture medium, such as DMEM or RPMI; and cryopreservation medium containing a component that removes free radicals.

[0163] The microparticle composition may contain the active ingredient of a conventionally known therapeutic drug for rheumatoid arthritis, vasculitis associated with autoimmune diseases, or skin sclerosis, and may be appropriately modified by a person skilled in the art depending on the intended use or the subject of administration.

[0164] On the other hand, the microparticle composition preferably does not contain the specified substance.

[0165] For example, the microparticle composition preferably does not contain stem cells from dental pulp.

[0166] In addition, the microparticle composition preferably does not contain MCP-1. However, cytokines other than MCP-1 may be included. As other cytokines, cytokines described in

[0014] to

[0020] of Japanese Patent Publication No. 2018-023343 can be cited.

[0167] In addition, the microparticle composition preferably does not contain Siglec-9. However, other sialic acid-binding immunoglobulin-like lectins besides Siglec-9 may be included.

[0168] It should be noted that the microparticle composition preferably does not substantially contain serum (fetal bovine serum, human serum, goat serum, etc.) In addition, the microparticle composition preferably does not substantially contain conventional serum substitutes such as knockout serum replacement (KSR).

[0169] The content (solid content) of the above-mentioned other components in the fine particle composition is preferably 1% by mass or less, more preferably 0.1% by mass or less, and particularly preferably 0.01% by mass or less.

[0170] <Method for producing fine particles>

[0171] There is no particular limitation on the method for producing the microparticles.

[0172] The culture supernatant of stem cells from dental pulp etc. can be modulated, and then the microparticles are purified from the culture supernatant of stem cells from dental pulp to modulate the PTX3 expression modulator of the present invention. Alternatively, the culture supernatant of stem cells from dental pulp obtained by commercial purchase can be purified to modulate the PTX3 expression modulator of the present invention. Furthermore, a composition containing the culture supernatant of stem cells from dental pulp that has been discarded (or the composition is appropriately purified) can also be accepted, and the microparticles are purified therefrom to modulate the PTX3 expression modulator of the present invention.

[0173] (Method for preparing culture supernatant of dental pulp-derived stem cells, etc.)

[0174] The culture supernatant of dental pulp-derived stem cells and the like is not particularly limited.

[0175] The culture supernatant of dental pulp-derived stem cells or the like preferably contains substantially no serum. For example, the culture supernatant of dental pulp-derived stem cells or the like preferably has a serum content of 1% by mass or less, more preferably 0.1% by mass or less, and particularly preferably 0.01% by mass or less.

[0176] Dental pulp-derived stem cells may be derived from humans or animals other than humans. Examples of animals other than humans include the same animals (biological species) as those to be administered with the PTX3 expression regulating agent of the present invention described below, preferably mammals.

[0177] There is no particular limitation on the dental pulp stem cells used for the culture supernatant. Dental pulp stem cells from exfoliated deciduous teeth, or dental pulp stem cells from deciduous teeth obtained by other methods, or dental pulp stem cells from permanent teeth (dental pulp stem cells; DPSC) can be used. In addition to human deciduous tooth dental pulp stem cells or human permanent tooth dental pulp stem cells, dental pulp stem cells from animals other than humans, such as porcine deciduous tooth dental pulp stem cells, can also be used.

[0178] In addition to exosomes, dental pulp stem cells can also produce various cytokines such as vascular endothelial growth factor (VEGF), hepatocyte growth factor (HGF), insulin-like growth factor (IGF), platelet-derived growth factor (PDGF), transforming growth factor-β (TGF-β)-1 and -3, TGF-α, KGF, HBEGF, SPARC, other growth factors, chemokines, etc. In addition, they can also produce a variety of other physiologically active substances.

[0179] In the present invention, the dental pulp-derived stem cells used in the culture supernatant of dental pulp-derived stem cells are preferably dental pulp-derived stem cells containing a large amount of protein, and deciduous tooth dental pulp stem cells are preferably used. That is, in the present invention, the culture supernatant of deciduous tooth dental pulp stem cells is preferably used.

[0180] The dental pulp-derived stem cells used in the present invention may be natural stem cells or genetically modified stem cells as long as they can achieve the target treatment.

[0181] In particular, immortalized stem cells derived from dental pulp stem cells can be used in the present invention. By using immortalized stem cells that can proliferate indefinitely in essence, the amount and composition of biological factors contained in the culture supernatant of stem cells can be stabilized for a long time. There are no particular limitations on the immortalized stem cells that are stem cells derived from dental pulp. The immortalized stem cells are preferably immortalized stem cells that are not cancerous. The immortalized stem cells derived from dental pulp stem cells can be modulated by adding the following small molecule compounds (inhibitors) to the stem cells derived from dental pulp alone or in combination for culturing.

[0182] The TGFβ receptor inhibitor is not particularly limited as long as it is a substance that has an effect of inhibiting the function of the transforming growth factor (TGF) β receptor, and examples thereof include 2-(5-benzo[1,3]dioxol-4-yl-2-tert-butyl-1H-imidazol-4-yl)-6-methylpyridine, 3-(6-methylpyridin-2-yl)-4-(4-quinolyl)-1-phenylthiocarbamoyl-1H-pyrazole (A- A-83-01), 2-[(5-chloro-2-fluorophenyl)pteridin-4-yl]pyridin-4-ylamine (SD-208), 3-[(pyridin-2-yl)-4-(4-quinone)]-1H-pyrazole, 2-(3-(6-methylpyridin-2-yl)-1H-pyrazol-4-yl)-1,5-naphthyridine (all from Merck), SB431542 (Sigma-Aldrich), etc. Preferably, A-83-01 is mentioned.

[0183] As a ROCK inhibitor, there is no particular limitation as long as it is a substance that has the function of inhibiting the function of Rho binding kinase. As a ROCK inhibitor, for example, GSK269962A (Axonmedchem), fasudil hydrochloride (TocrisBioscience), Y-27632, H-1152 (all from Fujifilm Wako Pure Chemical Industries, Ltd.) and the like can be cited. Preferably, Y-27632 can be cited.

[0184] The GSK3 inhibitor is not particularly limited as long as it is a substance that inhibits GSK-3 (Glycogen Synthase Kinase 3), and examples thereof include A1070722, BIO, and BIO-acetone oxime (all from TOCRIS).

[0185] MEK inhibitors are not particularly limited as long as they are substances that have the effect of inhibiting the function of MEK (MAP kinase-ERK kinase), and examples thereof include AZD6244, CI-1040 (PD184352), PD0325901, RDEA119 (BAY86-9766), SL327, U0126-EtOH (all from Selleck), PD98059, U0124, U0125 (all from Cosmo Bio Co., Ltd.), and the like.

[0186] When the PTX3 expression regulating agent of the present invention is used in regenerative medicine, based on the requirements of the law on safety assurance of regenerative medicine, etc., the following embodiment is adopted: the composition containing the culture supernatant of dental pulp-derived stem cells or immortalized stem cells thereof or microparticles derived therefrom does not contain other somatic stem cells other than dental pulp-derived stem cells, etc. The microparticle composition may contain mesenchymal stem cells or other somatic stem cells other than dental pulp-derived stem cells, etc., but preferably does not contain them.

[0187] Examples of somatic stem cells other than mesenchymal stem cells include stem cells from the dermal system, digestive system, bone marrow system, nervous system, etc., but are not limited to these. Examples of somatic stem cells of the dermal system include epithelial stem cells, hair follicle stem cells, etc. Examples of somatic stem cells of the digestive system include pancreatic (whole) stem cells, liver stem cells, etc. Examples of somatic stem cells of the bone marrow system (other than mesenchymal stem cells) include hematopoietic stem cells, etc. Examples of somatic stem cells of the nervous system include neural stem cells, retinal stem cells, etc.

[0188] The microparticle composition may contain stem cells other than somatic stem cells, but preferably does not contain any of them. Stem cells other than somatic stem cells include embryonic stem cells (ES cells), induced pluripotent stem cells (iPS cells), and embryonic carcinoma cells (EC cells).

[0189] The method for preparing the culture supernatant of dental pulp-derived stem cells or immortalized stem cells thereof is not particularly limited, and conventional methods can be employed.

[0190] The culture supernatant of dental pulp stem cells or the like is a culture fluid obtained by culturing dental pulp stem cells. For example, by separating and removing cell components after culturing dental pulp stem cells, a culture supernatant that can be used in the present invention can be obtained. A culture supernatant that has been appropriately subjected to various treatments (e.g., centrifugation, concentration, solvent replacement, dialysis, freezing, drying, freeze drying, dilution, desalting, storage, etc.) can be used.

[0191] The dental pulp stem cells used to obtain the culture supernatant of dental pulp stem cells can be screened by conventional methods, and can be screened based on the size or morphology of the cells or as adherent cells. The dental pulp cells collected from the deciduous teeth or permanent teeth can be screened as adherent cells or their passage cells. In the culture supernatant of dental pulp stem cells, the culture supernatant obtained by culturing the selected stem cells can be used.

[0192] It should be noted that the "culture supernatant of dental pulp-derived stem cells, etc." is preferably a culture medium that does not contain the cells themselves obtained by culturing dental pulp-derived stem cells, etc. The culture supernatant of dental pulp-derived stem cells used in the present invention preferably does not contain cells (regardless of the cell type) as a whole in one embodiment. The composition of this embodiment naturally distinguishes the dental pulp-derived stem cells themselves from various compositions containing dental pulp-derived stem cells based on this feature. A typical example of this embodiment is a composition that does not contain dental pulp-derived stem cells and consists only of the culture supernatant of dental pulp-derived stem cells.

[0193] The culture supernatant of dental pulp-derived stem cells used in the present invention may contain the culture supernatants of both stem cells from deciduous tooth pulp and stem cells from adult dental pulp. The culture supernatant of dental pulp-derived stem cells used in the present invention preferably contains the culture supernatant of stem cells from deciduous tooth pulp as an effective ingredient, more preferably contains 50% by mass or more, and preferably contains 90% by mass or more. The culture supernatant of dental pulp-derived stem cells used in the present invention is more preferably a composition consisting only of the culture supernatant of stem cells from deciduous tooth pulp.

[0194] The culture medium for obtaining the culture supernatant of the dental pulp stem cells can be a basal medium or a medium in which serum or the like is added to the basal medium. It should be noted that, as a basal medium, in addition to Dulbecco's modified Eagle medium (DMEM), Iscove's modified Dulbecco's medium (IMDM) (GIBCO, etc.), HamF12 medium (HamF12) (SIGMA, GIBCO, etc.), RPMI1640 medium, etc. can also be used. In addition, as examples of components that can be added to the culture medium, serum (fetal bovine serum, human serum, sheep serum, etc.), serum substitutes (knockout serum substitutes KSR, etc.), bovine serum albumin (BSA), antibiotics, various vitamins, and various minerals can be listed.

[0195] However, in order to prepare a serum-free "culture supernatant of dental pulp-derived stem cells", a serum-free medium can be used for the subculture throughout the entire process or the last or several times since the last. For example, by culturing dental pulp-derived stem cells with a serum-free medium (serum-free medium), a serum-free culture supernatant of dental pulp-derived stem cells can be prepared. By performing one or more subcultures, and culturing the last or several times since the last subcultures with a serum-free medium, a serum-free culture supernatant of dental pulp-derived stem cells can also be obtained. On the other hand, by removing serum from the recovered culture supernatant using dialysis or column-based solvent replacement, a serum-free culture supernatant of dental pulp-derived stem cells can also be obtained.

[0196] In the culture of dental pulp-derived stem cells for obtaining the culture supernatant, the conditions commonly used can be directly applied. Regarding the method for preparing the culture supernatant of dental pulp-derived stem cells, except for appropriately adjusting the separation and selection steps of stem cells according to the type of stem cells, it can be carried out in the same manner as the cell culture method described later. Those skilled in the art can appropriately separate and select dental pulp-derived stem cells according to the type of dental pulp-derived stem cells.

[0197] In addition, in the culture of dental pulp-derived stem cells, special conditions may be applied to mass-produce microparticles such as exosomes, and examples of special conditions include co-culture conditions with any stimulant such as low temperature conditions, low oxygen conditions, and microgravity conditions.

[0198] In the present invention, the culture supernatant of dental pulp-derived stem cells used for preparing microparticles such as exosomes may contain other components in addition to the culture supernatant from which the dental pulp-derived stem cells have been removed, but preferably does not substantially contain other components.

[0199] However, various additives for preparing exosomes may be added to the culture supernatant of dental pulp-derived stem cells before storage.

[0200] (Modulation of Particles)

[0201] Microparticles can be prepared by purifying the microparticles from the culture supernatant of dental pulp-derived stem cells or the like.

[0202] The purification of the microparticles is preferably performed by isolating a fraction containing the microparticles from the culture supernatant of the dental pulp-derived stem cells, and more preferably by isolating the microparticles.

[0203] Microparticles can be separated from non-associated components by separation based on properties of the microparticles. For example, microparticles can be separated based on molecular weight, size, morphology, composition, or biological activity.

[0204] In the present invention, the microparticles can be purified by fractionating a specific fraction (e.g., a precipitate) containing a large amount of microparticles obtained by centrifuging the culture supernatant of stem cells from dental pulp. Unnecessary components (insoluble components) of fractions other than the specified fractions can be removed. The removal of the solvent and the dispersion medium and the unnecessary components from the microparticle composition may not be complete. If the conditions for the centrifugation are exemplified, it is performed at 100 to 20,000 g for 1 to 30 minutes.

[0205] In the present invention, microparticles can be purified by filtering the culture supernatant of stem cells from dental pulp or its centrifuged product. Unnecessary components can be removed by filtering. In addition, if a filter membrane with an appropriate pore size is used, the removal of unnecessary components and sterilization can be performed at the same time. There is no particular limitation on the material, pore size, etc. of the filter membrane used for filtering. Filtration can be performed using a filter membrane with an appropriate molecular weight or size cutoff according to a known method. From the viewpoint of easy fractionation and separation of exosomes, the pore size of the filter membrane is preferably 10 to 1000 nm, more preferably 30 to 500 nm, and particularly preferably 50 to 150 nm.

[0206] In the present invention, the culture supernatant of dental pulp stem cells or its centrifuged product or its filtered product can be separated by further separation methods such as column chromatography. For example, high performance liquid chromatography (HPLC) using various columns can be used. The column can be a size exclusion column or a binding column.

[0207] In order to track the microparticles (or their activity) in each fraction at each stage of the treatment, one or more properties or biological activities of the microparticles can be used. For example, light scattering, refractive index, dynamic light scattering, or UV-visible detectors can be used to track the microparticles. Alternatively, specific enzyme activities can be used to track the activity in each fraction.

[0208] As a method for purifying microparticles, the method described in

[0034] to

[0064] of JP-A-2019-524824 can be used, and the contents of this publication are incorporated herein by reference.

[0209] There is no particular limitation on the final form of the microparticle composition. For example, the microparticle composition may be a form in which microparticles are filled into a container together with a solvent or a dispersion medium; a form in which microparticles are gelled together with a gel and filled into a container; a form in which microparticles are frozen and / or dried to solidify to form a preparation or filled into a container, etc. Examples of containers include tubes suitable for frozen storage, centrifugal sedimentation tubes, bags, etc. The freezing temperature may be, for example, -20°C to -196°C.

[0210] Compared with the compositions that can be used as therapeutic or preventive drugs for rheumatoid arthritis, vasculitis or skin sclerosis associated with autoimmune diseases in the past, the PTX3 expression regulator of the present invention has the following advantages: it is easy to mass produce, and the culture medium of stem cells that was previously discarded as industrial waste can be used and utilized, reducing the cost of discarding the stem cell culture medium, etc. In particular, when the culture supernatant of stem cells from dental pulp is the culture supernatant of stem cells from human dental pulp, it also has the following advantages: when the PTX3 expression regulator of the present invention is applied to humans, the safety from the perspective of immunology is high and there are few ethical issues. When the culture supernatant of stem cells from dental pulp is the culture supernatant of stem cells from dental pulp derived from patients with vasculitis, when the PTX3 expression regulator of the present invention is applied to the patient, the safety is further improved and the ethical issues are also reduced.

[0211] In the case where the PTX3 expression regulator of the present invention is derived from the culture supernatant of stem cells from dental pulp, it can also be used for restorative medical purposes. In particular, a composition containing microparticles derived from the culture supernatant of stem cells from dental pulp is preferably used for restorative medical purposes. Here, it is known that in regenerative medicine based on stem cell transplantation, stem cells are not the protagonist of regeneration, but the liquid components produced by stem cells repair organs together with their own stem cells. Difficult problems such as canceration, standardization, administration method, preservation, and culture method associated with previous stem cell transplantation have been solved, and repair medical treatment has become possible by using the culture supernatant of stem cells from dental pulp or a composition of microparticles derived therefrom. Compared with stem cell transplantation, since cell transplantation is not performed when using the PTX3 expression regulator of the present invention, it is not easy to cause tumorization, etc., which can be said to be safer. In addition, the PTX3 expression regulator of the present invention has the advantage that a regulator of certain standardized quality can be used. Since mass production or effective administration methods can be selected, it can be used at low cost.

[0212] [Preventive or therapeutic drug for rheumatoid arthritis, vasculitis or skin sclerosis associated with autoimmune diseases]

[0213] The preventive or therapeutic agent for rheumatoid arthritis, vasculitis associated with autoimmune diseases, or skin sclerosis of the present invention contains the PTX3 expression regulating agent of the present invention.

[0214] In this specification, "prevention" means preventing the onset of a disease (in this specification, vasculitis) before it occurs. In addition, in this specification, "treatment" means alleviating, inhibiting or stopping the progression of symptoms of an already developed disease, as well as improving symptoms.

[0215] [Methods for improving rheumatoid arthritis, vasculitis or skin sclerosis associated with autoimmune diseases]

[0216] The method for improving rheumatoid arthritis, vasculitis associated with autoimmune diseases, or skin sclerosis of the present invention comprises administering an effective amount of the PTX3 expression regulator of the present invention or an effective amount of the preventive or therapeutic drug for rheumatoid arthritis, vasculitis associated with autoimmune diseases, or skin sclerosis of the present invention to a subject suffering from vasculitis.

[0217] The step of administering the PTX3 expression regulating agent of the present invention to a subject suffering from rheumatoid arthritis, vasculitis associated with autoimmune diseases, or skin sclerosis is not particularly limited.

[0218] The method of administration can be listed as follows: spray or suction, drip, topical administration, nasal drops, smearing on the skin, etc., preferably less invasive methods for oral, nasal or respiratory tract. As a method of topical administration, injection is preferred. In addition, electroporation is also preferred, which temporarily opens fine holes on the cell membrane by applying voltage (electric pulse) to the skin surface, so that the active ingredient penetrates into the dermis that cannot be reached in conventional care. In the case of topical administration, intravenous administration, intraarterial administration, portal vein administration, intradermal administration, subcutaneous administration, intramuscular administration, intraperitoneal administration, etc. can be listed, and intraarterial administration, intravenous administration, subcutaneous administration or intraperitoneal administration are more preferably given. In the case of administering the PTX3 expression regulator of the present invention to the object of skin sclerosis, it is more preferably applied to the skin. For example, the PTX3 expression regulator of the present invention is preferably mixed in skin lotions (lotions), essences, emulsions, creams, ointments, facial masks and other skin coatings, and they are applied to the skin. When the preventive or therapeutic drug for rheumatoid arthritis, vasculitis associated with autoimmune diseases, or skin sclerosis of the present invention is a preventive or therapeutic drug for skin sclerosis, it is preferably a skin ointment.

[0219] In addition, various formulation techniques can be used to modify the in vivo distribution of the microparticles. Various methods for modifying in vivo distribution are known to those skilled in the art. Examples of such methods include protection of exosomes in vesicles composed of substances such as proteins, lipids (e.g., liposomes), carbohydrates, or synthetic polymers.

[0220] The PTX3 expression modulator of the present invention administered to a subject suffering from rheumatoid arthritis, vasculitis associated with an autoimmune disease, or skin sclerosis can circulate in the subject's body and reach a predetermined tissue.

[0221] There is no particular restriction on the number of administrations and the interval between administrations. The number of administrations can be set to be once or more per week, preferably 5 or more times, more preferably 6 or more times, and particularly preferably 7 or more times. The interval between administrations is preferably 1 hour to 1 week, more preferably half a day to 1 week, and particularly preferably 1 day (once a day). However, it can be appropriately adjusted according to the biological species of the subject or the symptoms of the subject.

[0222] The PTX3 expression regulator of the present invention is preferably used for the following purposes: administering microparticles to a subject suffering from vasculitis at least once a week during the effective treatment period. When the subject is a human, the administration frequency is preferably high, preferably 5 times a week or more during the effective treatment period, preferably daily.

[0223] The concentration used was 2.0×10 9 In the case of a culture supernatant of dental pulp-derived stem cells at a concentration of cells / ml, in a mouse model, the amount is preferably 0.1 to 5 ml, more preferably 0.3 to 3 ml, and particularly preferably 0.5 to 1 ml per mouse (about 25 g).

[0224] The concentration used was 0.1×10 8 In the case of microparticles of the invention having a concentration of 1 μg / μg, in a mouse model, the dosage is preferably 1 to 50 μg, more preferably 3 to 30 μg, and particularly preferably 5 to 25 μg per mouse (about 25 g).

[0225] The preferred range of the dosage per unit body weight for other animals can be calculated from the dosage per unit body weight (about 25 g) for model mice using a proportional relationship, but can be appropriately adjusted depending on the symptoms of the subject of administration.

[0226] There is no particular limitation on the target animal (biological species) to which the PTX3 expression modulator of the present invention is administered. The target animal to which the PTX3 expression modulator of the present invention is administered is preferably a mammal, a bird (chicken, quail, duck, etc.), a fish (salmon, trout, tuna, bonito, etc.). As a mammal, it can be a human or a non-human mammal, but it is particularly preferably a human. As a non-human mammal, it is more preferably a cow, a pig, a horse, a goat, a sheep, a monkey, a dog, a cat, a mouse, a rat, a guinea pig, or a hamster.

[0227] The PTX3 expression modulator of the present invention can be used in combination with a conventionally known therapeutic drug for rheumatoid arthritis, vasculitis associated with autoimmune diseases, or skin sclerosis. Specifically, for example, it can be used in combination with conventionally known steroids, immunosuppressants, biological agents (tocilizumab, TNF inhibitors, etc.), antiplatelet drugs, antihistamines / antiallergic drugs, NSAIDs (nonsteroidal anti-inflammatory drugs), etc.

[0228] Example

[0229] Below, enumerate embodiment and comparative example or reference example, further specifically illustrate feature of the present invention.Material, usage amount, ratio, processing content, processing sequence etc. shown in the following embodiment can be appropriately changed as long as do not depart from the purpose of the present invention.Therefore, the scope of the present invention should not be interpreted restrictively by the specific examples shown below.

[0230] [Example 1]

[0231] <Preparation of culture supernatant of dental pulp-derived stem cells>

[0232] DMEM medium was used instead of DMEM / HamF12 mixed medium, and the culture supernatant of human deciduous dental pulp stem cells was prepared according to the method described in Example 6 of Japanese Patent No. 6296622, and the culture supernatant was fractionated. Fetal bovine serum (FBS) was added to the primary culture for culture, and the supernatant of the subculture medium obtained by culture in the subculture using the primary culture medium was fractionated to make it free of FBS, and the culture supernatant of deciduous dental pulp stem cells was prepared. It should be noted that DMEM is Dulbecco's modified Eagle medium, and F12 is Ham's F12 medium.

[0233] <Exosome Modulation>

[0234] Exosomes derived from dental pulp stem cells were purified from the obtained culture supernatant of dental pulp stem cells by the following method.

[0235] After filtering the culture supernatant (100 mL) of deciduous dental pulp stem cells with a filter having a pore size of 0.22 μm, the solution was centrifuged at 100,000 × g for 60 minutes at 4°C. The supernatant was decanted and the exosome concentrated particles were resuspended in phosphate-buffered saline (PBS). The resuspended sample was centrifuged at 100,000 × g for 60 minutes. The particles were recovered from the bottom of the centrifuge tube as a concentrated sample again (about 100 μl). The protein concentration was determined by a micro BSA protein assay kit (Pierce, Rockford, IL). The composition containing exosomes (concentrated solution) was stored at -80°C.

[0236] A composition containing exosomes purified from the culture supernatant of dental pulp-derived stem cells was used as the expression regulator of Example 1 (microparticle composition sample).

[0237] The average particle size and concentration of the microparticles contained in the expression regulating agent of Example 1 were evaluated using NanoSight, a nanoparticle analysis system (manufactured by Quantum Design Japan Inc.).

[0238] The average particle size of the microparticles contained in the expression regulating agent of Example 1 is 50 to 150 nm.

[0239] The expression regulator of Example 1 is 1.0×10 9 A high concentration of exosome solution of more than 2.0×10 9 / ml high concentration exosome solution.

[0240] In addition, the components of the expression regulator of Example 1 obtained were analyzed by a known method. As a result, it was found that the expression regulator of Example 1 did not contain stem cells from dental pulp stem cells, MCP-1, or Siglec-9. Therefore, it was found that the active ingredient different from MCP-1 and Siglec-9 and their analogs, which are active ingredients of the culture supernatant of mesenchymal stem cells, is the active ingredient of the expression regulator of Example 1.

[0241] [Comparative Example 1]

[0242] <Preparation of culture supernatant of umbilical cord-derived stem cells>

[0243] A composition containing exosomes purified from umbilical cord stem cells was prepared according to Example 1 except that human umbilical cord-derived stem cells were used instead of deciduous tooth pulp stem cells (microparticle composition of Comparative Example 1).

[0244] [Test Example 1]: MicroRNA expressed in exosomes

[0245] The microRNAs contained in the microparticle composition of Example 1 were analyzed by next generation sequencing (NGS) analysis. By NGS analysis, 1787 miRNAs contained in the microparticle composition (exosomes derived from dental pulp stem cells) of Example 1 were identified. The obtained results are shown in Table 1 below.

[0246] [Table 1]

[0247] name Number of tests ％ miRNA 1787 72.35 piRNA 123 4.98 tRNA 411 16.64 Other RNA 149 6.03 total 2470 100

[0248] [Test Example 2]: Exploration of disease-related microRNAs

[0249] Disease-related microRNAs were explored. IMOTA (Interactive Multi-Omics-Tissue Atlas) was used for the extraction of disease-related microRNAs. IMOTA is a conversational multi-omics atlas (Nucleic Acids Research, Vol. 46, Issue D1, 4 January 2018, pp. D770-D775, "IMOTA: an interactive multi-omics tissue atlas for the analysis of human miRNA-target interactions") that can study the interaction or expression level of miRNA, mRNA, and protein in each tissue or cell. Here, it was explored whether microRNAs that regulate proteins and / or genes associated with rheumatoid arthritis, vasculitis or skin sclerosis associated with autoimmune diseases, or whether microRNAs that regulate proteins and / or genes that become targets of therapeutic drugs were included. In this test example 2, miRNAs with genes associated with the expression of PTX3 as target genes were explored. As a reference, miRNAs targeting genes related to TSP-1 expression were also searched.

[0250] [Test Example 2]: Exploration of disease-related microRNAs

[0251] Disease-related microRNAs were explored. IMOTA (Interactive Multi-Omics-Tissue Atlas) was used to extract disease-related microRNAs. IMOTA is a conversational multi-omics atlas that can study the interactions or expression levels of miRNAs, mRNAs, and proteins in various tissues or cells (Nucleic Acids Research, Vol. 46, Issue D1, 4 January 2018, pp. D770-D775, "IMOTA: an interactive multi-omics tissue atlas for the analysis of human miRNA-target interactions"). Here, it was explored whether microRNAs that regulate proteins and / or genes associated with rheumatoid arthritis, vasculitis associated with autoimmune diseases, or skin sclerosis, or whether microRNAs that regulate proteins and / or genes that become targets of therapeutic drugs, were included. In this Experimental Example 2, miRNAs targeting genes related to the expression of PTX3 were explored as proteins related to rheumatoid arthritis, vasculitis associated with autoimmune diseases, or skin sclerosis. It should be noted that, as a reference, miRNAs targeting genes related to the expression of thrombospondin 1 (TSP1 or THBS1) were also explored.

[0252] The miRNAs that target genes related to PTX3 expression and are expressed in exosomes purified from the culture supernatant of dental pulp-derived stem cells are the following PTX3 inhibition-related miRNA group (three types).

[0253] hsa-miR-224-5p, has-miR-374c-5p and hsa-miR-655-3p.

[0254] Therefore, it was found that the expression modulator of the present invention can be used as a PTX3 expression modulator.

[0255] For reference, miRNAs that target genes related to the expression of thrombospondin 1 (TSP1 or THBS1) and are expressed in exosomes purified from the culture supernatant of dental pulp-derived stem cells are the following TSP1-related miRNA group (69 types).

[0256] TSP1-related miRNA group:

[0257] hsa-let-7a-5p, hsa-let-7b-5p, hsa-let-7c-5p, hsa-let-7d-5p, hsa-let-7e-5p,

[0258] hsa-let-7f-5p、hsa-let-7g-5p、hsa-let-7i-5p、hsa-miR-101-3p、hsa-miR-125a-3p、

[0259] hsa-miR-1273g-3p, hsa-miR-132-3p, hsa-miR-139-5p, hsa-miR-141-3p, and hsa-miR-143-3p

[0260] hsa-miR-144-3p, hsa-miR-155-5p, hsa-miR-182-5p, hsa-miR-194-5p, and hsa-miR-198

[0261] hsa-miR-19a-3p, hsa-miR-19b-3p, hsa-miR-205-5p, hsa-miR-206, hsa-miR-211-3p

[0262] hsa-miR-212-3p, hsa-miR-221-3p, hsa-miR-222-3p, hsa-miR-27b-3p, and hsa-miR-297

[0263] hsa-miR-300, hsa-miR-30a-3p, hsa-miR-30a-5p, hsa-miR-3149, hsa-miR-331-3p

[0264] hsa-miR-338-3p, hsa-miR-340-5p, hsa-miR-3609, hsa-miR-3665, and hsa-miR-377-3p

[0265] hsa-miR-377-5p, hsa-miR-381-3p, hsa-miR-382-5p, hsa-miR-410-3p, and hsa-miR-411-3p

[0266] hsa-miR-4257, hsa-miR-4270, hsa-miR-4450, hsa-miR-4458, hsa-miR-4495

[0267] hsa-miR-4500, hsa-miR-455-3p, hsa-miR-4655-5p, hsa-miR-4739, hsa-miR-491-5p

[0268] hsa-miR-493-3p, hsa-miR-493-5p, hsa-miR-5003-5p, hsa-miR-509-5p, hsa-miR-5096

[0269] hsa-miR-543, hsa-miR-582-5p, hsa-miR-613, hsa-miR-650, hsa-miR-657,

[0270] hsa-miR-675-3p, hsa-miR-7-1-3p, hsa-miR-766-5p, hsa-miR-98-5p.

[0271] Therefore, it was found that the expression regulating agent of the present invention can be used as an expression regulating agent of thrombospondin 1.

[0272] The results of comparing the expression levels of miRNAs expressed in exosomes from dental pulp stem cells are shown in Figure 1 The concentration of the heat map is expressed as the log ratio of the read count values.

[0273] Depend on Figure 1 and Figure 2 It is known that the expression inhibitor of the present invention contains miRNA related to PTX3 at a high concentration. Therefore, the expression inhibitor of the present invention can regulate the expression of PTX3 and / or the PTX3 gene (Ptx3).

[0274] It should be noted that the expression inhibitor of the present invention also contains miRNA related to TSP-1 at a high concentration. Therefore, the expression inhibitor of the present invention can also regulate the expression of TSP-1 and / or TSP-1 gene (Tsp-1).

[0275] [Test Example 3]: Confirmation of inhibition of PTX3 expression

[0276] Using the human umbilical vein endothelial cell (HUVEC) vasculitis model, the inhibition of PTX3 expression was confirmed by the following method. In addition, as a reference, the regulation of TSP-1 expression was also confirmed.

[0277] After inoculation, HUVEC cells were cultured for 18 hours at 37°C and 5% CO. Then, HUVEC cells were sealed in a BBL GasPak™ anaerobic system (Becton Dickinson Microbiology Systems, Cockeysville, MD, USA) and cultured under hypoxia for 24 hours. Thus, the oxygen concentration of the culture environment of HUVEC cells was 2%.

[0278] 24 hours later, 10,000 exosomes of the expression regulator of Example 1 (exosomes purified from dental pulp-derived stem cells) or the microparticle composition prepared in Comparative Example 1 (exosomes purified from umbilical cord-derived stem cells) were administered per HUVEC cell.

[0279] After 48 hours, the expression level of PTX3 gene was quantified by qPCR using the following primer set.

[0280] PTX3:

[0281] Pentraxin 3 (PTX3) Human qPCR Primer Pair (NM_002852)

[0282] CGAAATAGACAATGGACTCCATCC / CTCATCTGCGAGTTCT CCAGCA

[0283] As a reference, the expression level of the TSP-1 gene was quantified by qPCR in the same manner as for the PTX3 gene using the following primer set.

[0284] TSP-1:

[0285] Thrombospondin 1 (THBS1) Human qPCR Primer Pair (NM_003246)

[0286] GCTGGAAATGTGGTGCTTGTCC / CTCCATGTGGTTGAAGC AGGC

[0287] [Reference Example 1]: Hypoxia Untreated

[0288] The expression levels of PTX3 and TSP-1 genes were quantified by qPCR in the same manner as in Example 1, except that the HUVEC cells were cultured for 24 hours at 37°C and 5% CO and no microparticle composition was added instead of culturing them for 24 hours under hypoxia.

[0289] [Reference Example 2]: No particles after hypoxic culture

[0290] The expression levels of the PTX3 gene and the TSP-1 gene were quantified by qPCR in the same manner as in Example 1 except that the microparticle composition was not added.

[0291] Figure 3 : is a graph of the quantitative expression levels of PTX3 gene and TSP-1 gene in each case. Figure 3 It is found that the PTX3 expression inhibitor of the present invention can significantly inhibit the expression of the PTX3 gene

[0292] It should be noted that it was found that the expression regulator of the present invention can also significantly inhibit the expression level of TSP-1 gene.

Claims

1. PTX3 expression regulator, wherein The expression regulator comprises microparticles, The microparticles contain miRNAs that target genes related to PTX3 expression. 2 . The PTX3 expression regulating agent according to claim 1 , wherein the microparticles are exosomes. 3 . The PTX3 according to claim 1 , comprising at least one of hsa-miR-224-5p, has-miR-374c-5p and hsa-miR-655-3p as the miRNA having a gene related to the expression of PTX3 as a target gene. 4 . The PTX3 expression regulator according to claim 1 , wherein the miRNA targeting a gene related to the expression of PTX3 comprises at least hsa-miR-224-5p. 5 . The PTX3 expression regulator according to claim 1 , wherein the miRNA targeting a gene related to the expression of PTX3 comprises hsa-miR-224-5p and hsa-miR-655-3p. 6 . The PTX3 expression regulating agent according to claim 1 , wherein the microparticles contain the miRNA targeting a gene related to PTX3 expression at a higher concentration than that in a culture supernatant of dental pulp-derived stem cells.

7. The PTX3 expression regulating agent according to claim 1, wherein the microparticles are microparticles purified and separated from the culture supernatant of stem cells derived from dental pulp, The microparticles do not contain components obtained by removing the exosomes from the culture supernatant of the dental pulp-derived stem cells.

8. A preventive or therapeutic drug for rheumatoid arthritis, vasculitis associated with autoimmune diseases, or skin sclerosis, comprising the PTX3 expression regulating agent according to claim 1 as an active ingredient.

9. The preventive or therapeutic drug for rheumatoid arthritis, vasculitis associated with autoimmune diseases, or skin sclerosis according to claim 8, which is a preventive or therapeutic drug for skin sclerosis and is a skin ointment.

10. A method for improving rheumatoid arthritis, vasculitis associated with autoimmune diseases, or skin sclerosis, comprising administering an effective amount of the PTX3 expression modulator according to claim 1 or an effective amount of the preventive or therapeutic drug for rheumatoid arthritis, vasculitis associated with autoimmune diseases, or skin sclerosis according to claim 8 to a subject suffering from rheumatoid arthritis, vasculitis associated with autoimmune diseases, or skin sclerosis.

Images