TdT-specific chimeric receptors and methods of use thereof

Abstract

Embodiments of the present disclosure relate to methods and compositions associated with targeted cancer treatment, which are directed to specific terminal deoxynucleoside acyl transferase peptides associated with HLA-A02. In particular embodiments, cell therapies employ cells encoding chimeric T cell receptors that target peptides, and optionally bispecific T cell conjugates that target the same peptides. In particular embodiments, one or both are used to treat hematological malignancies.

Description

[0001] This application claims priority to U.S. Provisional Patent Application Serial No. 63 / 336,892, filed on April 29, 2022, which is incorporated herein by reference in its entirety. [Background of the invention]

[0003] [I. Technical field]

[0004] The present disclosure relates at least to the fields of cell biology, molecular biology, immunology, and medicine.

[0005] [II. Background technology]

[0006] Chimeric antigen receptor (CAR) T cells targeting CD19 produce long-term remissions in less than half of patients with refractory / relapsed B-cell ALL. Antigen escape and limited persistence of therapeutic T cells have hampered the clinical benefit of CD19-targeted approaches, prompting the evaluation of combined antigen targeting and structural optimization of chimeric receptors. 1 On the other hand, sustained CD19 CAR T cell activity often results in long-term systemic depletion of B cells, requiring IVIG supplementation. Targeted immunotherapy options are more limited for T-cell ALL and AML, where potential on-target non-tumor toxicities may result in ablation of important lymphocytes and primitive progenitor cells and significantly increase the risks of these therapies. 2 Therefore, overall survival of patients with refractory or relapsed T-ALL and AML remains very poor. 2,3 .

[0007] The present disclosure satisfies a long-felt need to provide effective adoptive cell therapy techniques for cancer treatment. [Summary of the Invention]

[0008] The disclosed embodiments include methods and compositions for treating medical conditions that are associated with terminal deoxynucleotidyl transferase (TdT) in any way and require targeting. In specific embodiments, fragments of TdT are targeted as a process of action, including peptides of TdT. In particular, TdT peptides are the focus of treatment of individuals in need. In specific embodiments, TdT peptides may or may be associated with any member of the human leukocyte antigen (HLA) system, including at least HLA-A02, and may be the focus of treatment of individuals in need thereof. In certain cases, TdT peptides associated with HLA-A02 are targeted, including targeting the surface of any type of harmful cells expressing HLA-A02. In some embodiments, TdT peptides may be associated with any HLA antigen, including HLA-A, HLA-B, HLA-C, HLA-E, HLA-F or HLA-G.

[0009] In specific embodiments, antibodies that recognize a portion of TdT, such as a TdT peptide, are used as a means of targeting cancer cells that express the peptide. The antibody can be used in any form, but in specific embodiments, the antibody is used in any type of non-natural chimeric polypeptide, including receptors and / or multispecific antibodies. In some embodiments, the antibody is employed in a receptor as an extracellular portion so that the receptor can bind to the TdT peptide as an antigen. In some embodiments, the antibody is used in a soluble protein, including a protein that may have one or more other antibodies to other antigens other than the TdT peptide; in this case, the protein can be a bispecific antibody, a trispecific antibody, etc. In certain embodiments, cells expressing chimeric receptors and / or soluble antibodies can be used, for example, including as adoptive cell therapy.

[0010] In various embodiments, the present disclosure addresses limitations in cancer therapeutic technologies by targeting TdT as a tumor antigen expressed on the surface of any type of cancer cell, including at least a subset of B-cell and T-cell acute lymphoblastic leukemia (ALL) and acute myeloid leukemia (AML), but absent in mature immune cells and early hematopoietic progenitor cells. 4 ( Figure 1 ). TdT is normally expressed in B cells and T cell precursors, where its activity has been implicated in leukemogenesis 5,6 ; The presence of TdT in peripheral primitive cells is a common diagnostic criterion for leukemia. Therefore, targeted TdT can enable highly selective treatment of acute leukemia (for example) without the risk of extratumoral destruction of key cell populations. This technology will address the limitations of adoptive cell therapy for leukemia. In other embodiments, solid tumors can be targeted by the treatments contained herein.

[0011] It is contemplated that any embodiment discussed in this specification can be implemented with respect to any method or composition of the invention, and vice versa. In addition, the compositions of the invention can be used to implement the methods of the invention.

[0012] Other objects, features and advantages of the present invention will become apparent from the following detailed description. However, it should be understood that the detailed description and specific examples, while indicating specific embodiments of the present invention, are given by way of illustration only, because various changes and modifications within the spirit and scope of the present invention will become apparent to those skilled in the art from this detailed description.

Brief Description of the Figures

[0014] The following drawings constitute part of this specification and are included to further demonstrate certain aspects of the present invention. The present invention may be better understood by referring to one or more of these drawings in conjunction with the detailed description of specific embodiments given herein.

[0015] Figure 1 : Expression of TdT in normal and malignant lymphocytes.

[0016] Figure 2 : Targeting TdT with chimeric TCR and BiTE.

[0017] Figure 3 A-3E: Structure, expression and function of TdT-specific CAR and cTCR. Figure 3 A) Schematic diagram showing the structure of CAR and cTCR. Figure 3 B) Expression of TdT.CAR and cTCR in primary T cells (n=7 donors). Figure 3 C) Expansion of modified T cells after transduction (n=7). Figure 3 D) Expression of CD27 and CD45RA on control and TdT-specific CD8+ T cells (n=6). Figure 3 E) Cytotoxicity of TdT-specific T cells against BV173 cells, co-cultured at an E:T ratio of 1:4 for 3 days (n=3).

[0018] Figure 4 A~4B: Specificity of TdT.cTCR T cells. ( Figure 4 A) Cytotoxicity of cTCR T cells against BV173 (TdT+ / A2+), NALM6 (TdT+ / A2+), CCRF-CEM (TdT+ / A2-) and THP-1 (TdT- / A2+) cells after 3 days of co-culture (n=3-4). Figure 4 B) Viability of normal autologous T and B cells after co-culture with TdT.cTCR- or CD19.CAR-expressing T cells was measured by Annexin V / 7-AAD staining (n=3).

[0019] Figure 5 A-5B: Effector function of CD4+ and CD8+ T cells transduced with TdT.cTCR. Representative flow graphs showing degranulation after co-culture with parental and MHC I-deficient (b2MKO) BV173 leukemia cells ( Figure 5 A) and IFNγ / TNFα production ( Figure 5 B).

[0020] Figure 6 : Redirection of T cell cytotoxicity against TdT+ / A2+ cell lines by CAR, cTCR or BiTE (n=3).

[0021] Figure 7 One embodiment of a chimeric TCR is shown, wherein the V H and V LThe domains are present on a single TCRα chain, in contrast to other receptors in the art (Liu et al., Sci Transl Med. 2021; 13(586):eabb5191). The constant chains of mouse TCRα and TCRβ are described.

[0022] Figure 8 Represents the expression of cTCR and STAR on T cells after retroviral transduction. NT: not transduced.

[0023] Fig. 9 The cytotoxicity of cTCR- and STAR-expressing T cells against the BV173 cell line (TdT+, HLA-A2+) was demonstrated.

[0024] Fig.10 Shown is the expression of cTCR and BiTE on T cells after retroviral transduction. NT: not transduced.

[0025] Fig.11 We demonstrated cTCR T cell cytotoxicity and BiTE-mediated killing of the BV173 cell line (TdT+, HLA-A2+).

[0026]

Detailed description

[0027] [I. Definition example]

[0028] In this application, the term "about" is used to indicate that a value includes the inherent variation of error of the measurement or quantification method.

[0029] When used with the term "comprising," the use of the word "a" or "an" may mean "one," but it is also consistent with the meaning of "one or more," "at least one," and "one or more."

[0030] The phrase "and / or" means either "and" or "or." To clarify, A, B, and / or C includes: A alone, B alone, C alone, a combination of A and B, a combination of A and C, a combination of B and C, or a combination of A, B, and C. In other words, "and / or" operates as an inclusive or.

[0031] As used herein, the phrase "at least one of" when used with a list of items means that different combinations of one or more of the listed items may be used, and only one of the items in the list may be required. An item may be a specific object, thing, step, operation, process, or category. In other words, "at least one of" means that any combination of items or numbers of items in the list may be used, but not all items in the list are required. For example, but not limited to, "at least one of item A, item B, or item C" means item A; item A and item B; item B; item A, item B, and item C; item B and item C; or items A and C. In some cases, "at least one of items A, B, or C" means, but is not limited to, two of items A, one of items B, and ten of items C; 4 items B and 7 items C; or some other suitable combination.

[0032] The words "comprise" (and any forms of inclusion, such as "includes" and "comprising"), "have" (and any forms of having, such as "haves" and "having"), "include" (and any forms of inclusion, such as "includes" and "comprising"), or "includes" (and any forms of inclusion, such as "includes" and "comprising") are inclusive or open-ended and do not exclude additional, unrecited elements or method steps.

[0033] In this specification, unless the context requires otherwise, the words "comprise", "comprising" and "including" will be understood to mean the inclusion of the stated steps or elements or groups of steps or elements but not the exclusion of any other steps or elements or groups of steps or elements. "Consisting of" means including and limited to whatever follows the phrase "consisting of". Thus, the phrase "consisting of" means that the listed elements are required or mandatory and no other elements may be present. "Consisting essentially of" means including any elements listed after the phrase and is limited to other elements that do not interfere with or contribute to the activity or action specified in this disclosure for the listed elements. Thus, the phrase "consisting essentially of" means that the listed elements are required or mandatory, but no other elements are optional and may or may not be present, depending on whether they affect the activity or operation of the listed elements.

[0034] In this specification, reference to "one embodiment", "an embodiment", "a specific embodiment", "a related embodiment", "a specific embodiment", "a specific embodiment", "an additional embodiment" or "a further embodiment" or a combination thereof means that a specific feature, structure or characteristic associated with the embodiment is included in at least one embodiment of the present invention. Therefore, the appearance of the above phrases in different places in this specification does not necessarily refer to the same embodiment. In addition, specific features, structures or characteristics can be combined in any appropriate manner in various embodiments.

[0035] The term "peptide" as used herein generally refers to amino acids connected by peptide bonds. A peptide may comprise an amino acid chain of about 5 to 50 residues. A peptide may comprise an amino acid chain shorter than 10 residues, including oligopeptides, dipeptides, tripeptides, and tetrapeptides. A peptide may comprise a chain longer than 50 residues and may be referred to as a "polypeptide" or "protein". In a specific embodiment, the term refers to the TdT peptide of ALYDKTKRI (SEQ ID NO: 3) or any peptide having at least 70, 75, 80, 85, 86, 87, 88, 89, 90 or more% identity with SEQ ID NO: 3. A peptide may be at least 5, 6, 7, 8 or all of the consecutive residues of SEQ ID NO: 3. There may be one or two substitutions compared to SEQ ID NO: 3. In a specific embodiment, any antibody contained herein is capable of targeting these variant peptides.

[0036] The term "subject" as used herein generally refers to an animal, such as a mammal (e.g., a human). For example, a subject may include a vertebrate, a mammal, a rodent (e.g., a mouse), a primate, an ape, or a human. Animals may include, but are not limited to, farm animals, sports animals, and pets, including dogs, cats, and horses. Subjects may include healthy or asymptomatic individuals, individuals suffering from or suspected of having a disease (e.g., cancer) or individuals with a disease susceptibility (e.g., a higher risk than the general population), and / or individuals in need of treatment or suspected of needing treatment. Subjects may be patients. "Individual," "subject," and "patient" may be used interchangeably and may refer to humans or non-humans.

[0037] "Treatment" or treatment of a disease or condition refers to the implementation of a regimen that may include the administration of one or more drugs to an individual (e.g., a patient) in an effort to alleviate the signs or symptoms of the disease. Desirable therapeutic effects include reducing the rate of disease progression, improving or alleviating the disease state, and alleviating or improving prognosis. Relief may occur before signs or symptoms of the disease or condition appear, or after the disease or condition appears. Therefore, "treatment" or "treatment" may include "prevention" or "prevention" of a disease or adverse condition. In addition, "treatment" or "treatment" does not require complete relief of signs or symptoms, does not require a cure, and specifically includes regimens that have only a marginal effect on the patient. The subject may or may not be receiving medical guidance over the Internet.

[0038] The term "therapeutically effective" as used throughout this application refers to anything that promotes or enhances the health of a subject with respect to the medical treatment of the condition. This includes, but is not limited to, a reduction in the frequency and / or severity of one or more signs or symptoms of a disease, including cancer, and / or a delay in its onset or spread.

[0039] It is specifically contemplated that any limitation discussed about one embodiment of the present invention may be applicable to any other embodiment of the present invention. In addition, any composition of the present invention may be used for any method of the present invention, and any method of the present invention may be used to produce or utilize any composition of the present invention. The various aspects of the embodiments set forth in the examples are also embodiments that can be implemented in the context of embodiments discussed elsewhere in the application (e.g., in the description of brief overview, detailed description, claims, and brief description of the accompanying drawings) and elsewhere in different embodiments.

[0040] Any method in the context of a therapeutic, diagnostic, or physiological purpose or effect may also be described using "use" claim language, such as "use" of any compound, composition, or agent discussed herein to achieve or carry out the described therapeutic, diagnostic, or physiological purpose or effect.

[0041]

****************

[0042] In various embodiments, the methods and compositions enhance the sensitivity of chimeric receptors targeting tumor antigens. The active development and clinical evaluation of CAR- and TCR-based immune cell therapies has prompted research into mechanisms that regulate tumor-specific receptor sensitivity and efficacy. While most CARs target antigens that are abundantly expressed on tumor cells, it is important to understand the limits of their antigen sensitivity and design new strategies to overcome low tumor responsiveness and reduced target antigen expression. Previous studies have shown that CARs have significantly reduced sensitivity compared to TCRs and tend to "ignore" tumor variants with reduced antigen surface density. 7,8 To overcome this limitation, certain embodiments combine high TCR sensitivity with the versatility of CAR-based targeting and provide highly sensitive chimeric TCRs and antibody-derived antigen recognition moieties.

[0043] [II. Compositions based on anti-TdT peptide antibodies]

[0044] The present disclosure relates to the use of specific antibodies that target one or more TdT peptides to treat one or more medical conditions and compositions utilizing them. In various embodiments, specific antibodies are used in one or more different compositions for targeting harmful cells that express TdT peptides, such as cancer cells that express TdT peptides, and in specific embodiments, the peptide comprises ALYDKTKRI (SEQ ID NO: 3) or a variant thereof that is still recognized by the antibody. In some embodiments, one of the compositions utilizing the antibody is cell-based and targets the TdT peptide, and the cell comprises a non-natural receptor on the surface of the cell in which the antibody is employed. In some embodiments, one of the compositions utilizing the antibody is soluble and targets the TdT peptide, although the composition is extracellular (however, it can be delivered to an individual in the form of a cell, and the soluble protein that constitutes the antibody is subsequently secreted from the cell). In specific embodiments, two types of antibody-based compositions are used.

[0045] In specific embodiments, the disclosure includes antibodies that bind a portion of a TdT protein, including antibodies that bind a TdT peptide comprising, consisting of, or consisting essentially of SEQ ID NO: 3. Although the antibody can be of any class, in specific embodiments, the antibody comprises a single chain variable fragment (scFv).

[0046] In various embodiments, the present disclosure provides a variety of scFvs that can be used for any chimeric receptor, including any chimeric TCR and / or any bispecific or multispecific antibody, including any bispecific T cell engager (BiTE). In a specific embodiment, the antibody comprises the following representative sequence:

[0047]

Clone 1: TdT_B1 polynucleotide sequence

[0048] ATGGCCTTAC CAGTGACCGC CTTGCTCCTG CCGCTGGCCT TGCTGCTCCA CGCCGCCAGG

[0049] CCGGCTCAAG TTCAGCTGGT GCAGAGCGGA GCGGAGGTGA AGAAGCCAGG GTCTTCCGTT

[0050] AAGGTCTCTT GTAAGGCCTC AGGCGGAACT TTCTCATCTT ACGCTATTTC CTGGGTAAGG

[0051] CAAGCACCAG GACAGGGATT AGAATGGATG GGGGGGATTA TCCCCATTTT CGGTACCGCG

[0052] AACTACGCCC AAAAATTTCA AGGTCGGGTA ACCATCACCG CCGATGAATC GACATCTACC

[0053] GCCTACATGG AACTGAGCTC TCTTCGGAGC GAGGACACCG CAGTCTATTA CTGCGCGAGA

[0054] GACGGGTATA GTGGTAGCTA CTACTATTAT TACGGCATGG ACGTTTGGGG CCAGGGGACC

[0055] TTAGTGACGG TGAGCAGCGG AGGAGGCGGC GGGTCCCAGT CTGCTCTGAC CCAACCTGCC

[0056] AGCGTCTCCG GCAGTCCAGG ACAAAGTATC ACCATCAGCT GCACTGGGAC TTCCAGCGAT

[0057] GTGGGGGGCT ACAATTACGT AAGTTGGTAC CAGCAACACC CTGGGAAGGC CCCCAAGCTG

[0058] ATGATTTATG ATGTCTCATA CAGACCGAGC GGAGTGAGCC ACCGTTTTAG TGGCTCCAAG

[0059] TCCGGAAACA CCGCTTCACT AACAATCAGT GGCTTACAAG CAGAGGACGA AGCCGATTAT

[0060] TACTGCTCAT CTTACACCAG TTCCAGTACG CTTGTGTTTG GTACTGGAACAAAGTTGACTGTGCTGGGC(SEQ ID NO:4)

[0061]

Clone 1: TdT_B1 polypeptide sequence; Signal peptide - V H -V L

[0062]

[0063] Among them, the signal peptide is located at the N - terminus and lacks a label, VH The domain is underlined, and V L Domains are both italicized and underlined.

[0064] In the specific embodiment of B1, the V H and V L as follows:

[0065]

V H

[0066]

[0067]

V L

[0068]

[0069] In a specific embodiment, the complementarity determining regions (CDRs) of B1 are as follows:

[0070]

[0071]

Clone 2: TdT_G7 polynucleotide sequence

[0072]

[0073]

Clone 2: TdT_G7 polypeptide sequence

[0074]

[0075] The signal peptide is located at the N-terminus and lacks a tag. H The domain is underlined, and V L Domains are both italicized and underlined.

[0076] In a specific embodiment, V for G7 H and V L as follows:

[0077]

V H

[0078]

[0079]

V L

[0080]

[0081] In a specific embodiment, the complementarity determining regions (CDRs) of G7 are as follows:

[0082]

[0083] LCDR2: DAS Series

[0084]

[0085]

Clone 3: TdT_G9 polynucleotide sequence

[0086]

[0087]

Clone 3: TdT_G9 polypeptide sequence

[0088]

[0089] The signal peptide is located at the N-terminus and lacks a tag. H The domain is underlined, and V L Domains are both italicized and underlined.

[0090] In the specific embodiment for G9, V H and V L as follows:

[0091]

V H

[0092]

[0093]

V L

[0094]

[0095] In a specific embodiment, the complementarity determining regions (CDRs) of G9 are as follows:

[0096]

[0097] LCDR3: QSYDSSNVI (SEQ ID NO: 45)

[0098] The scFv in various embodiments comprises any one or more of SEQ ID NOs: 4 to 9. The scFv in specific embodiments comprises a sequence having at least 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or more % identity to any one or more of SEQ ID NOs: 4 to 9.

[0099] Thus, in a specific embodiment, any antibody used in any composition (chimeric receptor, multispecific antibody, etc.) included herein may comprise the following V H One of the sequences or one or more modifications thereof:

[0100]

[0101] In a specific embodiment, the V H The domain comprises SEQ ID NO: 22, SEQ ID NO: 23 or SEQ ID NO: 24, or the V H The VH domain may have 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more modifications compared to SEQ ID NO: 22, SEQ ID NO: 23 or SEQ ID NO: 24, including amino acid substitutions, inversions, deletions, etc. The N-terminal and / or C-terminal sequences may have 1, 2, 3, 4, 5 or more amino acid truncations compared to SEQ ID NO: 22, SEQ ID NO: 23 or SEQ ID NO: 24. In a specific embodiment, the VH domain may have 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more modifications compared to SEQ ID NO: 22, SEQ ID NO: 23 or SEQ ID NO: 24, including amino acid substitutions, inversions, deletions, etc. The N-terminal and / or C-terminal sequences may have 1, 2, 3, 4, 5 or more amino acid truncations compared to SEQ ID NO: 22, SEQ ID NO: 23 or SEQ ID NO: 24. H The domain comprises at least 100, 105, 110, 115, 116, 117, 118, 119, 120, 121, 122 or all of the consecutive amino acids of SEQ ID NO:22, SEQ ID NO:23 or SEQ ID NO:24.

[0102] Thus, in a specific embodiment, any antibody used in any composition (chimeric receptor, multispecific antibody, etc.) included herein may comprise the following V L One of the sequences, or one or more modifications thereof:

[0103]

[0104] In a specific embodiment, the V L The domain comprises SEQ ID NO: 25, SEQ ID NO: 26 or SEQ ID NO: 27, or the V L The domain is at least 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% identical in sequence to SEQ ID NO: 25, SEQ ID NO: 26 or SEQ ID NO: 27. Compared to SEQ ID NO: 25, SEQ ID NO: 26 or SEQ ID NO: 27, V LThe domain may have 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more modifications, including amino acid substitutions, inversions, deletions, etc. The N-terminal and / or C-terminal sequences may have 1, 2, 3, 4, 5 or more amino acid truncations compared to SEQ ID NO: 25, SEQ ID NO: 26 or SEQ ID NO: 27. In a specific embodiment, V H The domain comprises at least 100, 105, 110, 115, 116, 117, 118, 119, 120, 121, 122 or all of the consecutive amino acids of SEQ ID NO:25, SEQ ID NO:26 or SEQ ID NO:27.

[0105] The scFv in various embodiments comprises any one or more of SEQ ID NOs: 4-9, 22-24, or 25-27. The scFv in specific embodiments comprises a sequence that is at least 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or more % identical to any one or more of SEQ ID NOs: 4-9, 22-24, or 25-27.

[0106] In a specific embodiment, the composition contained in the present invention can utilize an antibody or antigen-binding fragment, which comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises HCDR1, HCDR2 and HCDR3 of the heavy chain variable region from an antibody clone of B1, G7 or G9, and wherein the light chain variable region comprises LCDR1, LCDR2 and LCDR3 of the light chain variable region from the same corresponding clone of B1, G7 or G9. A further aspect relates to an antibody or antigen-binding fragment comprising a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises a HCDR1, HCDR2 and HCDR3 having at least 80% sequence identity to, or having at least 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% sequence identity to, a heavy chain variable region from a B1, G7 or G9 antibody clone (or wherein 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% (or any derivable range therein) sequence identity to the light chain variable region of the same corresponding clone of B1, G7 or G9.

[0107] In a specific embodiment, the composition contained in the present invention can utilize an antibody, an antigen-binding fragment or a polypeptide, which comprises a heavy chain variable region having HCDR1, HCDR2 and HCDR3, and a light chain variable region having LCDR1, LCDR2 and LCDR3, wherein HCDR1, HCDR2 and HCDR3 respectively comprise the amino acid sequences of SEQ ID NOs: 28 to 30, and LCDR1, LCDR2 and LCDR3 respectively comprise the amino acid sequences of SEQ ID NOs: 31, 33 and "DVS".

[0108] In a specific embodiment, the composition contained in the present invention can utilize an antibody, an antigen-binding fragment or a polypeptide, which comprises a heavy chain variable region having HCDR1, HCDR2 and HCDR3, and a light chain variable region having LCDR1, LCDR2 and LCDR3, wherein HCDR1, HCDR2 and HCDR3 respectively comprise the amino acid sequence of SEQ ID NOs: 34 to 36, and LCDR1, LCDR2 and LCDR3 respectively comprise the amino acid sequence of SEQ ID NOs: 37, 39 or "DAS".

[0109] In a specific embodiment, the composition contained herein can utilize an antibody, antigen-binding fragment or polypeptide, which comprises a heavy chain variable region having HCDR1, HCDR2 and HCDR3, and a light chain variable region having LCDR1, LCDR2 and LCDR3, wherein HCDR1, HCDR2 and HCDR3 respectively comprise the amino acid sequence of SEQ ID NOs: 40 to 42, and LCDR1, LCDR2 and LCDR3 respectively comprise the amino acid sequence of SEQ ID NOs: 43, 45 or "DDN".

[0110] Polynucleotides encoding antibodies or parts thereof, antibody proteins, vectors constituting polynucleotides, vectors encoding antibody proteins, and cells, proteins, and / or vectors comprising polynucleotides are all included herein. In a specific embodiment, the antibody is used for any kind of chimeric protein. In a specific embodiment, the chimeric protein is a receptor, including a receptor that binds to a TdT peptide, such as a receptor that comprises an antibody that binds to a TdT peptide. In a specific embodiment, the chimeric receptor is a chimeric T cell receptor (TCR) or a chimeric antigen receptor. Polynucleotides encoding chimeric TCRs comprising antibodies, chimeric TCR proteins, vectors comprising polynucleotides, vectors encoding chimeric TCR proteins, and cells comprising polynucleotides, proteins, and / or vectors are all included herein. The antibody portion of a chimeric TCR can be configured in a variety of ways relative to TCR alpha and beta chains. Any vector can be used, including viral vectors and non-viral vectors. The viral vector can be an adenoviral vector, an adeno-associated viral vector, a retroviral vector, or a lentiviral vector. The non-viral vector can be a plasmid or a transposon.

[0111] In one embodiment, the chimeric receptor is a synthetic T cell receptor (TCR) and antigen receptor (STAR) (Liu et al., Sci Transl Med. 2021; 13(586):eabb5191), wherein the antigen receptor comprises the antigen recognition domain of an antibody and the constant region of a TCR molecule ( Figure 7 In various embodiments, the STAR receptor is a two-chain TCRαβ-based receptor having immunoglobulin heavy and light chain variable regions (VH and V L In a specific embodiment, the STAR receptor comprises V H and V L In a specific embodiment, the STAR receptor comprises V L and V H Fusion with TCR α chain and β chain constant region respectively. Polynucleotides encoding chimeric STARs comprising antibodies, chimeric STAR proteins, vectors comprising polynucleotides, vectors encoding chimeric STAR proteins, and cells comprising polynucleotides, proteins and / or vectors are all included herein. Any vector can be used, including viral vectors and non-viral vectors. The viral vector can be an adenoviral vector, an adeno-associated viral vector, a retroviral vector or a lentiviral vector. The non-viral vector can be a plasmid or a transposon.

[0112] Although a representative example of a STAR receptor comprising the above-described B1 antibody and comprising two separate chains (B1 STAR) is provided below, any antibody that binds to the TdT peptide can be used equally well in any STAR configuration.

[0113]

B1_STAR (2 independent chains)

[0114]

B1_STAR VH-TCRA polynucleotide (VH of B1 antibody linked to TCRα chain H domain)

[0115]

[0116]

B1_STAR VH-TCRA peptide (VH of B1 antibody linked to TCRα chain H domain)

[0117]

[0118]

B1_STAR VL-TCRB polynucleotide (VL of B1 antibody linked to TCRβ chain) L domain)

[0119]

[0120]

B1_STAR VL-TCRB peptide (VL domain of B1 antibody linked to TCRβ chain)

[0121]

[0122] In one embodiment, the chimeric receptor is a chimeric T cell receptor (cTCR) comprising a specific domain or sequence. In this case, the scFv is fused to the TCR alpha and / or TCR beta chain. In specific embodiments, both the VH and VL domains are linked to the TCR alpha chain, or both the VH and VL domains are linked to the TCR beta chain. Although a representative example of a cTCR includes the B1 antibody (B1 cTCR) described above linked to a TCR alpha or beta chain, any antibody that binds to the TdT peptide can be used with any configuration of the TCR alpha beta chain. In the case of the VH and VL domains of the antibody, the VH and VL domains are linked to the TCR beta chain. L and V H If all variable domains are attached to the TCRα chain, the TCRβ chain will be considered “empty” (e.g., lacking variable domain sequences). L and V H domains are attached to the TCRβ chain, the TCRα chain would be considered “empty” (e.g., lacking the variable domain sequence).

[0123]

B1.cTCR

[0124]

B1_cTCR VHVL-TCRA polynucleotide (V L and V H domain is connected to the TCRα chain)

[0125]

[0126]

B1_cTCR VHVL-TCRA peptide (V L and V H domain is connected to the TCRα chain)

[0127]

[0128]

B1_cTCR VHVL-TCRB polynucleotide (V L and V H domain connected to the TCRβ chain)

[0129]

[0130]

[0131]

B1_cTCR VHVL-TCRB peptide (V L and V H domain connected to the TCRβ chain)

[0132]

[0133] An example of a TCRβ chain that is considered “empty” (lacking any antibody material) is as follows, and can be combined in a cell with a TCRα chain (itself combined with V H and V L Domain connection) combination:

[0134]

TCRβ_empty

[0135]

[0136]

TCRβ_empty protein

[0137]

[0138] Representative sequences of TCR alpha chains that are "empty" (lacking any antibody material) are known in the art.

[0139] In one embodiment, there are methods and compositions utilizing bispecific T cell engagers of specific sequences comprising any antibody that binds to a TdT peptide. Although the specific example of an engager uses the B1 antibody clone described above, in other embodiments, any TdT specific antibody is used for the BiTE.

[0140]

TdT B1 BiTE polynucleotide (B1 antibody linked to anti-CD3 antibody)

[0141]

[0142]

TdT B1 BiTE peptide (B1 antibody linked to anti-CD3 antibody)

[0143]

[0144] In various embodiments, any polynucleotide comprising a sequence encoding a chimeric receptor protein (chimeric TCR or STAR or chimeric antigen receptor) and / or BiTE may also encode one or more other gene products. In a specific embodiment, the polynucleotide encoding the chimeric receptor protein may also encode another gene product that also uses an antibody, including any anti-TdT peptide antibody. In a specific embodiment, the polynucleotide encoding the chimeric receptor protein also includes a sequence encoding a bispecific T cell engager (BiTE), including a sequence comprising an anti-TdT peptide antibody. In certain cases, the polynucleotide encoding the TCR protein is a different polynucleotide encoding the BiTE, and the BiTE comprises an antibody specific for TdT or a TdT peptide.

[0145] In a specific embodiment, the present disclosure relates to TdT-specific cytotoxic receptors and methods of using the same. The present disclosure includes novel agents that recognize and eliminate any type of cancer cell (including blood cancers, such as acute leukemia cells or solid tumors) without causing substantial damage to normal cells. In a specific embodiment, the present disclosure includes T cell-based (chimeric T cell receptors (TCRs) or STARs) and / or recombinant protein-based (bispecific T cell engagers) agents to target specific TdT peptides, including peptides present on the cell surface, for example in the context of HLA-A2. The potent activity of TdT-redirected T cells in preclinical models of human acute leukemia is demonstrated herein, although in other embodiments, immune effector cells other than T cells are used for adoptive cell therapy.

[0146] Embodiments of the present disclosure allow for redirection of CD4+ and CD8+ T cells to tumor antigens presented by class I MHC. T cells expressing natural TdT-specific TCRs are deleted during thymic selection, thereby excluding the selection or expansion of natural TdT-specific T cells in patients who need them (e.g., leukemia). To overcome this limitation, the inventors have identified an antibody binder that specifically recognizes dominant TdT peptides in the context of HLA-A02, which is the most common class I MHC allele in the Western world. Since this binding does not require CD8 co-receptors, the expression of TdT-specific cTCRs can effectively redirect CD8+ and CD4+ T cells to elicit effector functions against TdT+ leukemias, which is different from conventional MHC I-specific TCRs that only activate CD8+ T cells. According to current preclinical and clinical evidence, CD4+ T cell activation improves TdT-specific T cell responses and overall anti-leukemia activity in specific embodiments.

[0147] As shown elsewhere in this article, T cells expressing TdT-specific cTCRs have more potent anti-leukemic activity compared to T cells expressing similar TdT-specific chimeric antigen receptors (CARs). These results suggest that, in various embodiments, optimal recognition of rare TdT / HLA complexes requires highly sensitive TCR signaling. As shown herein, unmodified T cells can be effectively redirected to fight TdT+ leukemias in the presence of soluble TdT-specific T cell engagers, which similarly activate TCR signaling in bystander, unmodified T cells. These results provide a scientific rationale for the development of cellular and non-cellular strategies to target TdT using cTCR transgenic T cells or recombinant bispecific engagers, respectively. Compared to autologous engineered T cells, bispecific engagers offer ready availability and reduced manufacturing costs, and their use during treatment, including early in the course of treatment, may enhance the anti-tumor activity of standard of care treatments, particularly in high-risk T-ALL and AML patients ( Figure 2 ). Thus, in specific embodiments of the present disclosure, there are methods and compositions for employing adaptive T cell therapy and bispecific T cell engagers on the same individual.

[0148] In various embodiments, a recombinant T cell receptor (TCR) (which uses TCR alpha and beta chains, including cTCR referred to herein, and STAR referred to herein) comprises a single-chain fragment variable (scFv) specific for terminal deoxynucleotidyl transferase (TdT) or a TdT peptide. Any embodiment related to the receptor can be used, including non-natural TCR polypeptides, recombinant polynucleotides encoding TCR polypeptides, cells containing TCR polypeptides (including those isolated from nature, commercially obtained, obtained from donors or individuals treated with them, etc.) or polynucleotides encoding TCR polypeptides, any type of vector polynucleotide expressing TCR polypeptides, cells containing one or more recombinant polynucleotides, and so on. In a specific embodiment of the recombinant TCR, the TCR comprises a binder targeting the TdT peptide, such as an antibody, including a peptide that may be associated with HLA-A02 on the surface of a cell (including the surface of a cancer cell, not a non-cancerous cell).

[0149] The TCR is non-natural in that it has been designed by human hands to contain an antibody that binds to the TdT peptide, and in some embodiments structurally comprises a disulfide-linked membrane-anchored heterodimeric protein containing an alpha chain and a beta chain, and the TCR is in a configuration not found in nature. In a specific embodiment, the TCR alpha chain and / or TCR beta chain in the recombinant TCR has one or more modifications made by human hands, such as to prevent cross-pairing with endogenous TCRs present in cells and / or to enhance heterologous pairing with each other. In a specific embodiment, the alpha chain and / or beta chain is not from a human, but from another mammal, such as a mouse, rat, or monkey. In a specific embodiment, the V of the anti-TdT peptide antibody L and V H domains are all attached to the same TCR chain (α or β) ( Figure 7 In some embodiments, the corresponding TCR chain is linked to the V H or V L In a specific embodiment, representative sequences of TCR alpha and TCR beta chains can be used in the compositions of the present disclosure, wherein the bold underlined sequences have been modified compared to the wild type:

[0150]

TCRα

[0151]

[0152] NGAIAWSNQT SFTCQDIFKE TNATYPSSDV PCDATLTEKS FETDMNLNFQ NL LVIV LRILLLKVAGFNLL MTLRLWSS (SEQ ID NO: 1)

[0153]

TCRβ

[0154] EDLRNVTPPK VSLFEPSKAE IANKQKATLV CLARGFFPDH VELSWWVNGK EVHSGV C TDP

[0155] QAYKESNYSY CLSSRLRVSA TFWHNPRNHF RCQVQFHGLS EEDKWPEGSP KPVTQNISAEAWGRADCGIT SASYQQGVLS ATILYEILLG KATLYAVLVS TLVVMAMVKR KNS (SEQ ID NO: 2)

[0156] Any protein, polynucleotide and / or cell included herein may be included in the composition. The cell in the composition may be of any kind, including immune cells, such as immune effector cells. The cell in the composition may be a T cell, a NK cell, a NK T cell, a B cell, a macrophage, a neutrophil or a combination thereof. When the cell is a T cell, the T cell may be an αβT cell, a γδT cell, a T helper cell, an invariant natural killer T (iNKT) cell, a cytotoxic T cell, a T regulatory cell natural killer (NK) cell, or a combination thereof. In various embodiments, a cell may comprise (a) a polynucleotide comprising (1) a sequence encoding a recombinant TCR comprising a scFv specific for TdT or a TdT peptide; (2) a sequence encoding a BiTE comprising an antibody specific for TdT or a TdT peptide; or (b) a first polynucleotide comprising a sequence encoding a recombinant TCR comprising a scFv specific for TdT or a TdT peptide; and a second polynucleotide comprising a sequence encoding a BiTE comprising an antibody specific for TdT or a TdT peptide.

[0157] In some embodiments, the chimeric receptor used may include a chimeric antigen receptor (CAR). CAR can be first generation, second generation, third generation, and so on. In a specific embodiment, the antibody portion of the CAR targets a TdT peptide that may or may not be associated with HLA. The hinge, transmembrane domain, CD3ζ (or a domain with similar function), and optional one or more costimulatory domains can be of any suitable type.

[0158] III. Antibodies, general

[0159] Various aspects of the present disclosure relate to anti-TdT antibodies or fragments thereof. The term "antibody" refers to an intact immunoglobulin of any isotype, or a fragment thereof, that can compete with an intact antibody for specific binding to a target antigen, including chimeric antibodies, humanized antibodies, fully human antibodies, and bispecific antibodies. As used herein, the terms "antibody" or "immunoglobulin" are used interchangeably to refer to any of several classes of structurally related proteins that function as part of an animal's immune response, including IgG, IgD, IgE, IgA, IgM, and related proteins, as well as polypeptides comprising antibody CDR domains that retain antigen binding activity.

[0160] The term "antigen" refers to a molecule or a portion of a molecule that can be bound by a selective binding agent, such as an antibody. An antigen may have one or more epitopes that can interact with different antibodies.

[0161] The term "epitope" includes any region or portion of a molecule that is capable of inducing an immune response by binding to an immunoglobulin or T-cell receptor. Epitope determinants may include chemically active surface groups such as amino acids, sugar side chains, phosphate groups, or sulfonyl groups, and may have specific three-dimensional structural characteristics and / or specific charge characteristics. Typically, an antibody specific for a particular target antigen will preferentially recognize an epitope on the target antigen in a complex mixture.

[0162] Many different epitope mapping techniques known in the art can be used to identify the epitope region of a given polypeptide, including: X-ray crystallography, nuclear magnetic resonance spectroscopy, site-directed mutagenesis mapping, protein display arrays, see, for example, Epitope Mapping Protocols (Johan Rockberg and Johan Nilvebrant, Ed., 2018) Humana Press, New York, NY. Such techniques are known in the art, for example, U.S. Patent No. 4,708,871; Geysen et al. Proc. Natl. Acad. Sci. USA 81: 3998-4002 (1984); Geysen et al. Proc. Natl. Acad. Sci. USA 82: 178-182 (1985); Geysen et al. Molec. Immunol. 23: 709-715 (1986) For example, see Epitope Mapping Protocols, supra. Additionally, standard antigenicity and hydropathy plots can be used to predict and identify antigenic regions of proteins.

[0163] A complete antibody is usually composed of two full-length heavy chains and two full-length light chains, but may contain fewer chains in some cases, for example, antibodies naturally present in camelids may contain only heavy chains. The antibodies disclosed herein may be from only a single source, or they may be "chimeras", that is, different parts of the antibody may come from two different antibodies. For example, the variable region or CDR region may be from rat or mouse sources, while the constant region is from a different animal source, such as human. Antibodies or binding fragments can be produced in hybridomas by recombinant DNA technology or by enzymatic or chemical cleavage of complete antibodies. Unless otherwise specified, the term "antibody" includes derivatives, variants, fragments and decoy proteins thereof, examples of which are described below (Sela-Culang et al., Front Immunol. 2013; 4: 302; 2013)

[0164] The term "light chain" includes full-length light chains and fragments thereof that have sufficient variable region sequence to confer binding specificity. A full-length light chain has a molecular weight of approximately 25,000 daltons and includes one variable region domain (abbreviated herein as V L ) and a constant region domain (abbreviated herein as CL). There are two types of light chains, designated κ and λ. L "Fragment" refers to a fragment of a monoclonal antibody light chain, including all or part of the light chain variable region, including CDR. L The fragment may also include the light chain constant region sequence.The variable region domain of the light chain is located at the amino terminus of the polypeptide.

[0165] The term "heavy chain" includes a full-length heavy chain and fragments thereof that have sufficient variable region sequence to confer binding specificity. A full-length heavy chain has a molecular weight of approximately 50,000 daltons and includes one variable region domain (abbreviated herein as V H ) and three constant region domains (abbreviated herein as CH1, CH2, and CH3). The term "V H "Fragment" refers to a heavy chain fragment of a monoclonal antibody, including all or part of the heavy chain variable region, including CDRs. H The fragment may also include heavy chain constant region sequences. The number of heavy chain constant region domains will depend on the isotype. H The CH domain is located at the amino terminus of the polypeptide, and the CH domain is located at the carboxyl terminus, with the CH3 being closest to the -COOH terminus. The isotype of an antibody can be IgM, IgD, IgG, IgA, or IgE, defined by the presence of heavy chains, of which there are five types: μ, δ, γ, α, or ε chains. There are several subtypes of IgG, including but not limited to IgG1, IgG2, IgG3, and IgG4. IgM subtypes include IgM1 and IgM2. IgA subtypes include IgA1 and IgA2.

[0166] Antibodies may be whole immunoglobulins of any isotype or class, chimeric antibodies, or hybrid antibodies specific for two or more antigens. They may also be fragments (e.g., F(ab')2, Fab', Fab, Fv, etc.), including hybrid fragments. Immunoglobulins also include natural, synthetic, or genetically engineered proteins that function as antibodies by binding to specific antigens to form a complex. The term antibody includes transgenic or otherwise modified forms of immunoglobulins, such as:

[0167] The term "monomer" refers to an antibody that contains only one Ig unit. A monomer is the basic functional unit of an antibody. The term "dimer" refers to an antibody that contains two Ig units, which are interconnected by the constant domain (Fc, or crystallizable fragment, region) of the antibody heavy chain. The complex can be stabilized by connecting (J) chain proteins. The term "multimer" refers to an antibody that contains more than two Ig units, which are interconnected by the constant domain (Fc region) of the antibody heavy chain. The complex can be stabilized by connecting (J) chain proteins.

[0168] The term "bivalent antibody" refers to an antibody that contains two antigen-binding sites. The two binding sites may have the same antigen-specificity or may be bispecific, meaning that the two antigen-binding sites have different antigen-specificities.

[0169] Bispecific antibodies are a class of antibodies with two complements, which have different binding sites for two or more different epitopes. In some embodiments, bispecific antibodies can be double complements, wherein bispecific antibodies can specifically recognize different epitopes from the same antigen. In some embodiments, bispecific antibodies can be constructed by a pair of different single-domain antibodies called "nanoantibodies". Single-domain antibodies are derived from cartilaginous fish and camelids and modified. Nanoantibodies can be connected together using typical techniques of those skilled in the art through joints; This method of selecting and connecting nanoantibodies is described in PCT Publication Nos. WO2015044386A1, WO2010037838A2, and Bever et al., Anal Chem. 86: 7875-7882 (2014), each of which is incorporated herein by reference as a whole.

[0170] Bispecific antibodies can be constructed as: full IgG, Fab'2, Fab'PEG, diabodies, or alternatively as scFv. Diabodies and scFvs can be constructed without an Fc region, using only the variable domains, which may reduce the impact of anti-idiotypic responses. Bispecific antibodies can be produced by a variety of methods, including but not limited to fusion of hybridomas or connection of Fab' fragments. For example, see Songsivilai and Lachmann, Clin. Exp. Immunol. 79: 315-321 (1990); Kostelny et al., J. Immunol. 148: 1547-1553 (1992), each of which is incorporated herein by reference in its entirety.

[0171] In certain aspects, the antigen binding domain can be multispecific or heterospecific, by combining V domains that bind different antigens. H and V L For example, an antibody may bind to or interact with (a) a cell surface antigen, (b) an Fc receptor on the surface of an effector cell, or (c) at least one other component. Thus, aspects may include, but are not limited to, bispecific, trispecific, tetraspecific and other multispecific antibodies or antigen-binding fragments thereof, to epitopes and other targets, such as Fc receptors on effector cells.

[0172] In some embodiments, multispecific antibodies can be used and directly linked via short flexible polypeptide chains using conventional methods known in the art. One such example is diabodies, which are bivalent, bispecific antibodies in which V H and V LThe domains are expressed on a single polypeptide chain, and a linker that is too short does not allow pairing between domains on the same chain, thereby forcing the domains to pair with the complementary domains of another chain, thereby generating two antigen binding sites. The linker function is applicable to embodiments of tri-antibodies, tetra-antibodies, and high-order antibody multimers (e.g., see Hollinger et al., Proc Natl. Acad. Sci. USA 90: 6444-6448 (1993); Polijak et al., Structure 2: 1121-1123 (1994); Todorovska et al., J. Immunol. Methods 248: 47-66 (2001)).

[0173] Bispecific antibodies, in contrast to bispecific full antibodies, may also be advantageous because they can be easily constructed and expressed in E. coli. It is easy to select bispecific antibodies (and other polypeptides, such as antibody fragments) with appropriate binding specificity using phage display (WO94 / 13804) from libraries. If one arm of a bispecific antibody remains unchanged, for example, with specificity for a protein, a library can be established where the other arm changes, and antibodies with appropriate specificity can be selected. Bispecific full antibodies can be manufactured by substitution engineering methods described in Ridgeway et al., (Protein Eng., 9: 616-621, 1996) and Krah et al., (N Biotechnol. 39: 167-173, 2017), which are hereby incorporated by reference in their entirety.

[0174] Heteroconjugate antibodies consist of two covalently linked monoclonal antibodies of different specificities. See, e.g., U.S. Pat. No. 6,010,902, herein incorporated by reference in its entirety.

[0175] The part of the Fv fragment of an antibody molecule that binds to an antigenic epitope with high specificity is referred to herein as "patch". The patch is composed of amino acid residues that contact the antigenic epitope to promote antigen recognition. Each of the two Fv fragments of an antibody is composed of two variable domains VH and VL in a dimeric configuration. The primary structure of each variable domain includes three hypervariable loops, which are separated by a framework region (FR) and flanked by framework regions (FR). The hypervariable loop is the region with the highest primary sequence variability in the antibody molecule from any mammal. The term hypervariable loop is sometimes used interchangeably with the term "complementarity determining region (CDR)". The length of the hypervariable loop (or CDR) varies from antibody molecule to antibody molecule. The framework region of all antibody molecules from a given mammal has a very high primary sequence similarity / consistency. A person skilled in the art can use the consensus of the framework region to identify the framework region and the hypervariable loops (or CDRs) interspersed between the framework regions. The hypervariable loops are given identification names to distinguish their positions in the polypeptide and in which domain they appear. The CDRs in the VL domain are identified as L1, L2, and L3, with L1 occurring at the most distal end and L3 occurring closest to the CL domain. CDRs may also be designated as CDR-1, CDR-2, and CDR-3. L3 (CDR-L3) is generally the region with the highest variability among all antibody molecules produced by a given organism. CDRs are regions of the polypeptide chain that are arranged linearly in the primary structure and are separated from each other by framework regions. The amino terminus (N-terminus) of the VL chain is designated as FR1. The region identified as FR2 occurs between the L1 and L2 hypervariable loops. FR3 occurs between the L2 and L3 hypervariable loops, with the FR4 region being closest to the CL domain. This structure and nomenclature is repeated in the VH chain, which includes three CDRs identified as H1, H2, and H3. Most of the amino acid residues in the variable domains or Fv fragments (VH and VL) are part of the framework region (about 85%). The three-dimensional or tertiary structure of the antibody molecule causes the framework region to be located more internally in the molecule and provide most of the structure, with the CDRs located on the outer surface of the molecule.

[0176] Several methods have been developed and can be used by those skilled in the art to identify the exact amino acids that make up each of these regions. This can be accomplished using any of a variety of sequence alignment methods and algorithms that can identify the conserved amino acid residues that make up the framework regions, thereby identifying CDRs that may vary in length but are located between framework regions. Three commonly used methods have been developed to identify the CDRs of antibodies: Kabat (as described in TT Wu and EA Kabat, "AN ANALYSIS OF THE SEQUENCES OF THE VARIABLE REGIONS OF BENCE JONES PROTEINS AND MYELOMA LIGHT CHAINS AND THEIR IMPLICATIONS FOR ANTIBODY COMPLEMENTARITY," J Exp Med, vol. 132, no. 2, pp. 211-250, August 1970); Chothia (as described in C. Chothia et al., "Conformations of immunoglobulin hypervariable regions," Nature, vol. 342, no. 6252, pp. 877-883, December 1989); and IMGT (as described in M.-P. Lefrance et al., "IMGT unique numbering for immunoglobulin and T cell receptor variable domains and Ig superfamily V-like domains,” Developmental & Comparative Immunology, vol. 27, no. 1, pp. 55-77, January 2003). These methods all include a unique numbering system for identifying the amino acid residues that make up the variable region. In most antibody molecules, the amino acid residues that actually contact the antigen epitope appear in the CDR, although in some cases, residues within the framework region contribute to antigen binding.

[0177] One skilled in the art can use any of several methods to determine the complement of an antibody. These methods include: (1) computer prediction of the tertiary structure of the antibody / epitope binding interaction based on the chemical properties of the amino acid sequence of the antibody variable region and the composition of the epitope; (2) hydrogen-deuterium exchange and mass spectrometry; (3) polypeptide fragmentation and peptide mapping methods, in which one generates multiple overlapping peptide fragments from the entire length of the polypeptide and evaluates the binding affinity of these peptides for the epitope; (4) antibody phage display library analysis, in which the genes encoding the Fab fragments of mammalian antibodies are expressed by phage in a manner that is incorporated into the phage coat. The Fab-expressing phage population is then allowed to interact with an antigen that has been fixed or may be expressed by a different exogenous expression system. The non-binding Fab fragments are washed away, leaving only the specifically binding Fab fragments attached to the antigen. The bound Fab fragments can be easily isolated and the genes encoding them determined. This method can also be used for smaller regions of the Fab fragment, including Fv fragments or specific V H and V L Domain (as appropriate).

[0178] In some aspects, affinity-matured antibodies are enhanced by one or more modifications in one or more CDRs thereof, which results in an improved affinity of the antibody to the target antigen compared to a parent antibody without these changes. Certain affinity-matured antibodies have nanomolar or picomolar affinities for the target antigen. Affinity-matured antibodies are produced by procedures known in the art, for example, Marks et al., Bio / Technology 10: 779 (1992) describes affinity maturation by mixing VH and VL domains, and random mutagenesis of CDRs and / or framework residues used in phage display is described by Rajpal et al., PNAS. 24: 8466-8471 (2005) and Thie et al., Methods Mol Biol. 525: 309-22 (2009), combined with computational methods demonstrated in Tiller et al., Front. Immunol. 8: 986 (2017).

[0179] Chimeric immunoglobulins are the product of fused genes derived from different species; a "humanized" chimera typically has framework regions (FRs) from a human immunoglobulin and one or more CDRs from a non-human source.

[0180] In certain aspects, portions of the heavy and / or light chains are identical or homologous to corresponding sequences from another particular species or belonging to a particular antibody class or subclass, while the remainder of the chain is identical or homologous to corresponding sequences in antibodies derived from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies, so long as they exhibit the desired biological activity. U.S. Pat. No. 4,816,567; and Morrison et al., Proc. Natl. Acad. Sci. USA 81:6851 (1984). For methods of chimeric antibodies, see, for example, U.S. Pat. No. 4,816,567; and Morrison et al., Proc. Natl. Acad. Sci. USA 81:6851-6855 (1985), each of which is incorporated herein by reference in its entirety. CDR importing is described, for example, in U.S. Patent Nos. 6,180,370, 5,693,762, 5,693,761, 5,585,089, and 5,530,101, which are incorporated by reference for all purposes.

[0181] In some embodiments, minimizing the antibody polypeptide sequences from non-human species can optimize chimeric antibody function and reduce immunogenicity. Specific amino acid residues from non-antigen recognition regions of non-human antibodies are modified to be homologous to corresponding residues in human antibodies or isotypes. An example is a "CDR transplant" antibody, in which the antibody comprises one or more CDRs from a specific species or belonging to a specific antibody class or subclass, and the rest of the antibody chain is identical or homologous to the corresponding sequence in an antibody derived from another species or belonging to another antibody class or subclass. For use in humans, the variable region consisting of CDR1, CDR2 and part of CDR3 of the light chain and heavy chain variable regions of non-human immunoglobulins is introduced into the human antibody framework region, replacing the natural antigen receptor of human antibodies with non-human CDRs. In some cases, the corresponding non-human residues replace the framework region residues of human immunoglobulins. In addition, humanized antibodies may contain residues not found in the receptor antibody or donor antibody to further improve performance. Humanized antibodies may also contain at least a portion of an immunoglobulin constant region (Fc), typically a constant region of a human immunoglobulin. See, for example, Jones et al., Nature 321:522 (1986); Riechmann et al., Nature 332:323 (1988); Presta, Curr. Op. Struct. Biol. 2:593 (1992); Vaswani and Hamilton, Ann. Allergy, Asthma and Immunol. 1:105 (1998); Harris, Biochem. Soc. Transactions 23; 1035 (1995); Hurle and Gross, Curr. Op. Biotech. 5:428 (1994); Verhoeyen et al., Science 239:1534-36 (1988).

[0182] In vivo antibodies are intracellularly localized immunoglobulins that bind to intracellular antigens, in contrast to secreted antibodies, which bind antigens in the extracellular space.

[0183] Polyclonal antibody preparations usually include different antibodies against different determinants (epitopes). To produce polyclonal antibodies, a host (such as a rabbit or goat) is immunized with an antigen or antigen fragment, usually with an adjuvant and, if necessary, coupled to a carrier. Antibodies to the antigen are then collected from the host's serum. Polyclonal antibodies can be affinity purified against the antigen to make them monospecific.

[0184] A monoclonal antibody or "mAb" refers to an antibody obtained from a homogeneous population of antibodies from exclusive parental cells, i.e., the population is identical except for naturally occurring mutations that may be present in minor amounts. Each monoclonal antibody is directed against a single antigenic determinant.

[0185] [A. Functional antibody fragments and antigen-binding fragments]

[0186] 【1. Antigen-binding fragment】

[0187] Certain aspects relate to antibody fragments, such as antibody fragments that bind to and / or neutralize inflammatory mediators. The term functional antibody fragment includes antibody antigen-binding fragments that retain the ability to specifically bind to an antigen. These fragments consist of a variable region heavy chain (V H ) and / or light chain (V L ) in various arrangements; in some embodiments, they include constant regions heavy chain 1 (CH1) and light chain (CL). In some embodiments, they lack the Fc region consisting of heavy chain 2 (CH2) and 3 (CH3) domains. Embodiments of antigen-binding fragments and modifications thereof may include: (i) consisting of V L 、V H , CL and CH1 domains; (ii) Fab fragments consisting of V H and CH1 domains; (iii) Fd fragment types consisting of V H and V L (iv) single domain fragment type dAb, (Ward, 1989; McCafferty et al., 1990; Holt et al., 2003) composed of a single V H or V LDomain composition; (v) isolated complementarity determining region (CDR) region. These terms are described in, for example, Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, NY (1989); Molec. Biology and Biotechnology: A Comprehensive Desk Reference (Myers, RA (ed.), New York: VCH Publisher, Inc.); Huston et al., Cell Biophysics, 22: 189-224 (1993); Pluckthun and Skerra, Meth. Enzymol., 178: 497-515 (1989) and in Day, ED, Advanced Immunochemistry, 2d ed., Wiley-Liss, Inc. New York, NY (1990); Antibodies, 4: 259-277 (2015). The citations in this paragraph are all incorporated by reference.

[0188] Antigen binding fragments also include fragments of antibodies that retain exactly, at least or at most, 1, 2 or 3 complementary determining regions (CDRs) from the light chain variable region. Fusion of CDR-containing sequences to Fc regions (or their CH2 or CH3 regions) is included within the scope of this definition, including, for example, scFvs fused directly or indirectly to Fc regions are also included within the scope of this definition.

[0189] The term Fab fragment refers to a monovalent antigen-binding fragment of an antibody comprising VL, VH, CL and CH1 domains. The term Fab' fragment refers to a monovalent antigen-binding fragment of a monoclonal antibody that is larger than a Fab fragment. For example, a Fab' fragment includes VL, VH, CL and CH1 domains and all or part of the hinge region. The term F(ab')2 fragment refers to a divalent antigen-binding fragment of a monoclonal antibody, consisting of two Fab' fragments, which are connected by a disulfide bond in the hinge region. For example, a F(ab')2 fragment includes all or part of two VH and VL domains, and may further include all or part of two CL and CH1 domains.

[0190] The term Fd fragment refers to a heavy chain fragment of a monoclonal antibody, which comprises all or part of VH, including CDRs. The Fd fragment may further include a CH1 region sequence.

[0191] The term Fv fragment refers to a monovalent antigen-binding fragment of a monoclonal antibody, including all or part of VL and VH, and without CL and CH1 domains. VL and VH include CDRs, etc. Single-chain antibodies (sFv or scFv) are Fv molecules in which the VL and VH regions are connected by a flexible linker to form a single polypeptide chain to form an antigen-binding fragment. Single-chain antibodies are discussed in detail in International Patent Application Publication No. WO 88 / 01649 and U.S. Patent Nos. 4,946,778 and 5,260,203, the disclosures of which are incorporated herein by reference as a whole. The term (scFv) 2 refers to a bivalent or bispecific sFv polypeptide chain, the C-terminus of which contains an oligomerization domain, which is separated from the sFv by a hinge region (Pack et al., 1992). The oligomerization domain includes a self-associated α-helix, such as a leucine zipper, which can be further stabilized by additional disulfide bonds. (scFv) 2 fragments are also referred to as "miniantibodies" or "miniantibodies".

[0192] Single domain antibodies are antigen binding fragments that contain only a VH or VL domain. In some cases, two or more VH regions are covalently linked with a peptide linker to produce a bivalent domain antibody. The two VH regions of a bivalent domain antibody can target the same or different antigens.

[0193] 2. Fragment crystallizable region, Fc

[0194] The Fc region comprises two heavy chain fragments, which comprise the CH2 and CH3 domains of an antibody. The two heavy chain fragments are bound together by two or more disulfide bonds and the hydrophobic interactions of the CH3 domains. The term "Fc polypeptide" as used herein includes native and mutant protein forms of polypeptides derived from the Fc region of an antibody. A truncated form of such polypeptide comprising a hinge region that promotes dimerization is included.

[0195] [B. Polypeptide having antibody CDR and scaffold domain displaying CDR]

[0196] Antigen binding peptide scaffolds, such as complementarity determining regions (CDRs), are used to generate protein binding molecules according to the embodiments. Generally, one skilled in the art can determine the type of protein scaffold on which to introduce at least one CDR. It is well known that the scaffold preferably must meet a number of criteria, such as: good phylogenetic conservation; known three-dimensional structure; small size; little or no post-transcriptional modification; and / or ease of production, expression and purification. Skerra, J Mol Recognit, 13: 167-87 (2000).

[0197] The protein scaffold may be derived from, but is not limited to, fibronectin type III FN3 domain (referred to as "monomer"), fibronectin type III domain 10, lipocalin, anti-calcitonin, the Z-domain of Staphylococcus aureus protein A, thioredoxin A, or a protein with a repeating motif, such as "ankyrin repeats," "armadillo repeats," "leucine-rich repeats," and "tetratricopeptide repeats." Such proteins are described in U.S. Patent Publication Nos. 2010 / 0285564, 2006 / 0058510, 2006 / 0088908, 2005 / 0106660, and PCT Publication No. WO2006 / 056464, each of which is specifically incorporated herein by reference in its entirety. Scaffolds derived from toxins of scorpions, insects, plants, mollusks, etc., as well as protein inhibitors of neuronal NO synthase (PIN) may also be used.

[0198]

C. Antibody Type

[0199] Antibodies can be whole immunoglobulins of any isotype or classification, chimeric antibodies, or hybrid antibodies specific for two or more antigens. They can also be fragments (e.g., F(ab')2, Fab', Fab, Fv, etc.), including hybrid fragments. Immunoglobulins also include natural, synthetic or genetically engineered proteins that function as antibodies by binding to specific antigens to form complexes. The term antibody includes transgenic or otherwise modified forms of immunoglobulins.

[0200] The term "monomer" refers to an antibody that contains only one Ig unit. A monomer is the basic functional unit of an antibody. The term "dimer" refers to an antibody that contains two Ig units that are interconnected by the constant domain (Fc or crystallizable fragment region) of the antibody heavy chain. The complex can be stabilized by connecting (J) chain proteins. The term "multimer" refers to an antibody that contains more than two Ig units that are interconnected by the constant domain (Fc region) of the antibody heavy chain. The complex can be stabilized by connecting (J) chain proteins.

[0201] The term "bivalent antibody" refers to an antibody that contains two antigen-binding sites. The two binding sites may have the same antigen-specificity or may be bispecific, meaning that the two antigen-binding sites have different antigen-specificities.

[0202] Bispecific antibodies are a class of antibodies with two complements, whose binding sites have different binding sites for two or more different epitopes. In some embodiments, bispecific antibodies can be double complemented, wherein the bispecific antibody can specifically recognize different epitopes from the same antigen. In some embodiments, bispecific antibodies can be constructed from a pair of different single-domain antibodies called "nanobodies". Single-domain antibodies are derived from cartilaginous fish and camelids and modified. Nanobodies can be connected together using typical techniques of those skilled in the art through linkers; this method of selecting and connecting nanobodies is described in PCT Publication Nos. WO2015044386A1, WO2010037838A2 and Bever et al., Anal Chem.86:7875-7882 (2014), each of which is specifically incorporated herein by reference in its entirety.

[0203] Bispecific antibodies can be constructed as: full IgG, Fab'2, Fab'PEG, diabodies, or alternatively as scFv. Diabodies and scFvs can be constructed without an Fc region, using only the variable domains, which may reduce the impact of anti-idiotypic responses. Bispecific antibodies can be produced by a variety of methods, including but not limited to fusion of hybridomas or connection of Fab' fragments. For example, see Songsivilai and Lachmann, Clin. Exp. Immunol. 79: 315-321 (1990); Kostelny et al., J. Immunol. 148: 1547-1553 (1992), each of which is expressly incorporated herein by reference.

[0204] In certain aspects, the antigen binding domain can be expressed by binding to a V domain that binds a different antigen. H and V L The antibody may bind to or interact with (a) a cell surface antigen, (b) an Fc receptor on the surface of an effector cell, or (c) at least one other component. Thus, aspects may include, but are not limited to, bispecific, trispecific, tetraspecific and other multispecific antibodies or antigen-binding fragments thereof that are directed against epitopes and other targets, such as Fc receptors on effector cells.

[0205] In some embodiments, multispecific antibodies can be used and directly linked via short flexible polypeptide chains using conventional methods known in the art. One such example is diabodies, which are bivalent, bispecific antibodies in which V H and V LThe domains are expressed on a single polypeptide chain, and a linker that is too short does not allow pairing between domains on the same chain, thereby forcing the domains to pair with the complementary domains of another chain, thereby generating two antigen-binding sites. The linker function is applicable to embodiments of triabodies, tetrabodies, and high-order antibody multimers (e.g., see Hollinger et al., Proc Natl. Acad. Sci. USA 90: 6444-6448 (1993); Polijak et al., Structure 2: 1121-1123 (1994); Todorovska et al., J. Immunol. Methods 248: 47-66 (2001)).

[0206] Bispecific antibodies, in contrast to bispecific full antibodies, may also be advantageous because they can be easily constructed and expressed in E. coli. Diabodies (and other polypeptides, such as antibody fragments) with appropriate binding specificity can be easily selected from libraries using phage display (WO94 / 13804). If one arm of a bispecific antibody remains unchanged, for example, with specificity for a protein, a library can be established where the other arm changes, and antibodies with appropriate specificity can be selected. Bispecific full antibodies can be made by alternative engineering methods described in Ridgeway et al. (Protein Eng., 9: 616-621, 1996) and Krah et al. (N Biotechnol. 39: 167-173, 2017), which are hereby incorporated by reference in their entirety.

[0207] Heteroconjugate antibodies consist of two covalently linked monoclonal antibodies of different specificities. See, e.g., U.S. Pat. No. 6,010,902, herein incorporated by reference in its entirety.

[0208] The portion of the Fv fragment of an antibody molecule that binds to an antigenic epitope with high specificity is referred to herein as a "patch". The patch consists of amino acid residues that contact the antigenic epitope to facilitate antigen recognition. Each of the two Fv fragments of an antibody consists of two variable domains V in a dimeric configuration. H and V LThe primary structure of each variable domain includes three hypervariable loops, which are separated by framework regions (FR) and flanked by framework regions (FR). The hypervariable loop is the region with the highest primary sequence variability in antibody molecules from any mammal. The term hypervariable loop is sometimes used interchangeably with the term "complementarity determining region (CDR)". The length of the hypervariable loop (or CDR) varies from antibody molecule to antibody molecule. The framework regions of all antibody molecules from a given mammal have a high primary sequence similarity / identity. A person skilled in the art can use the consensus of the framework regions to identify the framework regions and the hypervariable loops (or CDRs) interspersed between the framework regions. The hypervariable loops are given identification names to distinguish their location in the polypeptide and in which domain they appear. L The CDRs in a domain are identified as L1, L2, and L3, with L1 occurring most distally and L3 occurring closest to the CL domain. CDRs may also be designated as CDR-1, CDR-2, and CDR-3. L3 (CDR-3) is generally the region with the highest variability among all antibody molecules produced by a given organism. CDRs are regions of a polypeptide chain that are linearly arranged in the primary structure and separated from each other by framework regions. L The amino-terminal (N-terminal) end of the chain is designated FR1. The region identified as FR2 occurs between the L1 and L2 hypervariable loops. FR3 occurs between the L2 and L3 hypervariable loops, with the FR4 region closest to the CL domain. This structure and nomenclature is consistent with the V H The variable domains are repeated on the same chain, including three CDRs, namely H1, H2 and H3. Most of the amino acid residues in the variable domain or Fv fragment (V H and V L ) is part of the framework region (about 85%). The three-dimensional or tertiary structure of the antibody molecule is such that the framework region is located more internally in the molecule and provides most of the structure, while the CDRs are located on the outer surface of the molecule.

[0209] Several methods have been developed and can be used by those skilled in the art to identify the exact amino acids that make up each of these regions. This can be accomplished using any of a variety of sequence alignment methods and algorithms that can identify the conserved amino acid residues that make up the framework regions, thereby identifying CDRs that may vary in length but are located between framework regions. Three commonly used methods have been developed to identify the CDRs of antibodies: Kabat (as described in TT Wu and E. A. Kabat, "AN ANALYSIS OF THE SEQUENCES OF THE VARIABLE REGIONS OF BENCEJONES PROTEINS AND MYELOMA LIGHT CHAINS AND THEIR IMPLICATIONS FOR ANTIBODY COMPLEMENTARITY," J Exp Med, vol. 132, no. 2, pp. 211-250, August 1970); Chothia (as described in C. Chothia et al., "Conformations of immunoglobulin hypervariable regions," Nature, vol. 342, no. 6252, pp. 877-883, December 1989); and IMGT (as described in M.-P. Lefrance et al., "IMGT unique numbering for immunoglobulin and T cell receptor variable domains and Ig superfamily V-like domains,” Developmental & Comparative Immunology, vol. 27, no. 1, pp. 55-77, January 2003). These methods all include a unique numbering system for identifying the amino acid residues that make up the variable region. In most antibody molecules, the amino acid residues that actually contact the antigen epitope appear in the CDR, although in some cases, residues within the framework region contribute to antigen binding.

[0210] One skilled in the art can use any of several methods to determine the position of an antibody. These methods include:

[0211] (1) Based on the chemical properties of the amino acid sequence of the antibody variable region and the composition of the epitope, the tertiary structure of the antibody / epitope binding interaction is calculated and predicted.

[0212] (2) Hydrogen-deuterium exchange and mass spectrometry

[0213] (3) Peptide fragmentation and peptide mapping methods, one of which generates multiple overlapping peptide fragments from the entire length of the polypeptide and evaluates the binding affinity of these peptides for the epitope.

[0214] (4) Analysis of antibody phage display libraries, in which antibody Fab fragments encoding mammalian genes are expressed by phage in a manner incorporated into the phage coat. The Fab-expressing phage population is then allowed to interact with an antigen that has been immobilized or may be expressed by a different exogenous expression system. Non-binding Fab fragments are washed away, leaving only the specific binding Fab fragments attached to the antigen. The bound Fab fragments can be easily isolated and the genes encoding them determined. This method can also be used for smaller regions of Fab fragments, including Fv fragments or specific V H and V L Domain (as appropriate).

[0215] In certain aspects, affinity matured antibodies are enhanced by one or more modifications in one or more of their CDRs, which results in an improvement in the affinity of the antibody for the target antigen compared to a parent antibody that does not have these changes. Certain affinity matured antibodies have nanomolar or picomolar affinities for the target antigen. Affinity matured antibodies are produced by procedures known in the art, for example, Marks et al., Bio / Technology 10:779 (1992) describes affinity mature antibodies produced by V H and V L Affinity maturation of domain shuffling, random mutagenesis of CDR and / or framework residues employed in phage display is described in Rajpal et al., PNAS. 24:8466-8471 (2005) and Thie et al., Methods Mol Biol. 525:309-22 (2009) in combination with computational methods demonstrated in Tiller et al., Front. Immunol. 8:986 (2017).

[0216] Chimeric immunoglobulins are the product of fused genes derived from different species; a "humanized" chimera typically has framework regions (FRs) from a human immunoglobulin and one or more CDRs from a non-human source.

[0217] In certain aspects, portions of the heavy and / or light chains are identical or homologous to corresponding sequences from another particular species or belonging to a particular antibody class or subclass, while the remainder of the chain is identical or homologous to corresponding sequences in antibodies derived from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies, as long as they exhibit the desired biological activity. U.S. Pat. No. 4,816,567; and Morrison et al., Proc. Natl. Acad. Sci. USA 81:6851 (1984). For methods of chimeric antibodies, see, for example, U.S. Pat. No. 4,816,567; and Morrison et al., Proc. Natl. Acad. Sci. USA 81:6851-6855 (1985), each of which is specifically incorporated herein by reference in its entirety. For example, CDR grafting is described in U.S. Patent Nos. 6,180,370, 5,693,762, 5,693,761, 5,585,089, and 5,530,101, all of which are incorporated herein by reference.

[0218] In some embodiments, minimizing antibody polypeptide sequences from non-human species can optimize chimeric antibody function and reduce immunogenicity. Specific amino acid residues from non-antigen recognition regions of non-human antibodies are modified to be homologous to corresponding residues in human antibodies or isotypes. An example is a "CDR transplant" antibody, in which the antibody contains one or more CDRs from a specific species or belonging to a specific antibody class or subclass, while the rest of the antibody chain is identical or homologous to the corresponding sequence in an antibody derived from another species or belonging to another antibody class or subclass. For human use, the V region consisting of CDR1, CDR2, and part of CDR3 of the light and heavy chain variance regions of non-human immunoglobulins is grafted with the human antibody framework region, replacing the natural antigen receptor of the human antibody with non-human CDRs. In some cases, the corresponding non-human residues replace the framework region residues of human immunoglobulins. In addition, humanized antibodies may contain residues not found in the recipient antibody or donor antibody to further improve performance. Humanized antibodies may also contain at least a portion of the immunoglobulin constant region (Fc), typically the constant region of a human immunoglobulin. See, for example, Jones et al., Nature 321:522 (1986); Riechmann et al., Nature 332:323 (1988); Presta, Curr. Op. Struct. Biol. 2:593 (1992); Vaswani and Hamilton, Ann. Allergy, Asthma and Immunol. 1:105 (1998); Harris, Biochem. Soc. Transactions 23; 1035 (1995); Hurle and Gross, Curr. Op. Biotech. 5:428 (1994); Verhoeyen et al., Science 239:1534-36 (1988).

[0219] In vivo antibodies are intracellularly localized immunoglobulins that bind to intracellular antigens, as opposed to secreted antibodies, which bind to antigens in the extracellular space.

[0220] Polyclonal antibody preparations usually include different antibodies against different determinants (epitopes). To produce polyclonal antibodies, a host is immunized with an antigen or antigen fragment (such as a rabbit or goat), usually with an adjuvant and, if necessary, coupled to a carrier. The antigen and antibodies are then collected from the host's serum. Polyclonal antibodies can be affinity purified against the antigen to make them monospecific.

[0221] A monoclonal antibody or "mAb" refers to an antibody obtained from a homogeneous population of antibodies from exclusive parental cells, i.e., the population is identical except for naturally occurring mutations that may be present in minor amounts. Each monoclonal antibody is directed against a single antigenic determinant.

[0222]

D. Functional antibody fragments and antigen-binding fragments

[0223] 【1. Antigen-binding fragment】

[0224] Certain aspects relate to antibody fragments, such as antibody fragments that bind to an antigen. The term functional antibody fragment includes antibody antigen-binding fragments that retain the ability to specifically bind to an antigen. These fragments consist of a variable region heavy chain (V H ) and / or light chain (V L ) in various arrangements; in some embodiments, they include constant regions heavy chain 1 (CH1) and light chain (CL). In some embodiments, they lack the Fc region consisting of heavy chain 2 (CH2) and 3 (CH3) domains. Embodiments of antigen-binding fragments and modifications thereof may include: (i) consisting of V L 、V H , CL and CH1 domains; (ii) Fab fragments consisting of V H and CH1 domains; (iii) Fd fragment types consisting of V H and V L (iv) single domain fragment type dAb, (Ward, 1989; McCafferty et al., 1990; Holt et al., 2003) composed of a single V H or V LDomain composition; (v) isolated complementarity determining region (CDR) region. These terms are described in, for example, Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, NY (1989); Molec. Biology and Biotechnology: A Comprehensive Desk Reference (Myers, RA (ed.), New York: VCH Publisher, Inc.); Huston et al., Cell Biophysics, 22: 189-224 (1993); Pluckthun and Skerra, Meth. Enzymol., 178: 497-515 (1989) and in Day, ED, Advanced Immunochemistry, 2d ed., Wiley-Liss, Inc. New York, NY (1990); Antibodies, 4: 259-277 (2015), each of which is incorporated herein by reference.

[0225] Antigen binding fragments also include fragments of antibodies that retain exactly, at least or at most, 1, 2 or 3 complementary determining regions (CDRs) from the light chain variable region. Fusion of CDR-containing sequences to the Fc region (or its CH2 or CH3 region) is included within the scope of this definition, including, for example, scFvs fused directly or indirectly to the Fc region are also included within the scope of this definition.

[0226] The term Fab fragment refers to a fragment comprising V L 、V H The term Fab' fragment refers to a monovalent antigen-binding fragment of a monoclonal antibody that is larger than the Fab fragment. For example, a Fab' fragment includes V L 、V H , CL and CH1 domains and all or part of the hinge region. The term F(ab')2 fragment refers to a bivalent antigen-binding fragment of a monoclonal antibody consisting of two Fab' fragments linked by a disulfide bond at the hinge region. For example, a F(ab')2 fragment includes two V H and V L domain, and may further include all or part of two CL and CH1 domains.

[0227] The term Fd fragment refers to a heavy chain fragment of a monoclonal antibody, which includes all or part of the V H, including CDR. The Fd fragment may further include a CH1 region sequence.

[0228] The term Fv fragment refers to a monovalent antigen-binding fragment of a monoclonal antibody, comprising all or part of the V L and V H , and there are no CL and CH1 domains. L and V H Including CDR, etc. Single-chain antibody (sFv or scFv) is an Fv molecule in which V L and V H The regions are connected by flexible joints to form a single polypeptide chain to form an antigen binding fragment. Single-chain antibodies are discussed in detail in International Patent Application Publication No. WO 88 / 01649 and U.S. Patent Nos. 4,946,778 and 5,260,203, the disclosures of which are incorporated herein by reference. The term (scFv)2 refers to a bivalent or bispecific sFv polypeptide chain, the C-terminus of which includes an oligomerization domain separated from the sFv by a hinge region (Pack et al., 1992). The oligomerization domain includes self-associated α helices, such as leucine zippers, which can be further stabilized by additional disulfide bonds. (scFv)2 fragments are also referred to as "miniantibodies" or "miniantibodies".

[0229] Single-domain antibodies are antibodies that contain only V H or V L In some cases, two or more V H The two V domains of the bivalent domain antibody are covalently linked to a peptide linker to generate a bivalent domain antibody. H The regions can target the same or different antigens.

[0230] 2. Fragment crystallizable region, Fc

[0231] The Fc region comprises two heavy chain fragments, which comprise the CH2 and CH3 domains of an antibody. The two heavy chain fragments are bound together by two or more disulfide bonds and the hydrophobic interactions of the CH3 domains. The term "Fc polypeptide" as used herein includes native and mutant protein forms of polypeptides derived from the Fc region of an antibody. A truncated form of such polypeptide comprising a hinge region that promotes dimerization is included.

[0232]

E. Antibody Binding

[0233] The term "selective binding agent" refers to a molecule that binds to an antigen. Non-limiting examples include antibodies, antigen-binding fragments, scFv, Fab, Fab', F(ab')2, single-chain antibodies, peptides, peptide fragments, and proteins.

[0234] The term "binding" refers to direct binding between two molecules, for example due to covalent, electrostatic, hydrophobic and ionic and / or hydrogen bonding interactions, including interactions such as salt bridges and water bridges. "Immunoreactivity" means that a selective binding agent or antibody of interest will bind to an antigen present in a biological sample. The term "immune complex" refers to the combination formed when an antibody or selective binding agent binds to an epitope on an antigen.

[0235] 【1. Affinity / Affinity】

[0236] The term "affinity" refers to the strength with which an antibody or selective binding agent binds to an epitope. In an antibody binding reaction, this is expressed as the affinity constant (Ka or ka is sometimes referred to as the association constant) of any given antibody or selective binding agent. Affinity is measured as a comparison of the binding strength of an antibody to its associated antigen with the binding strength of the antibody to an unrelated amino acid sequence. Affinity can be expressed, for example, as a 20-fold higher binding capacity of an antibody to its antigen than to an unrelated amino acid sequence. The term "affinity" as used herein refers to the resistance of a complex of two or more reagents to dissociation after dilution. The terms "immunoreactivity" and "preferential binding" are used interchangeably herein with respect to antibodies and / or selective binding agents.

[0237] There are several experimental methods that can be used by those skilled in the art to assess the binding affinity of any given antibody or selective binding agent for its antigen. This is usually accomplished by measuring the equilibrium dissociation constant (KD or Kd), using the equation KD = k off / k on = [A] [B] / [AB]. Term k off The k is the rate of dissociation between the antibody and the antigen per unit time and is related to the concentration of the antibody and antigen present in the solution in unbound form at equilibrium. on It is the rate at which antibody and antigen bind per unit time and is related to the concentration of bound antigen-antibody complexes at equilibrium. The unit used to measure KD is mol / L (molar concentration or M) or concentration. The Ka of an antibody is the inverse of the KD and is determined by the equation Ka = 1 / KD. Some examples of experimental methods that can be used to determine KD values ​​include: enzyme-linked immunosorbent assay (ELISA), isothermal titration calorimetry (ITC), fluorescence anisotropy, surface plasmon resonance (SPR), and affinity capillary electrophoresis (ACE). The affinity constant (Ka) of an antibody is the inverse of the KD and is determined by the equation Ka = 1 / KD.

[0238] Antibodies contemplated as useful in certain embodiments may have a 6 , 10 7 , 10 8 , 10 9 or 10 10M or any range derivable therein. Similarly, in some embodiments, an antibody may have an affinity constant (Ka) of about, at least, or at most about 10 -6 , 10 -7 , 10 -8 , 10 -9 , 10 -10 M or any range of dissociation constants derivable therein. These values ​​are reported for the antibodies discussed herein, and the same assays can be used to assess the binding properties of such antibodies. When the dissociation constant (KD) is ≤10 -8 M, an antibody of the invention is said to "specifically bind" to its target antigen. -9 M, the antibody specifically binds to the antigen with "high affinity", and when KD is ≤5×10 -10 M, the antibody specifically binds the antigen with "very high affinity".

[0239] 【2. Epitope specificity】

[0240] The epitope of an antigen is a specific region of an antigen to which an antibody has binding affinity. In the case of a protein or polypeptide antigen, an epitope is a specific residue (or specific amino acid or protein fragment) to which an antibody binds with high affinity. An antibody does not necessarily contact every residue in a protein. Every amino acid substitution or deletion in a protein does not necessarily affect binding affinity. For the purposes of this specification and the appended claims, the terms "epitope" and "antigenic determinant" are used interchangeably to refer to a site on an antigen that a B cell and / or T cell reacts or recognizes. A polypeptide epitope can be formed by continuous and non-continuous amino acids and is juxtaposed to the tertiary fold of a polypeptide. An epitope typically includes at least 3 amino acids, typically 5 to 10 amino acids, and has a unique spatial conformation.

[0241] The epitope specificity of an antibody can be determined in a variety of ways. For example, one method involves testing a set of overlapping peptides that are 15 amino acids across the entire sequence of the protein and differ in increments of a small number of amino acids (e.g., 3 to 30 amino acids). The peptides are fixed in separate wells of a microtiter dish. For example, fixation can be accomplished by biotinylating one end of the peptide. This process may affect the affinity of the antibody for the epitope, so different samples of the same peptide can be biotinylated at the N and C termini and fixed in separate wells for comparison. This is useful for identifying end-specific antibodies. Alternatively, other peptides that terminate at specific target amino acids may be included. This method can be used to identify end-specific antibodies against internal fragments. Screen antibodies or antigen-binding fragments to bind to each of the various peptides. An epitope is defined as an amino acid fragment common to all peptides to which an antibody shows high affinity binding.

[0242] 【3. Modification of Antibody Antigen Binding Domain】

[0243] It is understood that the antibodies of the present disclosure can be modified so that they are substantially identical to the antibody polypeptide sequences or fragments thereof and still bind to the epitopes of the present invention. When optimally aligned using programs such as Clustal Omega, IGBLAST, GAP or BESTFIT with default gap weights, polypeptide sequences are "substantially identical" if they share at least 80% sequence identity, at least 90% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, or at least 99% sequence identity, or any range thereof.

[0244] As discussed herein, minor changes in the amino acid sequence of an antibody or antigen-binding region thereof are contemplated as being encompassed by the present invention, provided that the changes in the amino acid sequence maintain at least 75%, more preferably at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, and most preferably at least 99% sequence identity. In particular, conservative amino acid substitutions are contemplated.

[0245] Conservative substitutions are those that occur within a family of amino acids that are related in their side chains. Genetically encoded amino acids are often divided into families based on the chemical properties of their side chains; for example, acidic (aspartic acid, glutamic acid), basic (lysine, arginine, histidine), nonpolar (alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), and uncharged polar (glycine, asparagine, glutamine, cysteine, serine, threonine, tyrosine). For example, it is reasonable to expect that isolated substitutions of a leucine moiety with an isoleucine or valine moiety, or similar substitutions with structurally related amino acids in the same family, will not have a significant effect on the binding or properties of the resulting molecule, particularly if the substitution does not involve amino acids within a framework site. Whether an amino acid change results in a functional peptide can be readily determined by assaying the specific activity of the polypeptide derivative. Standard ELISA, surface plasmon resonance (SPR) or other antibody binding assays can be performed by one skilled in the art to quantitatively compare antigen binding affinity between an unmodified antibody and any polypeptide derivative that is conservatively substituted by any of several methods available to one skilled in the art.

[0246] Fragments or analogs of antibodies or immunoglobulin molecules can be easily prepared by those skilled in the art. Preferred amino and carboxyl termini of fragments or analogs appear near the boundaries of functional domains. By comparing nucleotide and / or amino acid sequence data with public or proprietary sequence databases, structural and functional domains can be identified. Preferably, computerized comparison methods are used to identify sequence motifs or predicted protein conformation domains that appear in other proteins of known structure and / or function. Standard methods for identifying protein sequences that fold into known three-dimensional structures are available to those skilled in the art; Dill and McCallum., Science 338: 1042-1046 (2012). Several algorithms for predicting protein structures and gene sequences encoding these structures have been developed, many of which can be found in the National Center for Biotechnology Information (at www.ncbi.nlm.nih.gov / guide / proteins / ) and the Bioinformatics Resource Portal (at www.expasy.org / proteomics / ). Thus, the above examples demonstrate that one skilled in the art can recognize sequence motifs and structural conformations that can be used to define structural and functional domains in accordance with the present invention.

[0247] Framework modifications may be made to antibodies to reduce immunogenicity, for example, by "backmutating" one or more framework residues to the corresponding germline sequence.

[0248] It is also contemplated that antigen binding domains can be multispecific or multivalent by multimerizing antigen binding domains having pairs of VH and VL regions that bind the same antigen (multivalent) or different antigens (multispecific).

[0249]

F. Chemical modification of antibodies

[0250] In certain aspects, glycosylation variants of antibodies are also contemplated, in which the number and / or type of glycosylation sites have been altered relative to the amino acid sequence of the parent polypeptide. The glycosylation of a polypeptide can be altered, for example, by modifying one or more glycosylation sites within the polypeptide sequence to increase the affinity of the polypeptide for an antigen (U.S. Pat. Nos. 5,714,350 and 6,350,861). In certain embodiments, an antibody protein variant comprises a greater or lesser number of N-linked glycosylation sites than a native antibody. The N-linked glycosylation site is characterized by the following sequence: Asn-X-Ser or Asn-X-Thr, wherein the amino acid residue designated as X can be any amino acid residue except proline. Substitution of amino acid residues produces this sequence, providing a potential new site for the addition of an N-linked carbohydrate chain. Alternatively, substitutions that eliminate or alter this sequence will prevent the addition of an N-linked carbohydrate chain present in the native polypeptide. For example, glycosylation can be reduced by deleting asparagine or replacing asparagine with a different amino acid. In other embodiments, one or more new N-linked glycosylation sites are produced. Antibodies typically have an N-linked glycosylation site in the Fc region.

[0251] Other antibody variants include cysteine ​​variants, in which one or more cysteine ​​residues of the parent or native amino acid sequence are deleted from or substituted for another amino acid (e.g., serine). Cysteine ​​variants are particularly useful when the antibody must be refolded into a conformation with biological activity. Cysteine ​​variants may have fewer cysteine ​​residues than native antibodies and generally have an even number to minimize interactions caused by unpaired cysteines.

[0252] In certain aspects, the polypeptide can be pegylated to increase biological half-life by reacting the polypeptide with PEG or a reactive ester or aldehyde derivative of PEG under conditions where one or more polyethylene glycol (PEG) groups are attached to the polypeptide. Pegylated polypeptides can be achieved by acylation or alkylation with reactive PEG molecules (or similar reactive water-soluble polymers). Methods for pegylation of proteins are known in the art and can be applied to the polypeptides of the present invention to obtain pegylated derivatives of antibodies. For example, see EP 0 154 316 and EP 0 401 384. In certain aspects, the antibody is coupled or otherwise linked to transthyretin (TTR) or a TTR variant. TTR or a TTR variant can be chemically modified with, for example, a chemical selected from the group consisting of dextran, poly(n-vinyl pyrrolidone), polyethylene glycol, propylene glycol homopolymers, propylene oxide / ethylene oxide copolymers, polyoxyethylated polyols, and polyvinyl alcohol. As used herein, the term "polyethylene glycol" is intended to include any of the forms of PEG that have been used to derivatize other proteins.

[0253] [1. Conjugation]

[0254] Also provided herein are derivatives of the antibodies and antigen-binding fragments described herein. A derivatized antibody or fragment thereof may comprise any molecule or substance that imparts the desired properties to the antibody or fragment. A derivatized antibody may include, for example, a detectable (or labeling) portion (e.g., a radioactive, colorimetric, antigenic or enzyme molecule, or a detectable microbead), a molecule that binds to another molecule (e.g., biotin or streptavidin), a therapeutic or diagnostic portion (e.g., a radioactive, cytotoxic or pharmaceutically active portion), or a molecule that increases the suitability of the antibody for a particular use (e.g., administration to a subject (e.g., a human subject) or other in vivo or in vitro use).

[0255] Alternatively, the antibody or the immune portion of the antibody can be chemically coupled or expressed as a fusion protein with other proteins. In some aspects, the polypeptide can be chemically modified by coupling or fusion with serum proteins (such as human serum albumin) to increase the half-life of the resulting molecule. For example, see EP 0322094 and EP 0 486 525. In some aspects, the polypeptide can be coupled with a diagnostic agent and used for diagnosis, for example, to monitor the development or progress of the disease and determine the efficacy of a given treatment regimen. In some aspects, the polypeptide can also be coupled with a therapeutic agent to provide a treatment combined with the therapeutic effect of the polypeptide. Other suitable coupling molecules include ribonucleases (RNases), DNase I, antisense nucleic acids, inhibitory RNA molecules (such as siRNA molecules), immunostimulatory nucleic acids, aptamers, ribozymes, triplex formation molecules and external guide sequences. Functional nucleic acid molecules can serve as effectors, inhibitors, regulators and stimulants of the specific activity possessed by the target molecule, or functional nucleic acid molecules can have de novo synthesis activity independent of any other molecule.

[0256] In some aspects, disclosed are antibodies and antibody-like molecules that are connected to at least one reagent to form an antibody conjugate or payload. In order to improve the efficacy of the antibody molecule as a diagnostic or therapeutic agent, at least one desired molecule or part is usually connected or covalently bound or coordinated. Such a molecule or part can be, but is not limited to, at least one effector or reporter molecule. Effector molecules include molecules with desired activity, such as cytotoxic activity. Non-limiting examples of effector molecules include toxins, therapeutic enzymes, antibiotics, radiolabeled nucleotides, etc. In contrast, reporter molecules are defined as any part that can be detected using an assay. Non-limiting examples of reporter molecules coupled to antibodies include enzymes, radiolabels, haptens, fluorescent markers, phosphorescent molecules, chemiluminescent molecules, chromophores, luminescent molecules, photoaffinity molecules, colored particles, or ligands.

[0257] [2. Conjugate type]

[0258] Some examples of antibody conjugates are those conjugates in which antibodies are connected to detectable labels. "Detectable label" refers to compounds and / or elements that can be detected due to their specific functional properties and / or chemical properties, using which antibodies can be detected, and / or further quantified as needed. Examples of detectable labels include, but are not limited to, radioisotopes, fluorescent agents, semiconductor nanocrystals, chemiluminescent agents, chromophores, enzymes, enzyme substrates, enzyme cofactors, enzyme inhibitors, dyes, metal ions, metal sols, ligands (e.g., biotin, streptavidin or haptens), etc. Specific examples of labels include, but are not limited to, horseradish peroxidase (HRP), fluorescein, fluorescein isothiocyanate, rhodamine, dansyl chloride, hydroxycoumarin, dimethyl acridinium ester (DMAE), Texas Red, luminol, NADPH and α or β-galactosidase. Antibody conjugates include antibody conjugates primarily used in vitro, in which antibodies are connected to secondary binding ligands and / or enzymes to produce colored products when in contact with chromogenic substrates. Examples of suitable enzymes include, but are not limited to, urease, alkaline phosphatase, (horseradish) peroxidase, or glucose oxidase. Preferred secondary binding ligands are biotin and / or avidin and streptavidin compounds. The use of such tags is well known to those skilled in the art and is described, for example, in U.S. Patents 3,817,837; 3,850,752; 3,939,350; 3,996,345; 4,277,437; 4,275,149 and 4,366,241; each of which is incorporated herein by reference in its entirety. Molecules containing azide groups can also be used to form covalent bonds with proteins by active nitrase intermediates generated by low-intensity ultraviolet light (Potter & Haley, 1983).

[0259] In some aspects, the immunoconjugate envisioned comprises an antibody or its antigen-binding fragment and a cytotoxic agent such as a chemotherapeutic agent, a drug, a growth inhibitor, a toxin (e.g., an enzymatic toxin or a fragment thereof of a bacterial, fungal, plant or animal origin) or a radioactive isotope (i.e., a radioactive conjugate). In this way, the target agent can directly target cells carrying cell surface antigens. The antibody and the agent can be bound by non-covalent interactions (e.g., electrostatic forces) or covalent bonds. Various joints known in the art can be used to form an immunoconjugate. In addition, the immunoconjugate can be provided in the form of a fusion protein. On the one hand, the antibody can be coupled to various therapeutic substances to target cell surface antigens. Examples of coupling agents include, but are not limited to, metal chelate complexes, drugs, toxins and other effector molecules, such as cytokines, lymphokines, chemokines, immunomodulators, radiosensitizers, asparaginase, carboborin and radioactive halogens.

[0260] In an antibody drug conjugate (ADC), an antibody (Ab) is coupled to one or more drug moieties (D) via a linker (L). ADCs can be prepared by a variety of routes, using organic chemical reactions, conditions, and reagents known to those skilled in the art, including: (1) reacting a nucleophilic group of the antibody with a divalent linker reagent to form Ab-L via a covalent bond, which is then reacted with the drug moiety D; (2) reacting a nucleophilic group of the drug moiety with a divalent linker reagent to form DL via a covalent bond, which is then reacted with a nucleophilic group of the antibody. Antibody drug conjugates can also be produced by modifying an antibody to introduce an electrophilic moiety that can react with a nucleophilic substituent on a linker reagent or drug. Alternatively, a fusion protein comprising an antibody and a cytotoxic agent can be prepared, for example, by recombinant techniques or peptide synthesis. The length of DNA can include regions encoding the two portions of the conjugate, which are adjacent to each other or separated by a region encoding a linker peptide that does not destroy the desired properties of the conjugate. In another aspect, the antibody can be coupled to a "receptor" (e.g., streptavidin) for tumor or cancer cell pretargeting, where the antibody-receptor conjugate is administered to the patient, unbound conjugate is then removed from the circulation using a clearing agent, and then a "ligand" (e.g., avidin) coupled to a cytotoxic agent (e.g., radionucleotide) is administered.

[0261] Examples of antibody-drug conjugates known to those skilled in the art are pro-drugs that can be used for local delivery of cytotoxic or cytostatic drugs, i.e., drugs that kill or inhibit tumor cells in the treatment of cancer (Syrigos and Epenetos, Anticancer Res. 19:605-614 (1999); Niculescu-Duvaz and Springer, Adv. Drg. Del. Rev. 26:151-172 (1997); U.S. Pat. No. 4,975,278). In contrast, systemic administration of these unconjugated drugs may produce unacceptable levels of toxicity to normal cells and target tumor cells (Baldwin et al., Lancet 1: 603-5 (1986); Thorpe, (1985) "Antibody Carriers of Cytotoxic Agents in Cancer Therapy: A Review," In: Monoclonal Antibodies '84: Biological and Clinical Applications, A. Pincera et al., (eds.) pp. 475-506). It has been reported that both polyclonal and monoclonal antibodies are useful in these strategies (Rowland et al., Cancer Immunol. Immunother. 21: 183-87 (1986)).

[0262] In certain aspects, ADCs include covalent or aggregated conjugates of antibodies or antigen-binding fragments thereof with other proteins or polypeptides, such as by expressing a recombinant fusion protein comprising a heterologous polypeptide fused to the N-terminus or C-terminus of an antibody polypeptide. For example, the conjugated peptide can be a heterologous signal (or leader) polypeptide, such as a yeast alpha factor leader, or a peptide, such as an epitope tag (e.g., V5-His). Fusion proteins containing antibodies may include peptides (e.g., poly-His) added to facilitate antibody purification or identification. Antibody polypeptides can also be conjugated to (Sigma-Aldrich, St. Louis, Mo.) peptide linkage, as described in Hopp et al., Bio / Technology 6: 1204 (1988) and U.S. Pat. No. 5,011,912. Oligomers containing one or more antibody polypeptides can be used as antagonists. The oligomers can be in the form of dimers, trimers, or higher oligomers that are covalently or non-covalently linked. It is contemplated that oligomers containing two or more antibody polypeptides can be used. Other oligomers include heterodimers, homotrimers, heterotrimers, homotetramers, heterotetramers, etc. In certain aspects, the oligomer contains multiple antibody polypeptides that are linked by covalent or non-covalent interactions between peptide portions fused to the antibody polypeptides. Such peptides can be peptide linkers (spacers), or peptides that have oligomerization-promoting properties. Leucine zippers and certain antibody-derived polypeptides are peptides that can promote oligomerization of antibody polypeptides attached thereto, as described below.

[0263] 【3. Coupling method】

[0264] Several methods known in the art are used to connect or couple an antibody to its conjugate moiety. Some attachment methods involve the use of metal chelates, for example, using organic chelators such as diethylenetriaminepentaacetic anhydride (DTPA); ethylenetriaminetetraacetic acid; N-chloro-p-toluenesulfonamide; and / or tetrachloro-3-6-diphenylglycan-3-yl (U.S. Pat. Nos. 4,472,509 and 4,938,948, both incorporated herein by reference). Monoclonal antibodies can also be reacted with an enzyme in the presence of a coupling agent such as glutaraldehyde or periodate. Conjugates can also be made using a variety of bifunctional protein coupling agents, such as N-succinimidyl-3-(2-pyridyldithiol) propionate (SPDP), iminothioalkanes (IT), bifunctional derivatives of iminoesters (such as hexanedimethyl hydrochloride), active esters (such as disuccinimide), aldehydes (such as glutaraldehyde), bis-azido compounds (such as bis (p-azidobenzoyl) hexanediamine), bis-diazo derivatives (such as BOS (p-diazobenzoyl)-ethylenediamine), diisocyanates (such as toluene 2,6-diisocyanate) and bis-active fluorine compounds (such as 1,5-difluoro-2,4-dinitrobenzene). In certain aspects, it is contemplated to derivatize immunoglobulins by selectively introducing sulfhydryl groups into the Fc region of the immunoglobulin, using reaction conditions that do not alter the antibody combining site. Antibody conjugates produced according to the method are disclosed to have higher longevity, specificity and sensitivity (U.S. Pat. No. 5,196,066, incorporated herein by reference). Site-specific attachment of effector or reporter molecules, wherein the reporter or effector molecule is coupled to carbohydrate residues of the Fc region, has been described in the literature (O'Shannessy et al., 1987).

[0265]

IV. Protein

[0266] The present disclosure includes any kind of antibody protein or polypeptide and any kind of chimeric protein or polypeptide molecule, including a chimeric protein or polypeptide molecule comprising part or all of the functionalities of an antibody protein or polypeptide. As used herein, "protein" or "polypeptide" refers to a molecule comprising at least five amino acid residues. The term "wild type" as used herein refers to an endogenous version of a molecule naturally present in an organism. In some embodiments, a wild type version of a protein or polypeptide is used, however, in many embodiments of the present disclosure, a modified protein or polypeptide is used to produce an immune response. The above terms can be used interchangeably. "Modified protein" or "modified polypeptide" or "variant" refers to a protein or polypeptide whose chemical structure (particularly its amino acid sequence) is changed relative to a wild type protein or polypeptide. In some embodiments, a modified / variant protein or polypeptide has at least one modified activity or function (recognizing that a protein or polypeptide can have multiple activities or functions). It is particularly contemplated that a modified / variant protein or polypeptide may be changed relative to one activity or function, but retains a wild type activity or function in other aspects (e.g., immunogenicity).

[0267] When a protein is specifically mentioned herein, it generally refers to a natural (wild type) or recombinant (modified) protein, or optionally refers to a protein in which any signal sequence has been removed. The protein can be isolated directly from its natural organism, produced by recombinant DNA / exogenous expression methods, or produced by solid phase peptide synthesis (SPPS) or other in vitro methods. In a specific embodiment, there are isolated nucleic acid fragments and recombinant vectors comprising nucleic acid sequences encoding polypeptides (e.g., antibodies or fragments thereof). The term "recombinant" can be used in conjunction with the name of a polypeptide or a specific polypeptide, which generally refers to a polypeptide produced by a nucleic acid molecule that has been manipulated in vitro or a replication product of such a molecule.

[0268] In certain embodiments, the size of a protein or polypeptide (wild type or modified) may include, but is not limited to, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 275, 300, 325, 350, 375, 400 or 425 amino acid residues or more, and any range derivable therein, or derivatives of the corresponding amino acid sequences described or referenced herein. It is contemplated that polypeptides may be mutated by truncation, rendering them shorter than the corresponding wild-type form, and furthermore, they may be altered by fusion or coupling to heterologous protein or polypeptide sequences having specific functions (e.g., for targeting or localization, for enhancing immunogenicity, for purification purposes, etc.). As used herein, the term "domain" refers to any distinct functional or structural unit of a protein or polypeptide, and generally refers to an amino acid sequence having a structure or function recognizable to one skilled in the art.

[0269] The disclosed polypeptides, proteins or polynucleotides encoding such polypeptides or proteins may include 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 (or any derivative range thereof) or more variant amino acids or nucleic acid substitutions, or may be different from SEQ ID NO: NO: 4-19 is at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% (or any range derivable therein) similar, identical or homologous to, or at least 100% similar, identical or homologous to, 4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128,129,130,131,132,133,134,135,136,137,138,139,140,141,142,143,144,145,146,147,148,149,150,151,152,153,154,155,156,157,158,159,160,161,162,163,164,165,166,167,168,169,170,171,172,173,174,175,176,177,178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 2 18, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 300, 400 or more consecutive amino acids or nucleic acids, or any range derivable therein.

[0270] In some embodiments, the protein or polypeptide may comprise SEQ ID 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108,109,110,111,112,113,114,115,116,117,118,119,120,121,122,123,124,125,126,127,128,129,130,131,132,133,134,135,136,137,138,139,140,141,142,143 3,144,145,146,147,148,149,150,151,152,153,154,155,156,157,158,159,160,161,162,163,164,165,166,167,168,169,170,171,172,173,174,175,176,177,178,179,180,181,182,183,184,185,186,187,188,189,190,191,192,193,194,195,196,197,198,199,200,201,202,203,2 04, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264,265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306 06,307,308,309,310,311,312,313,314,315,316,317,318,319,320,321,322,323,324,325,326,327,328,329,330,331,332,333,334,335,336,337,338,339,340,341,342,343,344,345,346,347 7,348,349,350,351,352,353,354,355,356,357,358,359,360,361,362,363,364,365,366,367,368,369,370,371,372,373,374,375,376,377,378,379,380,381,382,383,384,385,386,387,388 , 389, 390, 391, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424 or 425 or more (or any range thereof) of amino acids. ,

[0271] In some embodiments, the protein, polypeptide or nucleic acid may comprise SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 8 2, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147 7, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 08, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268,269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309 9,310,311,312,313,314,315,316,317,318,319,320,321,322,323,324,325,326,327,328,329,330,331,332,333,334,335,336,337,338,339,340,341,342,343,344,345,346,347,348,349,3 50,351,352,353,354,355,356,357,358,359,360,361,362,363,364,365,366,367,368,369,370,371,372,373,374,375,376,377,378,379,380,381,382,383,384,385,386,387,388,389,390, 391,392,393,394,395,396,397,398,399,400,401,402,403,404,405,406,407,408,409,410,411,412,413,414,415,416,417,418,419,420,421,422,423,424,425 or more (or any derivative range thereof) of consecutive amino acids or nucleic acids.

[0272] In some embodiments, the polypeptide, protein or nucleic acid may comprise SEQ ID NO: at least, at most, or exactly 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79 ,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108,109,110,111,112,113,114,115,116,117,118,119,120,121,122,123,124,125,126,127,128,129,130,131,132,133,134,135,136,137,138,139,140,141,142,143,144,145 5, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 2 06, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266,267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308 08,309,310,311,312,313,314,315,316,317,318,319,320,321,322,323,324,325,326,327,328,329,330,331,332,333,334,335,336,337,338,339,340,341,342,343,344,345,346,347,348,349 ,350,351,352,353,354,355,356,357,358,359,360,361,362,363,364,365,366,367,368,369,370,371,372,373,374,375,376,377,378,379,380,381,382,383,384,385,386,387,388,389,390, 391, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424, 425 or more consecutive amino acids (or any derivative range thereof) which is identical to SEQ One of ID NOs: 4-19 is at least, at most, or exactly 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% (or any derivable range therein) similar, identical, or homologous.

[0273] In certain aspects, there is a NO: any one of 4 to 19: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116 6, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 1 47,148,149,150,151,152,153,154,155,156,157,158,159,160,161,162,163,164,165,166,167,168,169,170,171,172,173,174,175,176,177 , 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208 8, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 2 39, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269,270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310 ,311,312,313,314,315,316,317,318,319,320,321,322,323,324,325,326,327,328,329,330,331,332,333,334,335,336,337,338,339,340,341,342,343,344,345,346,347,348,349,350,35 1,352,353,354,355,356,357,358,359,360,361,362,363,364,365,366,367,368,369,370,371,372,373,374,375,376,377,378,379,380,381,382,383,384,385,386,387,388,389,390,391,3 92,393,394,395,396,397,398,399,400,401,402,403,404,405,406,407,408,409,410,411,412,413,414,415,416,417,418,419,420,421,422,423,424,425 or more (or any derivable range therein) starting with consecutive amino acids or nucleotides.

[0274] Nucleotide and protein, polypeptide and peptide sequences of various genes have been previously disclosed and can be found in recognized computerized databases. Two commonly used databases are the Genbank and GenPept databases of the National Center for Biotechnology Information (at www.ncbi.nlm.nih.gov / ) and the Universal Protein Resource (UniProt; at www.uniprot.org). The coding regions of these genes can be amplified and / or expressed using the techniques disclosed herein or techniques known to those of ordinary skill in the art.

[0275] It is contemplated that in the compositions of the present disclosure, about 0.001 mg to about 10 mg of total polypeptides, peptides and / or proteins are present per milliliter. The concentration of protein in the composition can be about, at least about, or at most about 0.001, 0.010, 0.050, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, 10.0 mg / ml or more (or any range derivable therein).

[0276] [A. Variant polypeptide]

[0277] The following is a discussion about changing the amino acid subunits of antibodies and / or receptor-associated proteins to produce equivalent or even improved second-generation variant polypeptides or peptides. For example, certain amino acids can replace other amino acids in a protein or polypeptide sequence, regardless of whether the interaction binding ability with a structure (e.g., an antigen-binding region of an antibody or a binding site on a substrate molecule) is significantly lost. Since the interaction ability and properties of a protein determine the functional activity of the protein, certain amino acid substitutions can be made in a protein sequence and its corresponding DNA coding sequence, and still produce a protein with similar or desirable properties. Therefore, the inventors envision that the DNA sequence of a gene encoding a protein may undergo various changes without significantly losing its biological utility or activity.

[0278] The term "functionally equivalent codons" is used herein to refer to codons encoding the same amino acid, such as six different codons for arginine. Also contemplated are "neutral substitutions" or "neutral mutations," which refer to changes in one or more codons encoding biologically equivalent amino acids.

[0279] The amino acid sequence variants disclosed herein can be substitution, insertion or deletion variants. The changes in the polypeptides disclosed herein may affect 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 or more non-continuous or continuous amino acids of the protein or polypeptide, compared to the wild type. The variant may comprise an amino acid sequence that is at least 50%, 60%, 70%, 80% or 90% identical to any sequence provided or cited herein, including all values ​​and ranges therebetween. The variant may include 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more substituted amino acids.

[0280] It is also understood that amino acid and nucleic acid sequences may include added residues, such as added N-terminal or C-terminal amino acids, or 5' or 3' sequences, respectively, but still be substantially identical to one of the sequences disclosed herein, provided that the sequence meets the criteria specified above, including maintaining biological protein activity in the case of protein expression. Adding terminal sequences is particularly useful for nucleic acid sequences, for example, which may include various non-coding sequences on either side of the 5' or 3' portion of the coding region.

[0281] Deletion variants generally lack one or more residues of the native or wild-type protein. Single residues may be deleted, or multiple consecutive amino acids may be deleted. Stop codons may be introduced (by substitution or insertion) into the encoding nucleic acid sequence to produce truncated proteins.

[0282] Insertion mutants generally involve the addition of amino acid residues at non-terminal points of a polypeptide. This may include the insertion of one or more amino acid residues. Terminal additions may also be produced and may include fusion proteins that are multimers or concatemers of one or more peptides or polypeptides described or referenced herein.

[0283] Substitution variants typically involve exchanging one amino acid for another at one or more sites within a protein or polypeptide, and can be designed to modulate one or more properties of a polypeptide, with or without loss of other functions or properties. Substitutions may be conservative, i.e., replacing one amino acid with an amino acid having similar chemical properties. "Conservative amino acid substitutions" may involve exchanging a member of an amino acid class for another member of the same class. Conservative substitutions are well known in the art and include, for example, changes such as alanine to serine, arginine to lysine, asparagine to glutamine or histidine, aspartic acid to glutamic acid, cysteine ​​to serine, glutamine to asparagine, glutamic acid to aspartic acid, glycine to proline, histidine to asparagine or glutamine, isoleucine to leucine or valine, leucine to valine or isoleucine, lysine to arginine, methionine to leucine or isoleucine, phenylalanine to tyrosine, leucine or methionine, serine to threonine, threonine to serine, tryptophan to tyrosine, tyrosine to tryptophan or phenylalanine, valine to isoleucine or leucine. Conservative amino acid substitutions may include non-naturally occurring amino acid residues that are typically incorporated by chemical peptide synthesis rather than synthesis in biological systems. These include other reverse or inverted forms of peptidomimetics or amino acid moieties.

[0284] Alternatively, a substitution may be "non-conservative", such that the function or activity of the polypeptide is affected. Non-conservative changes generally involve replacing an amino acid residue with an amino acid residue of a different chemical nature, such as replacing a non-polar or uncharged amino acid with a polar or charged amino acid, or vice versa. Non-conservative substitutions may involve exchanging a member of one amino acid class for a member of another class.

[0285]

B. Notes on substitution

[0286] Those skilled in the art can use known techniques to determine suitable variants of polypeptides as described herein. Those skilled in the art can identify suitable regions of molecules by targeting regions that are considered unimportant to activity, and these regions can be changed without destroying activity. The skilled artisan will also be able to identify conservative portions and amino acid residues of molecules in similar proteins or polypeptides. In further embodiments, conservative amino acid substitutions may be made in regions that may be important for biological activity or structure without significantly changing biological activity or adversely affecting protein or polypeptide structure.

[0287] When making such changes, the hydropathicity index of the amino acids can be considered. The hydropathicity profile of a protein is calculated by assigning a numerical value (the "hydropathy index") to each amino acid and then averaging these values ​​repeatedly along the peptide chain. Each amino acid is assigned a value based on its hydrophobicity and charge characteristics. They are: isoleucine (+4.5); valine (+4.2); leucine (+3.8); phenylalanine (+2.8); cysteine / cysteine ​​(+2.5); methionine (+1.9); alanine (+1.8); glycine (-0.4); threonine (-0.7); serine (-0.8); tryptophan (-0.9); tyrosine (-1.3); proline (1.6); histidine (-3.2); glutamate (-3.5); glutamine (-3.5); aspartate (-3.5); asparagine (-3.5); lysine (-3.9); and arginine (-4.5). The importance of the hydropathic amino acid index in conferring interactive biological function on a protein is generally understood in the art (Kyte et al., J. Mol. Biol. 157:105-131 (1982)). It is generally accepted that the relative hydrophobicity of amino acids contributes to the secondary structure of the resulting protein or polypeptide, which in turn defines the interaction of the protein or polypeptide with other molecules, such as enzymes, substrates, receptors, DNA, antibodies, antigens, etc. It is well known that certain amino acids can be substituted with other amino acids having a similar hydropathic index or score and still retain similar biological activity. When making changes based on the hydropathic index, in certain embodiments, substitutions of amino acids with hydropathic indices within ±2 are included. In certain aspects of the invention, those within the range of ±1 are included, while in other aspects of the invention, those within the range of ±0.5 are included.

[0288] It is also understood in the art that substitution of similar amino acids can be effectively achieved based on hydrophilicity. U.S. Pat. No. 4,554,101 (incorporated herein by reference in its entirety) indicates that the maximum local average hydrophilicity of a protein (controlled by the hydrophilicity of its adjacent amino acids) is related to the biological properties of the protein. In certain embodiments, the maximum local average hydrophilicity of a protein, as controlled by the hydrophilicity of its adjacent amino acids, is related to its immunogenicity and antigen binding, i.e., as a biological property of the protein. The following hydrophilicity values ​​have been assigned to these amino acid residues: arginine (+3.0); lysine (+3.0); aspartic acid (+3.0 ± 1); glutamate (+3.0 ± 1); serine (+0.3); asparagine (+0.2); glutamine (+0.2); glycine (0); threonine (-0.4); proline (-0.5 ± 1); alanine (-0.5); histidine (-0.5); cysteine ​​(-1.0); methionine (-1.3); valine (-1.5); leucine (-1.8); isoleucine (-1.8); tyrosine (-2.3); phenylalanine (-2.5); and tryptophan (-3.4). When making changes based on similar hydrophilicity values, in certain embodiments, substitution of amino acids with hydrophilicity values ​​within ±2 is included, in other embodiments, amino acids with hydrophilicity values ​​within ±1 are included, and in other embodiments, amino acids within ±0.5 are included. In some cases, epitopes can also be identified from the primary amino acid sequence based on hydrophilicity. These regions are also referred to as "epitope core regions." It is understood that an amino acid can be substituted with another amino acid having a similar hydrophilicity value and still produce a biologically equivalent and immunologically equivalent protein.

[0289] In addition, one skilled in the art can review structure-function studies to identify residues in similar polypeptides or proteins that are important for activity or structure. In view of this comparison, the importance of amino acid residues in proteins can be predicted, which residues correspond to amino acid residues in similar proteins that are important for activity or structure. One skilled in the art can select chemically similar amino acids to replace the important amino acid residues for such predictions.

[0290] Those skilled in the art can also analyze the three-dimensional structure and amino acid sequence of the related structure in similar proteins or polypeptides. In view of this information, those skilled in the art can predict the arrangement of the amino acid residues of the antibody relative to its three-dimensional structure. Those skilled in the art can choose not to change the amino acid residues predicted to be located on the surface of the protein, because these residues may be involved in important interactions with other molecules. In addition, those skilled in the art can generate test variants comprising single amino acid substitutions at each desired amino acid residue. Standard assays can then be used to screen the binding and / or activity of these variants, thereby generating information collected from such routine experiments, which may allow those skilled in the art to determine the amino acid positions that should be avoided from further substitutions alone or in combination with other mutations. Various tools that can be used to determine secondary structure can be found at www.expasy.org / proteomics / protein_structure.

[0291] In some embodiments of the invention, amino acid substitutions are made to: (1) reduce susceptibility to proteolysis, (2) reduce susceptibility to oxidation, (3) alter binding affinity for forming protein complexes, (4) alter ligand or antigen binding affinity, and / or (5) confer or modify other physicochemical or functional properties on such polypeptides. For example, single or multiple amino acid substitutions (in certain embodiments, conservative amino acid substitutions) can be made according to the naturally occurring sequence. Substitutions can be made in portions of the antibody that are located outside of the domains that form intermolecular contacts. In such embodiments, conservative amino acid substitutions that do not significantly change the structural characteristics of the protein or polypeptide can be used (e.g., one or more substituted amino acids that do not disrupt the secondary structure that characterizes the native antibody).

[0292]

V. Nucleic Acid

[0293] In various embodiments, the disclosure includes nucleic acids encoding antibodies, chimeric receptors (including chimeric TCRs or STARs), and / or encoding bispecific T cell engagers (BiTEs).

[0294] In certain embodiments, the nucleic acid sequence may be present in a variety of examples, such as: an incorporation sequence encoding one or two chains of an antibody or an isolated fragment and a recombinant vector of a recombinant polynucleotide, or a fragment, derivative, mutagen, or variant thereof, a polynucleotide sufficient to be identified as a hybridization probe, PCR primer, or sequencing primer, a polynucleotide encoding a polypeptide for analysis, mutation, or amplification, an antisense nucleic acid for inhibiting polynucleotide expression, and the above-mentioned complementary sequences described herein. Nucleic acids encoding epitopes, to which certain antibodies provided herein are also directed. Nucleic acids encoding fusion proteins comprising these peptides are also provided. Nucleic acids may be single-stranded or double-stranded, and may comprise RNA and / or DNA nucleotides and artificial variants thereof (e.g., peptide nucleic acids).

[0295] The term "polynucleotide" refers to a nucleic acid molecule that is either recombinant or isolated from total genomic nucleic acid. The term "polynucleotide" includes oligonucleotides (nucleic acids of 100 residues or less in length), recombinant vectors, such as plasmids, cosmids, phages, viruses, etc. Polynucleotides include regulatory sequences in some aspects, which are essentially separated from their naturally occurring genes or protein coding sequences. Polynucleotides can be single-stranded (coding or antisense) or double-stranded, and can be RNA, DNA (genomic, cDNA or synthetic), analogs thereof, or combinations thereof. Additional coding or non-coding sequences can, but need not, be present in a polynucleotide.

[0296] In this regard, the term "gene", "polynucleotide" or "nucleic acid" is used to refer to a nucleic acid encoding a protein, polypeptide or peptide (including any sequences required for proper transcription, post-translational modification or localization). As will be appreciated by those skilled in the art, the term includes genomic sequences, expression cassettes, cDNA sequences and smaller engineered nucleic acid fragments that express or may be adapted to express proteins, polypeptides, domains, peptides, fusion proteins and mutants. A nucleic acid encoding all or part of a polypeptide may comprise a continuous nucleic acid sequence encoding all or part of such a polypeptide. It is also contemplated that a particular polypeptide may be encoded by a nucleic acid containing variants that have slightly different nucleic acid sequences, but nonetheless encode the same or substantially similar proteins.

[0297] In certain embodiments, there are polynucleotide variants having substantial identity to the sequences disclosed herein; compared to the polynucleotide sequences provided herein, comprising at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% or higher sequence identity, including all values ​​in between, using the methods described herein (e.g., BLAST analysis using standard parameters). In certain aspects, the isolated polynucleotide will comprise a nucleotide sequence encoding a polypeptide having at least 90%, preferably 95% and above identity to the amino acid sequence described herein over the entire length of the sequence; or a nucleotide sequence complementary to the isolated polynucleotide.

[0298] Nucleic acid fragments, regardless of the length of the coding sequence itself, can be combined with other nucleic acid sequences, such as promoters, polyadenylation signals, additional restriction endonuclease sites, multiple cloning sites, other coding fragments, etc., so that their overall length can vary greatly. The nucleic acids can be of any length. For example, they can be 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, 100, 125, 175, 200, 250, 300, 350, 400, 450, 500, 750, 1000, 1500, 3000, 5000 or more nucleotides in length, and / or can contain one or more additional sequences, such as regulatory sequences, and / or be part of a larger nucleic acid, such as a vector. Thus, it is contemplated that nucleic acid fragments of virtually any length can be used, with the overall length preferably being limited by ease of preparation and use in the intended recombinant nucleic acid protocol. In some cases, the nucleic acid sequence may encode a polypeptide sequence that carries an additional heterologous coding sequence, for example, to allow purification, transport, secretion, post-translational modification of the polypeptide, or to achieve therapeutic benefits such as targeting or therapeutic efficacy. As described above, a tag or other heterologous polypeptide can be added to the modified polypeptide coding sequence, where "heterologous" refers to a polypeptide that is different from the modified polypeptide.

[0299]

VI. Antibody Production

[0300] The present disclosure includes antibodies generated for binding to TdT, including TdT peptides.

[0301] A. Antibody production

[0302] Methods for preparing and characterizing antibodies for use in diagnostic and detection assays, purification, and as therapeutic agents are well known in the art, for example, U.S. Pat. Nos. 4,011,308; 4,722,890; 4,016,043; 3,876,504; 3,770,380; and 4,372,745 (e.g., see Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, 1988; incorporated herein by reference). These antibodies can be polyclonal or monoclonal antibody preparations, monospecific antisera, human antibodies, hybrid or chimeric antibodies, such as humanized antibodies, altered antibodies, F(ab')2 fragments, Fab fragments, Fv fragments, single domain antibodies, dimer or trimer antibody fragment constructs, miniantibodies, or functional fragments that bind to relevant antigens. In certain aspects, polypeptides, peptides, proteins, and immunogenic fragments thereof used in various embodiments can also be synthesized in solution or on a solid support according to conventional techniques. See, for example, Stewart and Young, (1984); Tarn et al, (1983); Merrifield, (1986); and Barany and Merrifield (1979), each of which is incorporated herein by reference in its entirety.

[0303] In short, polyclonal antibodies are prepared by immunizing an animal with an antigen or a portion thereof and collecting antiserum from the immunized animal. Antigens may be altered compared to the antigenic sequence found in nature. In some embodiments, variant or altered antigenic peptides or polypeptides are used to produce antibodies. Inoculum is usually prepared by dispersing the antigenic composition in a physiologically tolerable diluent to form an aqueous composition. Antiserum is subsequently collected by methods known in the art, and the serum can be used as is for various applications, or the antibody components required for purification by recognized methods, such as affinity chromatography (Harlow and Lane, Antibodies: A Laboratory Manual 1988).

[0304] Methods for preparing monoclonal antibodies are also well known in the art (Kohler and Milstein, 1975; Harlow and Lane, 1988, U.S. Pat. No. 4,196,265, all of which are incorporated herein by reference for all purposes). In general, the technique involves immunizing a suitable animal with a selected immunogenic component (e.g., a purified or partially purified protein, polypeptide, peptide or domain). The antibody-producing B cells or all dissociated spleen cells produced by the immunized animal are then induced to fuse with cells of an immortalized cell line to form a hybridoma. Myeloma cell lines suitable for fusion procedures for producing hybridomas are preferably non-antibody-producing and have high fusion efficiency and enzyme defects, which prevent them from growing in certain selective culture media (hybridomas) that only support the growth of the desired fused cells. In general, the fusion partner includes a property that allows the resulting hybridoma to be selected using a specific culture medium. For example, the fusion partner may be sensitive to hypoxanthine / aminopterin / thymidine (HAT). The method of producing antibody-producing spleen or lymph node cells and myeloma cell hybrids generally comprises mixing somatic cells with myeloma cells in the presence of an agent (chemical or electrical) that promotes cell membrane fusion. Next, hybridomas can be selected by culturing cells by monoclonal dilution in microtiter plates and then testing individual clone supernatants (after about 2 to 3 weeks) to obtain the desired reactivity. Fusion procedures, immunization protocols, and techniques for isolating immune spleen cells for fusion for preparing hybridomas are known in the art.

[0305] Other techniques for producing monoclonal antibodies include viral or oncogenic transformation of B lymphocytes, the use of molecular cloning methods to generate nucleic acids or polypeptides, the selected lymphocyte antibody method (SLAM) (see, e.g., Babcook et al., Proc. Natl. Acad. Sci. USA 93:7843-7848 (1996), preparing combinatorial immunoglobulin phagemid libraries from RNA isolated from the spleen of an immunized animal and selecting phagemids that express the appropriate antibody, or using Cre-mediated site-specific recombination to generate cells expressing antibodies from cellular genomic sequences containing modified immunoglobulin sites (see, e.g., US 6,091,001).

[0306] The monoclonal antibodies can be further purified using filtration, centrifugation, and various chromatographic methods (such as HPLC or affinity chromatography). The monoclonal antibodies can be further screened or optimized for properties related to specificity, affinity, half-life, immunogenicity, binding association, binding dissociation, or overall functional properties relative to infection treatment. Thus, the monoclonal antibodies may have altered amino acid sequences of CDRs, including insertions, deletions, or substitutions for conservative or non-conservative amino acids.

[0307] The immunogenicity of a particular immunogenic composition can be enhanced by using a non-specific stimulator of the immune response (referred to as an adjuvant). The adjuvant that can be used according to the embodiment includes, but is not limited to, IL-1, IL-2, IL-4, IL-7, IL-12, gamma-interferon, GMCSF, BCG, aluminum hydroxide, MDP compounds such as thur-MDP and nor-MDP, CGP (MTP-PE), lipid A, and monophosphate lipid A (MPL). Exemplary adjuvants may include complete Freund's adjuvant (a non-specific stimulator of the immune response, containing inactivated Mycobacterium tuberculosis), incomplete Freund's adjuvant, and / or aluminum hydroxide adjuvant. In addition to adjuvants, it may be necessary to use a biological response modifier (BRM) in combination, such as, but not limited to, cimetidine (CIM; 1200 mg / d) (Smith / Kline, PA); low-dose cyclophosphamide (CYP; 300 mg / m2) (Johnson / Mead, NJ), cytokines (such as beta-interferon, IL-2 or IL-12), or genes encoding proteins involved in immune auxiliary functions, such as B-7. Phage display systems can be used to amplify antibody molecule populations in vitro. Saiki, et al., Nature 324:163 (1986); Scharf et al., Science 233:1076 (1986); U.S. Patent Nos. 4,683,195 and 4,683,202; Yang et al., J Mol Biol. 254:392 (1995); Barbas, III et al., Methods: Comp. Meth Enzymol. (1995) 8:94; Barbas, III et al., Proc Natl Acad Sci USA 88:7978 (1991).

[0308]

B. Fully human antibody production

[0309] Methods for preparing fully human antibodies. The use of fully human antibodies can minimize the immunogenicity and allergic reactions that may be caused by the administration of non-human monoclonal antibodies as therapeutic agents. In one embodiment, human antibodies can be produced in non-human transgenic animals, for example, transgenic mice that can produce a variety of human protein antibody isotypes (e.g., IgG, IgA and / or IgE) by undergoing VDJ recombination and isotype conversion. Therefore, this aspect is applicable to antibodies, antibody fragments and pharmaceutical compositions thereof, and is also applicable to non-human transgenic animals, B cells, host cells and hybridomas that produce monoclonal antibodies. The application of humanized antibodies includes, but is not limited to, in vivo or in vitro detection of cells expressing the expected protein, pharmaceutical preparations containing antibodies disclosed herein, and methods for treating diseases by administering antibodies.

[0310] Fully human antibodies can be produced by immunizing transgenic animals (usually mice), which are able to produce a range of human antibodies in the absence of endogenous immunoglobulin production. Antigens for this purpose generally have 6 or more consecutive amino acids and can be selected to be coupled to a carrier (such as a hapten). For example, see Jakobovits et al., Proc. Natl. Acad. Sci. USA 90: 2551-2555 (1993); Jakobovits et al., Nature 362: 255-258 (1993); Bruggermann et al., Year in Immunol. 7: 33 (1993). In one example, transgenic animals are produced by disabling the endogenous mouse immunoglobulin loci encoding mouse immunoglobulin heavy and light chains, and inserting large fragments of human genomic DNA containing loci encoding human heavy and light chain proteins into the mouse genome. Then hybridize partially modified animals with less than complete human immunoglobulin loci to obtain animals with all desired immune system modifications. When an immunogen is administered, these transgenic animals produce antibodies that are immunospecific for the immunogen, but have human rather than murine amino acid sequences, including variable regions. For more details on such methods, see, for example, International Patent Application Publication Nos. WO 96 / 33735 and WO 94 / 02602, which are hereby incorporated by reference in their entirety. U.S. Patent Nos. 5,545,807; 6,713,610; 6,673,986; 6,162,963; 6,300,129; 6,255,458; 5,877,397; 5,874,299 and 5,545,806; describe other methods for making human antibodies related to transgenic mice; International Patent Application Publication Nos. WO 91 / 10741 and WO 90 / 04036; and European Patent Nos. EP 546073B1 and EP546073A1, all of which are hereby incorporated by reference in their entirety.

[0311] The transgenic mice described above, referred to herein as "HuMAb" mice, contain human immunoglobulin gene minisites encoding unrearranged human heavy chain (μ and γ) and κ light chain immunoglobulin sequences, as well as targeted mutations that inactivate endogenous μ and κ chain sites (Lonberg et al., Nature 368: 856-859 (1994)). Thus, the mice exhibit reduced expression of mouse IgM or κ chains, and in response to immunization, the introduced human heavy and light chain transgenes undergo class switching and somatic mutation to produce high-affinity human IgGκ monoclonal antibodies (Lonberg et al., supra; Lonberg and Huszar, Intern. Ref. Immunol. 13: 65-93 (1995); Harding and Lonberg, Ann. NY Acad. Sci. 764: 536-546 (1995)). HuMAb mice were prepared in Taylor et al., Nucl. Acids Res. 20: 6287-6295 (1992); Chen et al., Int. Immunol. 5: 647-656 (1993); Tuaillon et al., J. Immunol. 152: 2912-2920 (1994); Lonberg et al. al., supra; Lonberg, Handbook of Exp. Pharmacol. 113: 49-101 (1994); Taylor et al., Int. Immunol. 6: 579-591 (1994); Lonberg and Huszar, Intern. Ref. Immunol. 13: 65-93 (1995); Harding and Lonberg, Ann. NY Acad. Sci. 764:536-546 (1995); Fishwild et al., Nat. Biotechnol. 14:845-851 (1996); are described in detail. The above references are incorporated herein by reference in their entirety for all purposes. See further U.S. Patent Nos. 5,545,806; 5,569,825; 5,625,126; 5,633,425; 5,789,650; 5,877,397; 5,661,016; 5,814,318; 5,874,299; 5,770,429; and 5,545,807; and International Patent Application Publication Nos. WO 93 / 1227; WO 92 / 22646; and WO 92 / 03918, all of which disclosures are hereby incorporated by reference in their entirety for all purposes.Techniques for producing human antibodies in these transgenic mice are also disclosed in WO 98 / 24893 and Mendez et al., Nat. Genetics 15:146-156 (1997), which are incorporated herein by reference. For example, HCo7 and HCo12 transgenic mouse strains can be used to generate human antibodies.

[0312] Using hybridoma technology, antigen-specific humanized monoclonal antibodies with desired specificity can be produced and selected from transgenic mice such as those described above. Such antibodies can be cloned and expressed using appropriate vectors and host cells, or they can be harvested from cultured hybridoma cells. Fully human antibodies can also be derived from phage display libraries (such as Hoogenboom et al., J. Mol. Biol. 227: 381 (1991); and Marks et al., J. Mol. Biol. 222: 581 (1991)). International Patent Application Publication No. WO 99 / 10494 (incorporated herein by reference) describes such a technique, which uses this method to separate high affinity and functional agonistic antibodies for MPL and msk receptors.

[0313]

C. Antibody fragment production

[0314] Antibody fragments that retain the ability to recognize the target antigen will also find use here. Many antibody fragments known in the art contain antigen binding sites, are able to exhibit the immunological binding properties of intact antibody molecules, and can subsequently be modified by methods known in the art. Functional fragments, including only the variable regions of the heavy and light chains, can also be produced using standard techniques, such as preferential proteolytic cleavage of immunoglobulin molecules or recombinant production. These fragments are referred to as Fv. For example, see Inbar et al., Proc. Nat. Acad. Sci. USA 69: 2659-2662 (1972); Hochman et al., Biochem. 15: 2706-2710 (1976); and Ehrlich et al., Biochem. 19: 4091-4096 (1980).

[0315] Single-chain variable fragments (scFvs) can be prepared by fusing DNA encoding a peptide linker, wherein the peptide linker is between DNA encoding two variable domain polypeptides (VL and VH). ScFvs can form antigen-binding monomers or multimers (e.g., dimers, trimers, or tetramers), depending on the length of the flexible linker between the two variable domains (Kort et al., Prot. Eng. 10: 423 (1997); Kort et al., Biomol. Eng. 18: 95-108 (2001)). By combining different V L and V H The polypeptides composed of can form multimeric scFvs that bind to different epitopes (Kriangkum et al., Biomol. Eng. 18: 31-40 (2001)). Antigen binding fragments are usually produced by recombinant DNA methods known to those skilled in the art. Although the two domains of the Fv fragment, VL and VH, are encoded by different genes, they can be connected by synthetic linkers using recombinant methods, so that they can be made into single-chain polypeptides (called single-chain Fv (sFv or scFv); for example, see Bird et al., Science 242: 423-426 (1988); and Huston et al., Proc. Natl. Acad. Sci. USA 85:5879-5883 (1988). Design criteria include determining the appropriate length of the distance between the C-terminus of one chain and the N-terminus of the other chain, wherein the linker is generally formed by small hydrophilic amino acid residues that do not tend to coil or form secondary structures. Suitable linkers generally comprise polypeptide chains of alternating sets of glycine and serine residues, and may include inserted glutamic acid and lysine residues to improve solubility. The practical screening of antigen-binding fragments is the same as that of intact antibodies. Such fragments include fragments obtained by amino-terminal and / or carboxyl-terminal deletions, wherein the remaining amino acid sequence is substantially the same as the corresponding positions derived in the naturally occurring sequence, for example, inferred from the full-length cDNA sequence.

[0316] Antibodies can also be generated using peptide analogs of the epitope determinants disclosed herein, which can be composed of non-peptide compounds having properties similar to the template peptide. These types of non-peptide compounds are referred to as "peptide mimetics" or "mimetic peptides". Fauchere, J. Adv. Drug Res. 15: 29 (1986); Veber and Freidinger TINS ​​p. 392 (1985); and Evans et al., J. Med. Chem. 30: 1229 (1987). Liu et al. (2003) also described "antibody-like binding peptide mimetics" (ABiPs), which are peptides that act as streamlined antibodies, with longer serum half-lives and certain advantages of less cumbersome synthetic methods. These analogs can be peptides, non-peptides, or a combination of peptide and non-peptide regions. Fauchere, Adv. Drug Res. 15: 29 (1986); Veber and Freidiner, TINS ​​p. 392 (1985); and Evans et al., J. Med. Chem. 30: 1229 (1987), which are incorporated herein by reference in their entirety for any purpose. Peptide mimetics that are structurally similar to therapeutically useful peptides can be used to produce similar therapeutic or preventive effects. Such compounds are usually developed with the help of computerized molecular modeling. Generally, the peptidomimetics of the present disclosure are proteins that are structurally similar to antibodies that exhibit the desired biological activity, such as the ability to bind to proteins, but have one or more peptide bonds that are optionally substituted with a bond selected from the following options by methods well known in the art: -CH2NH-, -CH2S-, -CH2-CH2-, -CH═CH- (cis and trans), -COCH2-, -CH(OH)CH2- and -CH2SO-. In certain embodiments of the present disclosure, one or more amino acids of the consensus sequence can be replaced with the same type of D-amino acid system (e.g., replacing L-lysine with D-lysine) to produce a more stable protein. In addition, constrained peptides comprising a consensus sequence or substantially identical consensus sequence variations can be produced by methods known in the art (Rizo and Gierasch, Ann. Rev. Biochem. 61: 387 (1992), incorporated herein by reference), for example, by adding a cysteine ​​residue capable of forming an intramolecular disulfide bond to cyclize the peptide.

[0317] Once generated, the phage display library can be used to improve the immunological binding affinity of the Fab molecule using known techniques. For example, see Figini et al., J. Mol. Biol. 239: 68 (1994). The coding sequences of the heavy and light chain portions of the Fab molecules selected from the phage display library can be isolated or synthesized and cloned into any suitable vector or replicon for expression. Any suitable expression system can be used.

[0318] [VII. Administration of therapeutic composition]

[0319] Embodiments of the present disclosure include methods for treating a medical condition of an individual that is indirectly or directly caused by the presence of TdT or TdT peptides associated with HLA-A02 on the surface of a cell, comprising the step of administering to the individual a therapeutically effective amount of any composition contained in this contract, including cells, polynucleotides, polypeptides, etc. In a specific embodiment, the medical condition is any type of cancer, including a hematological malignancy or a solid tumor. The hematological malignancy may be a leukemia or a lymphoma. The leukemia may be acute myeloid leukemia (AML), chronic myeloid (or myeloid) leukemia (CML); acute lymphocytic (or lymphoblastic) leukemia (ALL); or chronic lymphocytic leukemia. The lymphoma may be Hodgkin's lymphoma, non-Hodgkin's lymphoma, chronic lymphocytic leukemia (CLL), or small lymphocytic lymphoma (SLL). In various embodiments, the medical condition is cancer, wherein the individual is administered a therapeutically effective amount of cells comprising a recombinant receptor (e.g., TCR or STAR) comprising an scFv specific for a TdT peptide, and wherein the individual is administered a therapeutically effective amount of cells comprising a BiTE comprising an scFv specific for a TdT peptide. In some cases, the cell comprising the recombinant receptor (TCR and / or STAR) and the cell comprising the BiTE are the same cell. In some cases, the cell comprising the recombinant receptor (TCR and / or STAR) and the cell comprising the BiTE are different cells. In specific embodiments, administration of the composition occurs before and / or after the onset of one or more symptoms of a medical condition including cancer.

[0320] Therapies provided herein may include combined administration of therapeutic agents, such as a first cancer treatment and a second cancer treatment. These therapies may be administered in any appropriate manner known in the art. For example, the first and second cancer treatments may be performed sequentially (at different times) or simultaneously (at the same time). In some embodiments, the first and second cancer treatments are administered with separate compositions. In some embodiments, the first and second cancer treatments are the same composition.

[0321] In some embodiments, cells expressing TdT-specific cTCR and / or STAR therapy and TdT-specific BiTE therapy are administered substantially simultaneously. In some embodiments, TdT-specific cTCR and / or STAR therapy and TdT-specific BiTE therapy are administered sequentially. In some embodiments, TdT-specific cTCR and / or STAR therapy, TdT-specific BiTE therapy, and a third or more therapies are administered sequentially. In some embodiments, TdT-specific cTCR and / or STAR therapy are administered before administering TdT-specific BiTE therapy. In some embodiments, TdT-specific cTCR and / or STAR therapy are administered after administering TdT-specific BiTE therapy. In various embodiments, TdT-specific cTCR and / or STAR therapy and TdT-specific BiTE therapy are administered substantially simultaneously, because cells expressing TdT-specific cTCR and / or STAR are cells expressing and secreting soluble TdT-specific BiTE molecules. In some embodiments, TdT-specific cTCR and / or STAR therapy and TdT-specific BiTE therapy are administered substantially simultaneously, but the cells expressing the TdT-specific cTCR and / or STAR are not cells expressing and secreting soluble TdT-specific BiTE molecules. In some embodiments, TdT-specific cTCR and / or STAR therapy and TdT-specific BiTE therapy are administered at different times, and the cells expressing the TdT-specific cTCR and / or STAR are not cells expressing and secreting soluble TdT-specific BiTE molecules.

[0322] Embodiments of the present disclosure relate to compositions and methods comprising therapeutic compositions. Different therapies can be administered in one composition or in multiple compositions, such as 2 compositions, 3 compositions, or 4 compositions. Various combinations of agents can be used.

[0323] The therapeutic agent of the present disclosure can be administered by the same route of administration or different routes of administration. In some embodiments, cancer treatment is intravenous, intramuscular, subcutaneous, topical, oral, transdermal, intraperitoneal, intraorbital, implantation, inhalation, intrathecal, intraventricular or intranasal administration. In some embodiments, antibiotics are administered intravenously, intramuscularly, subcutaneously, topical, oral, transdermal, intraperitoneal, intraorbital, implantation, inhalation, intrathecal, intraventricular or intranasal. Appropriate dosage can be determined according to the type of disease to be treated, the severity and course of the disease, the clinical condition of the individual, the clinical history of the individual and the response to treatment and the judgment of the attending physician.

[0324] The treatment may include various "unit doses". A unit dose is defined as a therapeutic composition containing a predetermined amount. The amount to be administered, as well as the specific route and formulation, are within the discretion of the clinical practitioner. A unit dose need not be administered as a single injection, but may include continuous infusion over a period of time. In some embodiments, a unit dose includes a single administrable dose.

[0325] In some embodiments, TdT-specific cTCR and / or STAR therapy comprises TdT-specific cTCR and / or STAR protein, nucleic acid encoding TdT-specific cTCR and / or STAR protein, vector comprising nucleic acid encoding TdT-specific cTCR and / or STAR protein, and / or cell comprising TdT-specific cTCR and / or STAR protein. In some embodiments, a single dose of TdT-specific cTCR and / or STAR protein treatment is administered. In some embodiments, multiple doses of TdT-specific cTCR and / or STAR protein are administered. Such administration may or may not include BiTE therapy, which includes BiTE protein, nucleic acid encoding BiTE protein, vector comprising nucleic acid encoding BiTE protein, and / or cell comprising BiTE protein. These cells may or may not be the same cells that constitute TdT-specific cTCR and / or STAR protein.

[0326] In some embodiments, the TdT-specific cTCR and / or STAR protein and / or BiTE protein is administered at a dose between 1 mg / kg and 5000 mg / kg. In some embodiments, the TdT-specific cTCR and / or STAR protein and / or BiTE is administered at a dose of at least, at most, or about: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65 5, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132 , 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 1 91, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249,250，251，252，253，254，255，256，257，258，259，260，261，262，263，264，265，266，267，268，269，270，271，272，273，274，275，276，277，278，279，280，281，282，283，284，285，286，287，288，289，290，291，292，293，294，295，296，297，298，299，300，301，302，303，304，305，306，307，308，309，310，311，312，313，314，315，316，317，318，319，320，321，322，323，324，325，326，327，328，329，330，331，332，333，334，335，336，337，338，339，340，341，342，343，344，345，346，347，348，349，350，351，352，353，354，355，356，357，358，359，360，361，362，363，364，365，366，367，368，369，370，371，372，373，374，375，376，377，378，379，380，381，382，383，384，385，386，387，388，389，390，391，392，393，394，395，396，397，398，399，400，401，402，403，404，405，406，407，408，409，410，411，412，413，414，415，416，417，418，419，420，421，422，423，424，425，426，427，428，429，430，431，432，433，434，435，436，437，438，439，440，441，442，443，444，445，446，447，448，449，450，451，452，453，454，455，456，457，458，459，460，461，462，463，464，465，466，467，468，469，470，471，472，473，474，475，476，477，478，479，480，481，482，483，484，485，486，487，488，489，490，491，492，493，494，495，496，497，498，499，500, 501, 502, 503, 504, 505, 506, 507, 508, 509, 510, 511, 512, 513, 514, 515, 516, 517, 518, 519, 520, 521, 522, 523, 524, 525, 526, 527, 528, 529, 530, 531, 532 32,533,534,535,536,537,538,539,540,541,542,543,544,545,546,547,548,549,550,551,552,553,554,555,556,557,558,559,560,561,562,563,564 , 565, 566, 567, 568, 569, 570, 571, 572, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400, 2500, 2600, 2700, 2800, 2900, 3000, 3100, 3200, 3300, 3400, 3500, 3600, 3700, 3800, 3900, 4000, 4100, 4200, 4300, 4400, 4500, 4600, 4700, 4800, 4900 or 5000 mg / kg.

[0327] The amount to be administered depends on both the number of treatments and the unit dose, and the desired therapeutic effect. An effective dose refers to the amount required to achieve a specific effect. In the practice of certain embodiments, it is contemplated that a dose within the range of 10 mg / kg to 200 mg / kg is effective. Thus, it is estimated that dosages include about 0.1, 0.5, 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, and 200, 300, 400, 500, 1000 μg / kg, mg / kg, μg / day or mg / day or any range derived therefrom. In addition, such dosages can be administered multiple times in one day, and / or administered over multiple days, weeks or months.

[0328] In certain embodiments, the effective dose of the pharmaceutical composition is a dose that provides a blood level of about 1 μM to 150 μM. In another embodiment, the effective dose provides a blood level of about 4 μM to 100 μM; or about 1 μM to 100 μM; or about 1 μM to 50 μM; or about 1 μM to 40 μM; or about 1 μM to 30 μM; or about 1 μM to 20 μM; or about 1 μM to 10 μM; or about 10 μM to 150 μM; or about 10 μM to 100 μM; or about 10 μM to 50 μM; or about 25 μM to 150 μM; or about 25 μM to 100 μM; or about 25 μM to 50 μM; or about 50 μM to 150 μM; or about 50 μM to 100 μM (or any range derived therefrom). In other embodiments, the dose can provide a blood level of the therapeutic agent resulting from administration of the therapeutic agent to a subject of about, at least, or at most about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75 6, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 μM or any range derivable therein. In certain embodiments, the therapeutic agent administered to the subject is metabolized in vivo to a metabolic therapeutic agent, in which case the blood level may refer to the amount of the agent. Alternatively, to the extent that the therapeutic agent is not metabolized by the subject, the blood levels discussed herein may refer to the unmetabolized therapeutic agent.

[0329] The exact amount of the therapeutic composition also depends on the judgment of the practitioner and is unique to each individual. Factors affecting dosage include the patient's physical and clinical state, route of administration, intended therapeutic goal (relief of symptoms vs. cure), and other therapies the subject may be receiving or the efficacy, stability, and toxicity of the specific therapeutic substance.

[0330] Those skilled in the art will be able to understand and appreciate that dosage units of μg / kg or mg / kg body weight can be converted and expressed as similar concentration units of μg / ml or mM (blood levels), such as 4 μM to 100 μM. It should also be understood that uptake depends on the species and organ / tissue. Applicable conversion factors and physiological assumptions to be made about uptake and concentration measurements are well known and will allow those skilled in the art to convert one concentration measurement to another and make reasonable comparisons and conclusions about the dosages, effects and results described herein.

[0331] In some cases, it is desirable to administer the composition multiple times, for example, 2, 3, 4, 5, 6 or more administrations. The administration interval can be 1, 2, 3, 4, 5, 6, 7, 8 to 5, 6, 7, 8, 9, 10, 11 or 12 weeks, including all ranges between the two.

[0332] The phrases "pharmaceutically acceptable" or "pharmacologically acceptable" refer to molecular entities and compositions that do not produce adverse, allergic or other untoward reactions when administered to animals or humans. As used herein, "pharmaceutically acceptable carriers" include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like. The use of such media and agents for pharmaceutically active substances is well known in the art. Unless any conventional media or agents are incompatible with the active ingredient, they are contemplated for use in immunogenic and therapeutic compositions. Supplementary active ingredients, such as other anti-infective agents and vaccines, may also be added to the compositions.

[0333] The active compound can be formulated for parenteral administration, for example, a drug formulated for injection by intravenous, intramuscular, subcutaneous or intraperitoneal routes. Generally, such compositions can be prepared as liquid solutions or suspensions; solid forms suitable for preparing solutions or suspensions can also be prepared when a liquid is added before injection; and the preparation can also be emulsified.

[0334] Pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions; formulations including aqueous propylene glycol, etc.; and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases, the form must be sterile and must be fluid for easy syringability. It must also be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi.

[0335] The protein composition can be formulated in a neutral or salt form. Pharmaceutically acceptable salts include acid addition salts (formed from the free amino groups of the protein) formed with inorganic acids (e.g., hydrochloric acid or phosphoric acid) or organic acids (e.g., acetic acid, oxalic acid, tartaric acid, mandelic acid, etc.). Salts formed with free carboxyl groups can also come from inorganic bases, such as sodium, potassium, ammonium, calcium or ferric hydroxide, and organic bases such as isopropylamine, trimethylamine, histidine, procaine, etc.

[0336] Pharmaceutical compositions can include solvents or dispersion media containing, for example, water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, etc.), suitable mixtures thereof, and vegetable oils. For example, appropriate fluidity can be maintained by using a coating (e.g., lecithin), maintaining the desired particle size in the case of dispersion, and using a surfactant. Various antibacterial and antifungal agents can prevent the action of microorganisms, such as parabens, chlorobutanol, phenol, sorbic acid, thimerosal, etc. In many cases, it is best to include an isotonic agent, such as sugar or sodium chloride. The absorption time of the injection composition can be extended by using an agent that delays absorption (e.g., aluminum monostearate and gelatin) in the composition.

[0337] Sterile injectable solutions are prepared by incorporating the required amount of the active compound in an appropriate solvent with various other ingredients listed above, as required, followed by filtered sterilization or an equivalent procedure. Generally, dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle that contains the basic dispersion medium and the required other ingredients from those listed above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and freeze drying techniques that produce a powder of the active ingredient and any other desired ingredients from a previously sterile-filtered solution.

[0338] Administration of the composition is generally by any common route. This includes, but is not limited to, oral or intravenous administration. Alternatively, administration may be in situ, intradermal, subcutaneous, intramuscular, intraperitoneal or intranasal. Such compositions are generally administered as pharmaceutically acceptable compositions, including physiologically acceptable carriers, buffers or other excipients.

[0339] When formulated, the solution will be administered in a manner compatible with the dosage of the formulation and in an amount effective for treatment or prevention. These formulations are easily administered in a variety of dosage forms, such as the injectable solution type described above.

[0340]

II. TdT-specific cell therapy

[0341] A. Cell culture

[0342] In some embodiments, TdT-related therapeutic cells (which may express TdT-specific chimeric TCRs and / or TdT-specific STARs and / or TdT-specific BiTEs) may be cultured for at least about 10 days to about 40 days, at least about 15 days to about 35 days, at least about 15 days to 21 days, for example, at least about 15, 16, 17, 18, 19, or 21 days. In some embodiments, the disclosed cells may be cultured for no more than 60 days, or no more than 50 days, or no more than 45 days. The cells may be cultured for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 days. Cells can be cultured in the presence of a liquid culture medium. Typically, the culture medium may include a basal culture medium formulation known in the art. Many basal culture medium formulations can be used to culture cells, including but not limited to Eagle's minimum essential medium (MEM), Dulbecco's modified Eagle's medium (DMEM), α-modified minimum essential medium (α-MEM), basal culture medium (BME), Iscove's modified Dulbecco's medium (IMDM), BGJb culture medium, F-12 nutrient mixture (Ham), Liebovitz L-15, DMEM / F-12, essential modified Eagle's medium (EMEM), RPMI-1640 and modifications and / or combinations thereof. The composition of the above-mentioned basal culture medium is well known in the art, and it is within the skill of those skilled in the art to modify or adjust the concentration of the culture medium and / or culture medium supplement according to the needs of the cultured cells. In some embodiments, the culture medium formulation may be an explant culture medium (CEM), which is composed of IMDM supplemented with 10% fetal bovine serum (FBS), 100U / ml penicillin G, 100μg / ml streptomycin and 2mmol / L of L-glutamine. Other embodiments may employ further basal medium formulations, such as those selected from those described above.

[0343] Any culture medium capable of supporting cells in vitro can be used to culture cells. Culture medium formulations that can support cell growth include, but are not limited to, Dulbecco's modified Eagle medium (DMEM), α-modified minimum essential medium (αMEM), and Roswell Park Memorial Institute medium 1640 (RPMI Media 1640), etc. Typically, up to 20% of fetal bovine serum (FBS) or 1-20% of horse serum is added to the above culture medium to support cell growth. However, if appropriate concentrations of growth factors, cytokines, and hormones required for cell culture are provided in the culture medium, a culture medium with defined components can also be used. The culture medium that can be used for the disclosed method may contain one or more compounds of interest, including but not limited to antibiotics, mitogenic compounds, or differentiation compounds for cell culture. Cells can be grown at a temperature of 27°C to 40°C (e.g., 31°C to 37°C) and can be grown in a humidified incubator. The carbon dioxide content can be maintained between 2% and 10%, and the oxygen content can be maintained between 1% and 22%. However, this disclosure should never be interpreted as being limited to any one method of isolating and culturing cells. On the contrary, any method of isolating and culturing cells should be construed as being included in the present disclosure.

[0344] For cell culture, the culture medium may provide one or more further components. For example, additional supplements may be used to provide cells with necessary trace elements and substances to achieve optimal growth and expansion. Such supplements include insulin, transferrin, selenium salts and combinations thereof. These ingredients may be contained in a salt solution, such as, but not limited to, Hanks balanced salt solution (HBSS), Earle's salt solution. Further antioxidant supplements may be added, such as β-mercaptoethanol. Although many culture media already contain amino acids, some amino acids may be supplemented later, such as L-glutamine, which is known to be less stable in solution. The culture medium may further provide antibiotics and / or antifungal compounds, such as, typically, a mixture of penicillin and streptomycin, and / or other compounds, such as, but not limited to, amphotericin, ampicillin, gentamicin, bleomycin, hygromycin, kanamycin, mitomycin, mycophenolic acid, nalidixic acid, neomycin, nystatin, paromomycin, polymyxin, puromycin, rifampicin, spectinomycin, tetracycline, tylosin and ZEOCIN. Supplementation of cell culture media with mammalian plasma or serum is also contemplated. Plasma or serum generally contains cytokines and components necessary for viability and expansion. Use of suitable serum substitutes is also contemplated.

[0345] References to specific buffers, media, reagents, cells, culture conditions, etc., or certain subclasses of the same, are not intended to be limiting, but should be understood to include all such related materials that one of ordinary skill in the art would deem to be of interest or value in the particular context in which the discussion is being conducted. For example, one buffer system or culture medium can generally be substituted for another, thereby using a different but known approach to achieve the same goal as using the proposed method, material or composition. In a specific embodiment, the cells are cultured in a cell culture system comprising a cell culture medium, preferably in a culture vessel, particularly a cell culture medium supplemented with a substance suitable and tested for protecting cells from in vitro aging and / or inducing non-specific or specific reprogramming.

[0346]

B. Cell generation

[0347] Some methods disclosed herein relate to culturing cells obtained from human tissue samples. In a particular embodiment of the present disclosure, cells are seeded onto a substrate that allows cells to adhere thereon. For example, this can be achieved by seeding cells in a culture plate, which displays one or more substrate surfaces compatible with cell adhesion. When one or more substrate surfaces contact a cell suspension (e.g., a suspension in a culture medium) imported into a culture system, cell adhesion between the cell and the substrate surface may ensue. Therefore, in certain embodiments, cells are imported into a culture system that has at least one substrate surface that is generally compatible with the substrate surface to which cells adhere, so that the cells of the plate can contact the substrate surface, and such an embodiment includes being plated onto a substrate, which allows cells to adhere thereto.

[0348] The cells of the present disclosure can be identified and characterized by their expression of specific marker proteins, such as cell surface markers. The detection and separation of these cells can be achieved by flow cytometry, ELISA and / or magnetic beads. Reverse transcription polymerase chain reaction (RT-PCR) can be used to quantify cell-specific genes and / or monitor changes in gene expression in response to differentiation.

[0349] C. Chimeric T cell receptors and synthetic T cell receptors (TCRs) and antigen receptors (STARs)

[0350] The disclosed embodiments utilize chimeric receptors (including T cell receptors and others) that bind to the TdT peptide. The T cell receptor is composed of two different polypeptide chains, called the T cell receptor α (TCRα) and β (TCRβ) chains, connected by a disulfide bond. These α:β heterodimers are structurally very similar to the Fab fragments of immunoglobulin molecules, which explain the antigen recognition of most T cells. A small number of T cells carry another but structurally similar receptor, the recombinant TCR consisting of a pair of different polypeptide chains, named γ and δ. Both types of T cell receptors are different from membrane-bound immunoglobulins that serve as B cell receptors: T cell receptors have only one antigen binding site, while B cell receptors have two, and T cell receptors are never secreted, while immunoglobulins can be secreted as antibodies.

[0351] Both chains of the T cell receptor have an amino-terminal variable (V) region homologous to immunoglobulin V domains, a constant (C) region homologous to immunoglobulin C domains, and a short hinge region containing cysteine ​​residues that form interchain disulfide bonds. Each chain spans the lipid bilayer via a hydrophobic transmembrane domain and ends in a short cytoplasmic tail.

[0352] Embodiments of the present disclosure relate to engineered T cell receptors that bind to the TdT peptides of the present disclosure, such as the peptide of SEQ ID NO: 3. The term "engineered" refers to a T cell receptor that, at least in some cases, has a TCR variable region grafted onto a TCR constant region to create a chimeric polypeptide that binds to the TdT peptide antigen. In certain embodiments, the TCR comprises intervening sequences that are useful for cloning, enhanced expression, detection, or therapeutic control of the construct but are not present in the endogenous TCR, such as multiple cloning sites, linkers, hinge sequences, modified hinge sequences, modified transmembrane sequences, detection polypeptides or molecules, or therapeutic controls that may allow selection or screening of cells containing the TCR.

[0353] In some embodiments, TCR comprises non-TCR sequence.Therefore, some embodiments are related to TCR with sequence not from TCR gene.In some embodiments, TCR is chimeric, because it comprises sequence usually found in TCR gene, but comprises sequence from at least two TCR genes, and these sequences are not necessarily found together in nature.

[0354] In some embodiments of the present disclosure, there is an engineered receptor that binds to a TdT peptide of the present disclosure, such as a peptide of SEQ ID NO: 3, which at least in some cases comprises V on different chains. H and V LDomain, but still contains TCR alpha chain and TCR beta chain (STAR). In certain embodiments, STAR contains intervening sequences that are used for cloning, enhanced expression, detection or therapeutic control of the construct, but not present in the endogenous TCR, such as multiple cloning sites, linkers, hinge sequences, modified hinge sequences, modified transmembrane sequences, detection polypeptides or molecules, or therapeutic controls that may allow selection or screening of cells containing STARs.

[0355] In some embodiments, a STAR comprises a non-TCR sequence. Thus, certain embodiments are associated with a STAR having a sequence that is not from a TCR gene. In some embodiments, a STAR is chimeric in that it comprises a sequence that is normally present in a TCR gene, but comprises sequences from at least two TCR genes that are not necessarily found together in nature.

[0356]

D. Peptides and Peptide Inhibitors

[0357] As used herein, "protein" or "polypeptide" refers to a molecule comprising at least five amino acid residues. The term "wild type" used herein refers to an endogenous version of a molecule naturally present in an organism. In some embodiments, a wild type version of a protein or polypeptide is used, however, in many embodiments of the present disclosure, a modified protein or polypeptide is used to produce an immune response. The above terms can be used interchangeably. "Modified protein" or "modified polypeptide" or "variant" refers to a protein or polypeptide whose chemical structure (particularly its amino acid sequence) is changed relative to a wild-type protein or polypeptide. In some embodiments, a modified / variant protein or polypeptide has at least one modified activity or function (a recognition protein or polypeptide may have multiple activities or functions), such as a changed TCR alpha chain or beta chain. It is particularly contemplated that a modified / variant protein or polypeptide may be changed relative to an activity or function, but retains a wild-type activity or function in other aspects (e.g., immunogenicity).

[0358] When a protein is specifically mentioned herein, it generally refers to a natural (wild type) or recombinant (modified) protein, or optionally refers to a protein in which any signal sequence has been removed. The protein can be isolated directly from its natural organism, produced by recombinant DNA / exogenous expression methods, or produced by solid phase peptide synthesis (SPPS) or other in vitro methods. In a specific embodiment, there are isolated nucleic acid fragments and recombinant vectors comprising nucleic acid sequences encoding polypeptides (e.g., antibodies or fragments thereof). The term "recombinant" can be used in conjunction with the name of a polypeptide or a specific polypeptide, which generally refers to a polypeptide produced by a nucleic acid molecule that has been manipulated in vitro, or a replication product of such a molecule.

[0359] In certain embodiments, the size of the peptides or proteins of the present disclosure may include, but is not limited to, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 amino acid residues or greater, and any range derivable therein. It is contemplated that polypeptides may be mutated by truncation, making them shorter than the corresponding wild-type form, and furthermore, they may be altered by fusion or coupling to heterologous protein or polypeptide sequences having specific functions (e.g., for targeting or localization, for enhancing immunogenicity, for purification purposes, etc.). As used herein, the term "domain" refers to any unique functional or structural unit of a protein or polypeptide, and generally refers to an amino acid sequence having a structure or function recognizable by those skilled in the art.

[0360] The polypeptides and peptides of the present disclosure may include 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 (or any derivative range thereof) or more variant amino acid substitutions of SEQ ID NOs: 4-19 or at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67, 68, 69, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 11112%, 113%, 114%, 115%, 116%, 117%, 118%, 119%, 120%, 121%, 122%, 123%, 124%, 125%, 126%, 127%, 128%, 129%, 130%, 131%, 132%, 133%, 134%, 135%, 136%, 137%, 138%, 139%, 140%, 141%, 142%, 143%, 144%, 145%, 146%, 147%, 148%, 149%, 150%, 151%, 152%, 153%, 154%, 155%, 15 %, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% (or any range derivable therein) are similar, identical or homologous to the above-mentioned compound, or any range derived therefrom.

[0361] In some embodiments, the peptide or polypeptide may comprise amino acids 1 to 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or 17 of SEQ ID NO: 3, 5, 7, 9, 11, 13, 15 or 17 (or any derivable range therein).

[0362] In some embodiments, the peptide or polypeptide may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or 17 (or any derivable range therein) consecutive amino acids of SEQ ID NO: 3, 5, 7, 9, 11, 13, 15 or 17.

[0363] In some embodiments, the peptide or polypeptide may comprise at least, or at most, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or 17 (or any derivative range thereof) of SEQ ID NO: 3, 5, 7, 9, 11, 13, 15 or 17, which amino acids are identical to those of SEQ ID NO: One of NO: 3, 5, 7, 9, 11, 13, 15 or 17 is at least, at most or exactly 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% (or any derivable range therein) similar, identical or homologous.

[0364] In some aspects there is a peptide or polypeptide starting at position 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 of any one of SEQ ID NO:3, 5, 7, 9, 11, 13, 15 or 17 and comprising, comprising at least or comprising at most 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or 17 (or any derivative range therein) consecutive amino acids or nucleotides of SEQ ID NO:3, 5, 7, 9, 11, 11, 13, 15 or 17.

[0365] The peptide or polypeptide may comprise, at least comprise or comprise at most 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 (or any derivable range therein) amino acid substitutions relative to SEQ ID NO: 3, 5, 7, 9, 11, 13, 15 or 17. The peptide or polypeptide may comprise, at least comprise or comprise at most 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 (or any derivable range therein) amino acid substitutions at positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 and / or 17 relative to SEQ ID NO: 3, 5, 7, 9, 11, 13, 15 or 17. The substitutions at positions 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 and / or 17 may be substitutions with alanine, arginine, asparagine, aspartic acid, cysteine, glutamine, glutamic acid, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine or valine.

[0366] The nucleotide and protein, polypeptide and peptide sequences of various genes have been previously published and can be found in recognized computerized databases. Two commonly used databases are the National Center for Biotechnology Information and Databases (at www.ncbi.nlm.nih.gov / ) and The Universal Protein Resource (UniProt; at www.uniprot.org). The coding regions of these genes can be amplified and / or expressed using the techniques disclosed herein or techniques known to those of ordinary skill in the art.

[0367] It is contemplated that in the compositions of the present disclosure, about 0.001 mg to about 10 mg of total polypeptide, peptide and / or protein are present per milliliter. The concentration of protein in the composition can be about, at least about, or at most about 0.001, 0.010, 0.050, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, 10.0 mg / ml or more (or any range derivable therein).

[0368] [VIII. Cells expressing TdT-specific reagents]

[0369] In various embodiments, a host cell is utilized in which at least one recombinant expression vector expressing TdT-specific cTCR and / or TdT-specific STAR and / or TDT-specific BiTE has been introduced. TdT-specific cTCR and TdT-specific STAR and TDT-specific BiTE may have separate expression vectors, or they may be expressed by the same one or two vectors. These agents can be expressed in a variety of cell types, including any type of immune effector cells. Certain embodiments relate to cells comprising polypeptides or nucleic acids disclosed herein. In some embodiments, the cells are immune cells including T cells. "T cells" include all types of immune cells, including T helper cells, invariant natural killer T (iNKT) cells, cytotoxic T cells, T regulatory cells (Treg) γ-δT cells, natural killer (NK) cells, and neutrophils. T cells may refer to CD4+ or CD8+T cells. In a specific embodiment, these cells are, for example, T cells, NK T cells, NK cells, macrophages, B cells, or mixtures thereof. The expression construct encoding TdT-specific cTCR and / or TDT-specific BiTE can be transfected into cells according to various methods known in the art. The vector DNA can be introduced into prokaryotic or eukaryotic cells by conventional transformation or transfection techniques. Some vectors may adopt control sequences so that they can be replicated and / or expressed in prokaryotic and eukaryotic cells. In some aspects, the antibody expression construct can be placed under the control of a promoter associated with T cell activation, such as a promoter controlled by NFAT-1 or NF-κΒ, both of which are transcription factors that can be activated when T cells are activated. The control of antibody expression enables T cells (such as tumor-targeted T cells) to sense their surrounding environment and regulate cytokine signaling in real time in T cells themselves and surrounding endogenous immune cells. Those skilled in the art will understand the conditions for incubating host cells to maintain them and allow vector replication. In addition, it is also understood and understood that the technology and conditions for allowing large-scale production of vectors and the production of nucleic acids encoded by vectors and their homologous polypeptides, proteins or peptides are also understood.

[0370] For stable transfection of mammalian cells, it is known that, depending on the expression vector and transfection technique used, only a small fraction of cells can integrate the foreign DNA into their genome. In order to identify and select these integrants, selectable markers (e.g., for antibiotic resistance) are usually introduced into the host cells together with the target gene. Cells stably transfected with the introduced nucleic acid can be identified by drug selection (e.g., cells incorporating the selectable marker gene will survive, while other cells die), as well as other methods known in the art.

[0371]

III. Formulation and culture of cells

[0372] In specific embodiments, the cells expressing TdT-specific agents of the present disclosure may be specifically formulated and / or they may be cultured in a specific culture medium. The cells may be formulated in a manner suitable for delivery to a recipient without causing deleterious effects.

[0373] In some aspects, a medium for culturing animal cells may be used as its basal medium, for example, any one of AIM V, X-VIVO-15, NeuroBaseal, EGM2, TeSR, BME, BGJb, CMRL 1066, Glasgow MEM, ImprovedMEM Zinc Option, IMDM, medium 199, Eagle MEM, αMEM, DMEM, Ham, RPMI-1640 and Fischer medium, and any combination thereof, but as long as the medium can be used for culturing animal cells, it may not be particularly limited thereto. In particular, the medium may be xeno-free or chemically defined.

[0374] The culture medium can be a serum-containing or serum-free culture medium, or a xeno-free culture medium. From the perspective of preventing contamination by heterogeneous animal-derived components, the serum can come from the same animal as the stem cells. Serum-free culture medium refers to a culture medium that does not contain raw or unpurified serum, and therefore, may include a culture medium containing purified blood-derived components or animal tissue-derived components (such as growth factors).

[0375] The culture medium may contain or not contain any substitute for serum. The substitute for serum may include materials that appropriately contain albumin (such as lipid-rich albumin, bovine albumin, albumin substitutes, such as recombinant albumin or humanized albumin, plant starch, dextran and protein hydrolysate), transferrin (or other iron transporters), fatty acids, insulin, collagen precursors, trace elements, 2-mercaptoethanol, 3'-thiol or its equivalent. The substitute for serum may be prepared by the method disclosed in International Publication No. 98 / 30679, for example (all included herein). Alternatively, any commercially available material may be used to obtain more convenience. Commercially available materials include knockout serum substitute (KSR), lipid concentrates (Gibco) and Glutamax (Gibco) with clear chemical composition.

[0376] In certain embodiments, the culture medium may contain 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more of the following substances: vitamins such as biotin; DL α-tocopherol acetate; DL α-tocopherol; vitamin A (acetate); protein, such as BSA (bovine serum albumin) or human albumin, component V without fatty acids; catalase; human recombinant insulin; human transferrin; superoxide dismutase; other ingredients, such as corticosterone; D-galactose; ethanolamine hydrochloride; glutathione (reduced); L-carnitine hydrochloride; linoleic acid; linolenic acid; progesterone; putrescine 2HCl; sodium selenite; and / or T3 (triiodo-L-thyronine). In specific embodiments, one or more of them may be explicitly excluded.

[0377] In some embodiments, the culture medium further comprises vitamins. In some embodiments, the culture medium comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 or 13 kinds (and any ranges derivable therein) of the following: biotin, DLα-tocopherol acetate, DLα-tocopherol, vitamin A, choline chloride, calcium pantothenate, pantothenic acid, nicotinamide folic acid, pyridoxine, riboflavin, thiamine, inositol, vitamin B12, or the culture medium comprises a combination thereof or a salt thereof. In some embodiments, the culture medium comprises or is substantially composed of biotin, DLα-tocopherol acetate, DLα-tocopherol, vitamin A, choline chloride, calcium pantothenate, pantothenic acid, nicotinamide folic acid, dadoxol, riboflavin, thiamine, inositol and vitamin B12. In some embodiments, vitamins comprise or are primarily composed of biotin, DLα-tocopherol acetate, DLα-tocopherol, vitamin A or a combination thereof or a salt thereof. In some embodiments, the culture medium further comprises protein. In some embodiments, the protein comprises albumin or bovine serum albumin, a BSA component, catalase, insulin, transferrin, superoxide dismutase, or a combination thereof. In some embodiments, the culture medium further comprises one or more of: corticosterone, D-galactose, ethanolamine, glutathione, L-carnitine, linoleic acid, linolenic acid, progesterone, putrescine, sodium selenite, or triiodo-L-thyronine, or a combination thereof. In some embodiments, the culture medium comprises one or more of: Supplements, Xeno-Free Supplement, GS21TM supplement or a combination thereof. In some embodiments, the culture medium comprises or further comprises amino acids, monosaccharides, inorganic ions. In some embodiments, the amino acids include arginine, cystine, isoleucine, leucine, lysine, methionine, glutamine, phenylalanine, threonine, tryptophan, histidine, tyrosine or valine, or a combination thereof. In some embodiments, the inorganic ions include sodium, potassium, calcium, magnesium, nitrogen or phosphorus, or a mixture or salt thereof. In some embodiments, the medium further comprises one or more of the following: molybdenum, vanadium, iron, zinc, selenium, copper or manganese, or a combination thereof. In certain embodiments, the culture medium comprises or is substantially composed of one or more vitamins discussed herein and / or one or more proteins discussed herein, and / or one or more of the following: corticosterone, D-galactose, ethanolamine, glutathione, L-carnitine, linoleic acid, linolenic acid, progesterone, putrescine, sodium selenite or triiodo-L-thyronine, Supplements, Xeno-Free Supplements, GS21TM supplements, amino acids (such as arginine, cystine, isoleucine, leucine, lysine, methionine, glutamine, phenylalanine, threonine, tryptophan, histidine, tyrosine or valine), monosaccharides, inorganic ions (such as sodium, potassium, calcium, magnesium, nitrogen and / or phosphorus) or salts thereof, and / or molybdenum, vanadium, iron, zinc, selenium, copper or manganese. In specific embodiments, one or more of these may be explicitly excluded.

[0378] The culture medium may also include one or more externally added fatty acids or lipids, amino acids (e.g., non-essential amino acids), vitamins, growth factors, cytokines, antioxidants, 2-mercaptoethanol, pyruvic acid, buffers and / or inorganic salts. In a specific embodiment, one or more of these may be explicitly excluded.

[0379] The amount of the polypeptide may be at least, at most, or about 0.1, 0.5, 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 180, 200, 250 ng / L, ng / ml, μg / ml, mg / ml, or any range derived therefrom.

[0380] In specific embodiments, the cells of the present disclosure are specifically formulated. They may or may not be formulated into a cell suspension. In certain cases, they are formulated in a single dose form. They can be formulated for systemic or local administration. In some cases, the cells are formulated for storage prior to use, and the cell formulation may contain one or more cryopreservatives, such as DMSO (e.g., in 5% DMSO). The cell preparation may contain albumin, including human albumin, whose specific preparation contains 2.5% human albumin. These cells can be specifically formulated for intravenous administration; for example, their formulation is suitable for intravenous administration in less than one hour. Specific embodiments The cells are in a formulated cell suspension that is stable at room temperature for 1, 2, 3 or 4 hours or more from the date of thawing.

[0381] In a specific embodiment, the cell of the present disclosure comprises an exogenous TCR, which may have a determined antigen specificity. In certain embodiments, TCR may be selected based on the absence or reduced alloreactivity of the expected receptor. In the example of exogenous TCR non-allogeneic reaction, during T cell differentiation, exogenous TCR suppresses the rearrangement and / or expression of endogenous TCR loci by a developmental process called allele rejection, causing T cells to express only non-allogeneic exogenous TCR, and therefore have non-allogeneic reactivity. In some embodiments, the selection of exogenous TCR may not necessarily be defined based on the lack of alloreactivity. In some embodiments, endogenous TCR genes have been modified by genome editing so that they do not express protein. Methods of gene editing, such as methods using CRISPR / Cas9 systems, are known in the art.

[0382] [IV. General pharmaceutical composition]

[0383] In some embodiments, the pharmaceutical composition is administered to a subject. Different aspects may involve administering an effective amount of composition to a subject. In some embodiments, an antibody or antigen binding fragment capable of binding to TdT can be administered to a subject to prevent or treat a condition (e.g., cancer). Alternatively, an expression vector encoding one or more such antibodies or polypeptides or peptides can be administered to a subject as a preventive treatment. In addition, such compositions can be administered in combination with other therapeutic agents (e.g., chemotherapeutic agents, immunotherapy, biological therapy, etc.). Such compositions are typically dissolved or dispersed in a pharmaceutically acceptable carrier or aqueous medium.

[0384] The phrases "pharmaceutically acceptable" or "pharmacologically acceptable" refer to molecular entities and compositions that do not produce adverse, allergic or other untoward reactions when administered to animals or humans. As used herein, "pharmaceutically acceptable carriers" include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like. The use of such media and agents for pharmaceutically active substances is well known in the art. Unless any conventional media or agents are incompatible with the active ingredient, they are contemplated for use in immunogenic and therapeutic compositions. Supplementary active ingredients, such as other anti-infective agents and vaccines, may also be added to the compositions.

[0385] The active compound can be formulated for parenteral administration, for example, a drug formulated for injection by intravenous, intramuscular, subcutaneous or intraperitoneal routes. Generally, such compositions can be prepared as liquid solutions or suspensions; solid forms suitable for preparing solutions or suspensions can also be prepared when a liquid is added before injection; and the preparation can also be emulsified.

[0386] Pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions; formulations including aqueous propylene glycol solutions, etc.; and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases, the form must be sterile and must be fluid for easy syringability. It must also be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi.

[0387] The protein composition can be formulated in a neutral or salt form. Pharmaceutically acceptable salts include acid addition salts (formed from the free amino groups of the protein) formed with inorganic acids (e.g., hydrochloric acid or phosphoric acid) or organic acids (e.g., acetic acid, oxalic acid, tartaric acid, mandelic acid, etc.). Salts formed with free carboxyl groups can also come from inorganic bases, such as sodium, potassium, ammonium, calcium or ferric hydroxide, and organic bases such as isopropylamine, trimethylamine, histidine, procaine, etc.

[0388] Pharmaceutical compositions can include solvents or dispersion media containing, for example, water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), suitable mixtures thereof, and vegetable oils. For example, appropriate fluidity can be maintained by using a coating (e.g., lecithin), maintaining the desired particle size in the case of dispersion, and using a surfactant. Various antibacterial and antifungal agents can prevent the action of microorganisms, such as parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it is best to include an isotonic agent, such as sugar or sodium chloride. The absorption time of the injection composition can be extended by using an agent that delays absorption (e.g., aluminum monostearate and gelatin) in the composition.

[0389] Sterile injectable solutions are prepared by incorporating the required amount of the active compound in an appropriate solvent with various other ingredients listed above, as required, followed by filtered sterilization or an equivalent procedure. Generally, dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle that contains the basic dispersion medium and the required other ingredients listed above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and freeze drying techniques that produce a powder of the active ingredient and any other desired ingredients from a previously sterile-filtered solution.

[0390] Administration of the composition is generally by any common route. This includes, but is not limited to, oral or intravenous administration. Alternatively, administration may be in situ, intradermal, subcutaneous, intramuscular, intraperitoneal or intranasal. Such compositions are generally administered as pharmaceutically acceptable compositions, including physiologically acceptable carriers, buffers or other excipients.

[0391] When formulated, the solutions will be administered in a manner compatible with the dosage of the formulation, and in an amount effective for treatment or prevention. These formulations are easily administered in a variety of dosage forms, such as the type of injectable solutions described above.

[0392] [IX. Kit of the present application]

[0393] Any composition described herein may be included in a kit. In a non-limiting example, any polynucleotide, polypeptide and / or cell included herein may be included in a kit. The kit may alternatively or additionally include one or more reagents for generating any polynucleotide, polypeptide and / or cell included herein, such as primers, deoxynucleotides, buffers, salts, etc.

[0394] Any component of the test kit may be packaged in an aqueous medium or in a lyophilized form. The container device of the test kit may generally include at least one vial, test tube, flask, bottle, syringe or other container device, in which the components can be placed, and preferably appropriately divided. If there are multiple components in the test kit, the test kit may also generally include a second, third or other additional container, in which other components can be placed separately. However, a bottle may contain various component combinations. The test kit of the present invention generally also includes a device for sealing the composition and any other reagent containers for commercial sale. Such containers may include injection molded or blow molded plastic containers, in which the required vials are retained. In a specific embodiment, the test kit may include one or more devices for collecting biological samples from individuals. [Example]

[0395] The following examples are included to demonstrate preferred embodiments of the present invention. It should be appreciated by those skilled in the art that the techniques disclosed in the following examples represent techniques that the inventors have found to work well in the practice of the present invention and therefore can be considered to constitute preferred modes for its implementation. However, it should be appreciated by those skilled in the art based on this disclosure that many changes can be made in the disclosed specific embodiments and similar or similar results can still be obtained without departing from the spirit and scope of the present invention.

[0396] [Example 1: TdT-specific cytotoxic receptor and method of use thereof]

[0397] Terminal deoxynucleotidyl transferase (TdT) is a DNA polymerase expressed in T and B cell progenitors that catalyzes the transfer of nucleotides during DNA rearrangement 9,10 TdT is expressed in up to 95% of T-lineage and B-lineage ALL and is widely used as a diagnostic marker for these malignancies. 4 In addition, TdT expression was frequently detected in poorly differentiated AML. 11,12 Off-target activity of TdT in immature progenitor cells is associated with leukemogenesis 5,6 . The absence of TdT expression in primitive hematopoietic progenitors or mature peripheral lymphocytes makes it an ideal therapeutic target for leukemia. However, TdT-specific TCRs are efficiently deleted in the thymus, and the nuclear localization of TdT precludes its targeting by conventional CARs. Therefore, it was thought that TdT-expressing tumor cells could be targeted using chimeric receptors recognizing TdT-derived peptides in the context of MHC I. A meta-analysis of surface peptides presented by TdT+HLAA2+ leukemic cells was performed and TdT-derived peptides presented in the context of the dominant class I MHC allele HLA-A02 in the Western world were identified. 13 Using recombinant HLA-A02:01 / TdT peptide complexes, the inventors screened two independent phage display libraries consisting of >2×10 12 The humanized scFv and humanized camelid VHH binders were composed. Four clones that recognized TdT / HLA-A02:01 but not control peptide / HLA-A02:01 complexes were identified. Since each individual peptide occupies only a very small fraction of the total HLA-A molecules, the surface density of TdT / HLA-A02 complexes is expected to be relatively low and may be below the optimal CAR-mediated detection threshold. To address this possibility, for each binder, a second-generation TdT-specific CAR and TdT-specific chimeric TCR (cTCR) were generated to take advantage of the modular CAR architecture and highly sensitive TCR signaling, which is able to detect only a few cognate peptide / HLA molecules on the cell surface. 14,15 ( Figure 3A). In the cTCR construct, the TdT binder is fused to the mouse constant TCR α and / or β chains to achieve specific dimerization and efficient integration with the CD3 signaling complex in human T cells ( Figure 3 A). Most TdT-specific receptors are expressed on the cell surface of primary human T cells following gamma-retroviral transduction, with most binder variants showing high levels of expression in transgenic T cells ( Figure 3 B) and amplification ( Figure 3 C). Expression of TdT-specific CAR in T cells resulted in a moderate reduction in microdifferentiated CD27+CD45RA+ T cells, likely due to predominant CAR signaling, whereas expression of TdT.cTCR did not affect T cell differentiation status ( Figure 3 D). Cytotoxicity of T cells expressing TdT-specific constructs was assessed in co-culture with the TdT+HLA-A02+ leukemia cell line BV173 for 72 hours. One TdT-specific cTCR construct exerted robust cytotoxicity against leukemia cells, whereas other clones showed lower activity ( Figure 3 E). Notably, T cells expressing CARs with the same TdT binder showed only minimal activity, indicating that CAR sensitivity was insufficient to elicit optimal T cell activation.

[0398] To evaluate the specificity of cTCR T cells, malignant and normal lymphocytes were co-cultured for 72 h, and the number of residual target cells was quantified using flow cytometry with bead counting. TdT.cTCR T cells were highly cytotoxic against TdT+ / HLA-A2+BV173 and NALM6 leukemias, but not against negative control CCRF-CEM (TdT+ / HLA-A2-) and THP-1 (TdT- / HLA-A2+) cells ( Figure 4 A) and TdT- / HLA-A2+ cell lines GDM-1, Jeko-1, and Loucy had no activity. Next, TdT.cTCR T cells were generated from HLA-A02+ donors and subjected to a 24-hour co-culture assay with autologous T cells and B cells freshly isolated from peripheral blood. No cytotoxicity against normal T and B lymphocytes was observed after co-culture with TdT.cTCR T cells, while control CD19 CAR T cells expectedly killed autologous CD19+ B cells ( Figure 4 B). Expression of TdT.cTCR on HLA-A02+ T cells also did not produce fratricide and did not affect their ex vivo expansion. These data suggest that TdT.cTCR specifically recognizes TdT peptides in the context of HLA-A02 and does not elicit off-target activity against normal TdT-negative lymphocytes.

[0399] Since the TdT-specific binders identified in the phage display screen recognized the TdT / HLA-A02 complex without the help of the CD8 coreceptor, it was assumed that the TdT.cTCR would effectively redirect both CD4+ and CD8+ T cells to fight leukemia. Indeed, both CD4+ and CD8+ T cells showed robust degranulation (as measured by CD107a staining) and production of IFNγ and TNFα ( Figure 5 This activity was abolished by removing surface class I MHC expression using b2M CRISPR knockout, indicating that this activity of CD4+ and CD8+ TdT.cTCR T cells is class I MHC specific ( Figure 5 ). Therefore, unlike conventional tumor antigen-specific TCRs, TdT.cTCRs can engage both the CD4+ and CD8+ T cell arms of the immune response against leukemia.

[0400] The above results indicate that TdT targeting is most effective through activation of conventional TCR signaling. In addition to cTCR transgenic T cells, the TCR pathway can also be engaged using soluble bispecific T cell engagers (BiTEs) in which a tumor antigen-specific binder is fused to an anti-CD3 moiety, thereby inducing TCR crosslinking and T cell activation / degranulation against target cells. To test whether unmodified T cells can be redirected against TdT+ leukemias with BiTEs, TdT-specific engagers were designed and expressed in producer cells. Unmodified untransduced T cells and TdT.CAR and TdT.cTCR T cells were subjected to a standard 72-hour co-culture assay against the TdT+ / HLA-A02+ leukemia cell lines BV173 and NALM-6. While control untransduced T cells had no measurable activity against leukemias in the absence of BiTEs, the addition of soluble BiTEs resulted in robust elimination of both leukemia targets by unmodified T cells, comparable to TdT.cTCR T cells ( Figure 6 Collectively, these results demonstrate that TdT-specific cTCR and BiTE constructs have potent and specific anti-leukemic activity compared with CAR-based modalities and support the feasibility and efficacy of using these agents to target TdT+ leukemias.

[0401] Figure 7 One embodiment of a chimeric TCR is shown, wherein the V H and V L The domains are present on a single TCRα chain, in contrast to the STAR receptors that contain the variable heavy and variable light regions on separate chains of the chimeric TCR (Liu et al., Sci Transl Med. 2021; 13(586):eabb5191). Figure 8cTCR and STAR expression on T cells after retroviral transduction is shown. Fig. 9 The cytotoxicity of T cells expressing cTCR and STAR against BV173 cell line (TdT+, HLA-A2+) was shown. In particular, the transduced cells were co-cultured with a representative cancer cell line of mixed lineage leukemia (MLL) cells for comparison. In another embodiment, cTCR and BiTE molecules are retrovirally transduced into T cells ( Fig.10 ), Fig.11 Evidence for the cytotoxicity of cTCR T cells and BiTE T cells against a representative cancer cell line of MLL cells (TdT+, HLA-A2+) is provided.

[0402]

***

[0403] All methods disclosed and claimed herein can be made and performed without undue experimentation in light of the present disclosure. Although the compositions and methods of the present invention have been described in terms of preferred embodiments, it will be apparent to those skilled in the art that changes may be applied to the methods and steps of the methods or the order of steps described herein without departing from the concept, spirit, and scope of the present disclosure. More specifically, it will be apparent that certain chemically and physiologically related reagents may be substituted for the reagents described herein while the same or similar results will be obtained. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be in accordance with the spirit, scope, and concept of the invention as defined by the appended claims.

[0404]

References

[0405] The following references, to the extent they provide exemplary procedural or other details supplementary to those set forth herein, are specifically incorporated herein by reference.

[0406] 1. Majzner, RG & Mackall, CLClinical lessons learned from the first leg of the CAR T cell journey. Nature Medicine 25, 1341-1355 (2019).

[0407] 2. Lulla, PD, Mamonkin, M. & Brenner, MKA Adoptive Cell Therapy for AcuteMyeloid Leukemia and T-Cell Acute Lymphoblastic Leukemia. Cancer J 25, 199-207 (2019).

[0408] 3.Mardiana,S.&Gill,S.CAR T Cells for Acute Myeloid Leukemia:State ofthe Art and Future Directions.Front Oncol 10,697(2020).

[0409] 4.Drexler,H.G.,Menon,M.&Minowada,J.Inc idence of TdT positivity incases of leukemia and lymphoma.Acta Haematol 75,12-17(1986).

[0410] 5.Borrow,J.,Dyer,S.A.,Akiki,S.&Griffiths,M.J.Molecular roulette:nucleophosmin mutations in AML are orchestrated through N-nucleotide additionby TdT.Blood 134,2291-2303(2019).

[0411] 6.Borrow,J.,Dyer,S.A.,Akiki,S.&Griffiths,M.J.Terminaldeoxynucleotidyl transferase promotes acute myeloid leukemia by priming FLT3-ITD replication slippage.Blood 134,2281-2290(2019).

[0412] 7.Watanabe,K.et al.Target antigen density governs the efficacy ofanti-CD20-CD28-CD3ζchimeric antigen receptor-modified effector CD8+T cells.JImmunol 194,911-920(2015).

[0413] 8.Gudipati,V.et al.Inefficient CAR-proximal signaling blunts antigensensitivity.Nature Immunology 21,848-856(2020).

[0414] 9.Kunkel,T.A.,Gopinathan,K.P.,Dube,D.K.,Snow,E.T.&Loeb,L.A.Rearrangements of DNA mediated by terminal transferase.Proc Natl Acad SciU S A 83,1867-1871(1986).

[0415] 10.Desiderio,S.V.et al.Insertion of N regions into heavy-chain genesis correlated with expression of terminal deoxytransferase in B cells.Nature311,752-755(1984).

[0416] 11.Patel,J.L.et al.The immunophenotype of T-lymphoblastic lymphoma inchildren and adolescents:a Children's Oncology Group report.Br J Haematol159,454-461(2012).

[0417] 12.Drexler,H.G.,Sperling,C.&Ludwig,W.D.Terminaldeoxynucleotidyltransferase(TdT)expression in acute myeloid leukemia.Leukemia 7,1142-1150(1993).

[0418] 13.Klatt,M.G.et al.Solving an MHC allele-specific bias in thereportedimmunopeptidome.JCI Insight 5,(2020).

[0419] 14.Purbhoo,M.A.,Irvine,D.J.,Huppa,J.B.&Davis,M.M.Tcell killing doesnot require the formation of a stable matureimmunological synapse.Nat Immunol5,524-530(2004).

[0420] 15.Sykulev,Y.,Joo,M.,Vturina,I.&Eisen,H.N.Evidence thata singlepeptide-MHC complex on a target cell can elicit a cytolytic Tcellresponse.Immunity 4,565-571(1996).

Claims

1. A polynucleotide comprising a sequence encoding a recombinant T cell receptor (TCR), wherein the recombinant TCR comprises an antibody specific for terminal deoxynucleotidyl transferase (TdT) or a TdT peptide.

2. The polynucleotide according to claim 1, wherein The antibody is a variable single chain fragment (scFv).

3. The polynucleotide according to claim 1 or 2, wherein The TdT peptide is a TdT peptide associated with HLA-A02 on the cell surface.

4. The polynucleotide according to any one of claims 1 to 3, wherein The TdT peptide comprises SEQ ID NO:3 or a functional variant thereof comprises at least 80% identity to SEQ ID NO:

3.

5. A polynucleotide according to any one of the preceding claims, wherein The TCR alpha chain and / or the TCR beta chain of the TCR has one or more modifications to prevent cross-pairing with endogenous TCRs present in the cell.

6. A polynucleotide according to any one of the preceding claims, wherein The TCR alpha chain and / or the TCR beta chain of the TCR have one or more modifications to enhance heterologous pairing with each other.

7. A polynucleotide according to any one of the preceding claims, wherein The TCR is further defined as comprising a murine constant TCR alpha chain, a murine constant TCR beta chain, or both.

8. The polynucleotide according to any one of claims 1 to 7, wherein The variable light chain (V L ) and variable heavy chain (V H ) domains are located on the same TCR chain.

9. The polynucleotide according to any one of claims 1 to 5, wherein One TCR chain is connected to V H domain, the other TCR chain connects to the V L chain.

10. A polynucleotide according to any one of the preceding claims, wherein The TCR chain comprises the sequence of SEQ ID NO: 1 or SEQ ID NO:

2.

11. A polynucleotide according to any one of the preceding claims, wherein The scFv comprises SEQ ID NO: 5, 7 or 9 or is encoded by SEQ ID NO: 4, 6 or 8.

12. A polynucleotide according to any one of the preceding claims, wherein The polynucleotide also includes a sequence encoding a bispecific T cell engager (BiTE).

13. The polynucleotide according to claim 12, wherein The BiTE comprises an antibody specific for TdT or a TdT peptide.

14. A polynucleotide according to any one of the preceding claims, wherein The recombinant TCR comprises SEQ ID NO: 11, 13, 15 or 17 or is encoded by SEQ ID NO: 10, 12, 14 or 16.

15. The polynucleotide according to any one of claims 12 to 14, wherein The BiTE comprises SEQ ID NO:19 or is encoded by SEQ ID NO:

18.

16. A polynucleotide comprising a sequence encoding a bispecific antibody comprising an antigen binding region specific for a TdT peptide.

17. The polynucleotide according to claim 16, wherein The bispecific antibody comprises an antigen binding region that is specific for CD3.

18. The polynucleotide according to any one of claims 18 or 19, wherein The sequence comprises SEQ ID NO:18 or encodes SEQ ID NO:

19.

19. A composition comprising the polynucleotide of any one of the preceding claims.

20. The composition according to claim 19, wherein The composition comprises a carrier.

21. The composition according to claim 20, wherein The vector is a viral vector or a non-viral vector.

22. The composition according to claim 21, wherein The viral vector is an adenoviral vector, an adeno-associated viral vector, a retroviral vector or a lentiviral vector.

23. A composition according to claim 21, wherein The non-viral vector is a plasmid or a transposon.

24. A polypeptide encoded by the polynucleotide of any one of claims 1 to 18 or the composition of any one of claims 19 to 23.

25. A cell comprising the polynucleotide of any one of claims 1 to 18 or the composition of any one of claims 19 to 23.

26. The cell according to claim 25, wherein The cells are immune cells.

27. The cell according to claim 25 or 26, wherein The cell is a T cell, a NK cell, a NK T cell, a B cell, a macrophage, a neutrophil or a combination thereof.

28. A cell according to claim 27, wherein The T cell is an αβ T cell, a γδ T cell, a T-helper cell, an invariant natural killer T (iNKT) cell, a cytotoxic T cell, a T-regulatory cell-natural killer (NK) cell, or a combination thereof.

29. The cell according to any one of claims 25 to 28, further defined as comprising: A polynucleotide comprising: (1) a sequence encoding a recombinant TCR comprising a scFv specific for TdT or a TdT peptide; and (2) a sequence encoding a BiTE comprising an antibody specific for TdT or a TdT peptide; or A first polynucleotide comprising a sequence encoding a recombinant TCR comprising a scFv specific for TdT or a TdT peptide; and A second polynucleotide comprising a sequence encoding a BiTE comprising an antibody specific for TdT or a TdT peptide.

30. The cell according to claim 29, wherein The variable light chain (V L ) and variable heavy chain (V H ) domains are located on the same TCR chain.

31. The cell according to claim 29, wherein One TCR chain is connected to V H domain, and The other TCR chain is connected to V L Structural domain.

32. The cell according to any one of claims 25 to 31, wherein The cells are T cells.

33. A method for treating a medical condition in an individual caused directly or indirectly by the presence of TdT or a TdT peptide associated with HLA-A02 on the surface of a cell, comprising the step of administering to the individual a therapeutically effective amount of the composition of any one of claims 19 to 23 and / or a therapeutically effective amount of the cell of any one of claims 25 to 32.

34. The method of claim 33, wherein: The medical condition was cancer.

35. The method of claim 34, wherein: Cancer includes hematological malignancies.

36. The method of claim 34, wherein: The cancer includes solid tumors.

37. The method of claim 35, wherein: Hematological malignancies are leukemias or lymphomas.

38. The method of claim 37, wherein: The leukemia is acute myeloid leukemia (AML), chronic myeloid (or myeloid) leukemia (CML); acute lymphocytic (or lymphoblastic) leukemia (ALL); or chronic lymphocytic leukemia.

39. The method of claim 37, wherein the lymphoma is Hodgkin's lymphoma, non-Hodgkin's lymphoma, chronic lymphocytic leukemia (CLL), or small lymphocytic lymphoma (SLL).

40. The method according to any one of claims 33 to 39, in, The medical condition is cancer, and wherein the individual is administered a therapeutically effective amount of cells comprising a recombinant TCR comprising a scFv specific for a TdT peptide, and Therein, the individual is administered a therapeutically effective amount of cells comprising a BiTE comprising a scFv specific for a TdT peptide.

41. The method of claim 40, wherein: The cell comprising the recombinant TCR and the cell comprising the BiTE are the same cell.

42. The method of claim 40, wherein: The cell comprising the recombinant TCR and the cell comprising the BiTE are different cells.

43. A kit, contained in a suitable container, comprising the polynucleotide of any one of claims 1 to 18, the composition of any one of claims 19 to 23 and / or the cell of any one of claims 25 to 32.

Images