Application of ZDHHC11 gene in preparation of medicine for treating non-small cell lung cancer

Abstract

The invention discloses an application of a ZDHHC11 gene in preparation of a medicine for treating non-small cell lung cancer, and relates to the technical field of biological medicines, and the research finds that the ZDHHC11 protein level is increased by over-expressing the ZDHHC11 gene in NSCLC cells, the cell viability, migration ability and multiplication ability can be inhibited, and cell apoptosis can be promoted. The activity of NSCLC cells can be increased by knocking out the ZDHHC11 gene, and the result shows that the ZDHHC11 gene plays an important role in controlling the development process of the non-small cell lung cancer, provides a new action target for treating the NSCLC, and has potential application value in preparing the medicine for treating the non-small cell lung cancer.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to application of ZDHHC11 gene in preparing medicine for treating non-small cell lung cancer. Background Art

[0002] Lung cancer is mainly divided into two categories according to the morphology of cancer cells and pathological histological classification: non-small cell lung cancer (NSCLC) and small cell lung cancer (SCLC). NSCLC accounts for about 80% of lung cancer cases. NSCLC can also be further divided into multiple types, namely lung adenocarcinoma (LUAD), lung squamous cell carcinoma (LUSC) and large cell lung cancer (LCC). At present, the treatment methods for lung cancer include surgery, radiotherapy, chemotherapy and targeted therapy. At present, the treatment mode of lung cancer has gradually shifted to targeted therapy. There are corresponding inhibitors for different molecular targets such as epidermal growth factor receptor (EGFR), anaplastic lymphoma kinase (ALK) and proto-oncogene protein tyrosine kinase 1 (ROS1). However, after a median treatment time of 12-14 months, most targeted drugs will develop resistance. It has become a trend to explore more therapeutic targets and develop better combination therapy plans.

[0003] More and more reports indicate that lipid metabolism can participate in the occurrence and development of cancer. Through fatty acid oxidation, ferroptosis, lipoylation and other processes, it can affect tumor metastasis, growth and immune escape. Among them, lipoylation is an important post-translational modification of proteins. S-palmitoylation is the most common protein lipid modification, also known as protein palmitoylation. Protein palmitoylation is mainly catalyzed by palmitoyltransferase. ZDHHC enzyme, as a palmitoyltransferase, catalyzes the formation of sulfhydryl bonds between palmitic acid and cysteine ​​residues of substrate proteins. The ZDHHC protein family is highly conserved in eukaryotes. There are 23 subtypes in human cells, which mediate S-palmitoylation modification of almost all membrane proteins. Many ZDHHCs are associated with cancer. Studies have predicted 299 cancer driver genes, of which 26% of the encoded proteins may be palmitoylated, but the specific ZDHHC responsible for their palmitoylation is still unclear. At least 15 of the 23 known human ZDHHCs have been associated with cancer. Studies have found that ZDHHC2 can inhibit NSCLC, while ZDHHC5 can promote the development of lung cancer. These studies suggest that ZDHHC protein plays an important regulatory role in the initiation and development of lung cancer, and also suggest that screening potential ZDHHC enzymes will provide new targets for lung cancer treatment. Summary of the invention

[0004] The purpose of the present invention is to overcome the deficiencies of the prior art and provide an application of the ZDHHC11 gene in the preparation of a therapeutic drug for treating non-small cell lung cancer. By changing the expression of the ZDHHC11 gene, the proliferation and migration capabilities of non-small cell lung cancer can be effectively reduced, the apoptosis of non-small cell lung cancer is greatly enhanced, and a target is provided for the treatment of NSCLC.

[0005] The present invention achieves the above-mentioned purpose through the following technical solutions:

[0006] As the first aspect of the present invention, the ZDHHC11 gene is used in the preparation of a drug for treating non-small cell lung cancer. The ZDHHC11 protein level is increased by overexpressing the ZDHHC11 gene, thereby inhibiting the proliferation and migration ability of non-small cell lung cancer cells and promoting cell apoptosis.

[0007] A further improvement is that the NCBI accession number of the ZDHHC11 gene is 79844, and the sequence of the encoded ZDHHC11 protein is shown as SEQ ID No.1.

[0008] A further improvement is that the overexpression of the ZDHHC11 gene is transient overexpression or stable overexpression of the ZDHHC11 gene.

[0009] As a second aspect of the present invention, a recombinant plasmid for overexpression of the ZDHHC11 gene is also disclosed. The recombinant plasmid for overexpression of the ZDHHC11 gene is constructed by the ZDHHC11 gene and a pCMV expression vector. The NCBI accession number of the ZDHHC11 gene is 79844.

[0010] As a third aspect of the present invention, also disclosed is a use of the ZDHHC11 gene overexpression recombinant plasmid as described above in the preparation of a drug for treating non-small cell lung cancer.

[0011] As a fourth aspect of the present invention, a drug for treating non-small cell lung cancer is also disclosed, the drug comprising a therapeutically effective amount of the recombinant plasmid for overexpression of the ZDHHC11 gene as described above.

[0012] As a fifth aspect of the present invention, a ZDHHC11 gene overexpression cell line is also disclosed. The ZDHHC11 gene overexpression cell line is obtained by transfecting the above-mentioned ZDHHC11 gene overexpression recombinant plasmid into non-small cell lung cancer cells.

[0013] A further improvement is that the non-small cell lung cancer cells are A549 and PC-9 cells.

[0014] The present invention has the following beneficial effects:

[0015] The present invention has found that overexpression of ZDHHC11 in NSCLC cells can inhibit cell viability, migration ability and proliferation ability, and promote cell apoptosis. Knocking out the ZDHHC11 gene can increase NSCLC cell viability. The above results suggest that the ZDHHC11 gene plays an important role in controlling the development of non-small cell lung cancer, providing a new target for the treatment of NSCLC, and has potential application value in the preparation of drugs for the treatment of non-small cell lung cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 The changes in the transcription level of ZDHHC11 in LUAD and LUSC (A) and the relationship between ZDHHC11 expression and overall survival of LUAD (BC);

[0017] Figure 2 To detect the protein level of ZDHHC11 after transfection of ZDHHC11 overexpression plasmid into PC-9 cells;

[0018] Figure 3 The effect of ZDHHC11 overexpression on the viability of PC-9 and A549 cells;

[0019] Figure 4 The effect of ZDHHC11 overexpression on apoptosis of PC-9 and A549 cells;

[0020] Figure 5 The effect of ZDHHC11 overexpression on the migration ability of PC-9 and A549 cells;

[0021] Figure 6 The effect of stable overexpression of ZDHHC11 on cell proliferation ability; (In the figure, A is a graph verifying the protein level of stable overexpressed cells; B is a graph comparing the proliferation effects of two types of cells in a clone formation experiment.);

[0022] Figure 7 Construction and screening of knockout ZDHHC11 cell lines; (In the figure, A is the construction of knockout plasmid; B is the verification of knockdown effect of knockout plasmid; C is the screening of knockout cells; D is the verification of knockout cell protein level; E is the comparison of knockout cell gene sequence.);

[0023] Figure 8 To investigate the effect of knocking out ZDHHC11 on cell viability. DETAILED DESCRIPTION

[0024] The present application is further described in detail below in conjunction with the accompanying drawings. It is necessary to point out here that the following specific implementation methods are only used to further illustrate the present application and cannot be understood as limiting the scope of protection of the present application. Technical personnel in this field can make some non-essential improvements and adjustments to the present application based on the above application content.

[0025] 1. Materials and Reagents

[0026] The experimental methods in the following examples are all conventional biochemical methods unless otherwise specified. The experimental materials used in the following examples are all purchased from conventional biochemical reagent stores unless otherwise specified.

[0027] 1. Cell lines

[0028] Lung adenocarcinoma cells (PC-9) were donated by the Central Laboratory of Hefei Binhu Hospital; lung adenocarcinoma cells (A549) were preserved in this laboratory.

[0029] 2. Plasmid

[0030] The pCMV3.1(+)-Flag plasmid was stored in our laboratory, and pCMV3.1(+)-Flag-ZDHHC11 was purchased from General Biotechnology Company.

[0031] 3. Molecular biology reagents and antibodies

[0032] Transfection reagent Lipofectamine 2000 was purchased from Thermo Scientific (Cat. No. 11668019); fetal bovine serum FBS was purchased from Excell; DMEM culture medium was purchased from Proteintech; anti-ZDHHC11 was purchased from Gene Tex, anti-FLAG, anti-GAPDH, goat anti-rabbit IgG (H+L)-HRP, goat anti-mouse IgG (H+L)-HRP antibodies were purchased from Proteintech;

[0033] The quantitative experiments in the following examples were all repeated three times, and the results were averaged.

[0034] 2. Methods

[0035] 1. ZDHHC11 expression and prognostic bioinformatics analysis

[0036] The GEPIA (Gene Expression Profile Interactive Analysis) dataset is a tool that provides key interactive network functions based on TCGA and GTEx data. The tissue expression level of the ZDHHCs gene was processed by the standard processing method provided in the GEPIA dataset. The results showed that the expression level of ZDHHC11 in lung adenocarcinoma and lung squamous cell carcinoma was much lower than that in normal tissues ( Figure 1 A). Compared with normal tissues, the expression of ZDHHC11, ZDHHC14, ZDHHC17 and ZDHHC19 genes in LUAD and LUSC showed significant downregulation ( Figure 1 B).

[0037] The Kaplan-Meier database was used to evaluate the correlation between the expression level of the ZDHHC11 gene and the prognosis and survival of lung cancer patients online. The present invention uses the Kaplan-Meier survival diagram to evaluate the relationship between the expression of the ZDHHC11 gene in LUAD and the overall survival (OS) and first progression survival (FP) of patients. The results showed that the effect of ZDHHC11 gene expression on survival was more significant, with an HR value of only 0.36, which indicates that high expression of ZDHHC11 may greatly improve the survival rate of patients with lung cancer cells ( Figure 1 C).

[0038] 2. Detection of protein expression level by immunoblotting after transfection of Flag-ZDHHC11 plasmid

[0039] PC-9 cells were cultured at a rate of 2×10 5Cells were inoculated into 6-well plates, 2 mL was inoculated into each well, and cultured for 24 h. The Flag-ZDHHC11 plasmid was transfected according to the instructions of Lipofectamine 2000. After 6 h of culture, the supernatant was replaced with 10% FBS culture medium. Cells were collected 48 h after transfection. The culture medium was discarded, and the cells were washed three times with 1 mL of pre-cooled 1× PBS solution, and the supernatant was discarded. The cell sample was placed on ice, and 50 μL of single cell lysis buffer (150 mmol / L NaCl, 50 mmol / L Tris-HCl pH 8.0, containing 1 tablet / 50 mL of EDTA protease inhibitor, 1% NP40) was added, and lysed on ice for 30 min. Centrifuge at 12000rpm at 4℃ for 10min; take 2μL of cell lysate and add 800μL of Coomassie Brilliant Blue solution (Bio-Rad) for protein quantification, and use cell lysate for protein balance; add 12.5μL of 5×SDS loading buffer to the balanced sample, water bath at 100℃ for 5min, centrifuge at 4℃ and 12000rpm for 5min, take 10μL for electrophoresis, the voltage is initially set to 80V, and after bromophenol blue migrates to the separation gel, the voltage is adjusted to 120V and electrophoresis is continued; 30min before the end of electrophoresis, activate the PVDF membrane with methanol for 15s, and then soak it in 1× transfer buffer for 30min with two 2.5mm thick filter papers. After the electrophoresis is completed, transfer the membrane from bottom to top according to the filter paper-PVDF membrane-PA Place GE gel-filter paper in a semi-dry transfer apparatus in order, use a roller to remove bubbles, and transfer at 18V for 1 hour; block the PVDF membrane after transfer with blocking solution (TBST solution containing 5% skim milk powder) for 3 hours, add anti-ZDHHC11 and anti-GAPDH (the corresponding concentration has been prepared according to the antibody manual) and incubate overnight at 4°C; wash with 1×TBST for 5 minutes, repeat 6 times, add goat anti-rabbit IgG (H+L)-HRP (the corresponding concentration has been prepared according to the antibody manual) and incubate at room temperature on a shaker for 1 hour, wash with 1×TBST for 5 minutes, repeat 3 times, and finally perform ECL chemiluminescence, mix the color developing solution A and solution B in a 1:1 ratio and evenly cover the PVDF membrane, and develop with a chemiluminescence imager.

[0040] The results showed that the expression level of ZDHHC11 was significantly increased under the condition of equal amount of plasmid transfection ( Figure 2 ). This indicates that the ZDHHC11 overexpression plasmid was overexpressed in the transfected cells.

[0041] 3. MTT assay to detect the effect of overexpression of ZDHHC11 on lung cancer cell viability

[0042] A549 and PC-9 cells in good condition were inoculated into 96-well plates at 3000-5000 cells per well. After 18-24 hours, the cells were attached to the wall and plasmid transfection could be performed. The steps of plasmid transfection were performed according to the instructions of Lipofectamine 2000. 48 hours after transfection, 20 μL of MTT solution (5 mg / mL) was added to each well of the 96-well plate, and placed in a 37°C incubator for 4 hours. The solution in each well was carefully discarded, and it was taken care not to absorb the crystals at the bottom. 150 μL of DMSO solution was added to each well, and it was placed on a shaker with low speed for 10 minutes. The absorbance value at a wavelength of 490 nm was detected using an enzyme marker.

[0043] The results showed that overexpression of ZDHHC11 could inhibit the viability of lung cancer cells in a gradient-dependent manner ( Figure 3 ).

[0044] 4. Flow cytometry detection of the effect of overexpression of ZDHHC11 on apoptosis of lung cancer cells

[0045] A549 and PC-9 cells in good condition were cultured at 3 × 10 5 -4×10 5 Cells were inoculated into a dish, and plasmid transfection was performed 18-24 hours later. The steps of plasmid transfection were performed according to the instructions of Lipofectamine 2000. 48 hours after transfection, floating cells and adherent cells in the culture medium were collected and combined for staining. When treating adherent cells, trypsin without EDTA was used to digest the cells. After terminating the digestion reaction, the cells were collected and centrifuged at 1000rpm in a pre-cooled 4℃ centrifuge for 5 minutes, and the supernatant was discarded. The cell pellet was washed twice with 4℃ pre-cooled PBS, each time at 1000rpm and 4℃ for 5 minutes, and the supernatant was discarded. 100μL 1×Binding buffer was added to resuspend the cells, and gently pipetted to a single cell suspension. 5μL Annexin V-FITC and 5μL PI were added and gently mixed, and incubated at room temperature and away from light for 10 minutes. 400μL 1×Binding buffer was added and the sample to be tested was transferred to a flow cytometer. Detected within 1 hour using a flow cytometer. The flow cytometer selected an excitation wavelength of 488 nm and used FL1 and FL3 channels for detection. The number of cells collected was set to 20,000, and the cross gate was defined based on the positive and negative boundaries of the two fluorescence parameters of FITC and PI. The cells were divided into three subpopulations: double negative cells were living cells; Annexin V-FITC single positive cells were early apoptotic cells; Annexin V-FITC and PI double positive cells were late apoptotic cells, and the final apoptosis rate calculation included the early rate and late apoptosis rate.

[0046] The results showed that overexpression of ZDHHC11 could promote apoptosis of lung cancer cells in a gradient-dependent manner ( Figure 4 ).

[0047] 5. Transwell chamber to observe the changes in cell migration ability before and after transfection

[0048] A549 and PC-9 cells in good condition were cultured at 2 × 10 5 Cells were inoculated into six-well plates and plasmid transfection was performed 18-24 hours later. The plasmid transfection steps were performed according to the instructions of Lipofectamine 2000. The experimental group cells, negative control group cells and untransfected cells after liposome transfection were digested with 0.25% trypsin, and the cells were counted and resuspended in base medium. 200 μL of cell suspension was added to the chamber, and the number of cells was 8×10 4 The lower chamber is 600 μL of DMEM culture medium containing 15% fetal bovine serum, and transfection is performed again according to the set groups. Incubate in an incubator at 37°C and 5% CO2 for 48 hours. After the incubation, take out the chamber, wash it twice with PBS, gently wipe the attached cells on the inner side of the upper chamber filter membrane with a cotton swab, and wash it twice with PBS. Fix the chamber filter membrane with 4% paraformaldehyde for 10 minutes, remove the fixative, add 800 μL of crystal violet stain to each well, stain for 5 minutes, discard the staining solution, wash it three times with PBS, take out the upper chamber, and dry it naturally. Take pictures under an upright fluorescence microscope and count the number of cells migrating on the back of the membrane. Count 3 random fields of view in the central and peripheral parts of each membrane and calculate the average value.

[0049] The results showed that overexpression of ZDHHC11 could inhibit the migration ability of lung cancer cells in a gradient-dependent manner ( Figure 5 ).

[0050] 6. Effect of stable overexpression of ZDHHC11 on cell proliferation

[0051] 6.1. Screening of Hygromycin Working Concentration

[0052] The constructed pCMV3.1(+)-Flag-ZDHHC11 overexpression plasmid carries a hygromycin screening marker, and the antibiotic is used for pressure screening, but the cell resistance to hygromycin is different. Therefore, before the experiment, the original cells were treated with drugs to determine the screening working concentration of hygromycin, and the operation was performed according to a series of concentrations set as follows. For PC-9 cells, six-well plates were plated, and hygromycin with a concentration gradient of 0, 300, 600, 900, 1200, and 1500 μg / mL was set to prepare a culture medium containing the corresponding concentration of antibiotics, and six-well plates of PC-9 cells were cultured. After 3 cycles of drug treatment, the cell culture medium was changed every 3 days, and the survival status of the cells was observed. After about a week, it was found that the cells cultured with a hygromycin concentration of 1200 μg / mL had no survival, so the final concentration of hygromycin was determined to be 400 μg / mL as the final screening concentration.

[0053] 6.2 Screening of ZDHHC11 Stable Overexpression Cell Lines

[0054] After determining the working concentration of hygromycin, the overexpression plasmid was transfected into the cells according to the instructions of Lipofectamine 2000. 2 μg of the plasmid was transfected into the cells. After the cells grew normally and adhered to the wall, they were cultured in a selection medium containing 1200 μg / mL hygromycin. After a period of culture, the cells were divided into single clones by limiting dilution method, observed and marked, and these single cell clusters were expanded and cultured to detect their protein level expression. Finally, an overexpression cell line was obtained, named EO-1 ( Figure 6 A).

[0055] 6.3. Clone formation assay to detect proliferation ability of ZDHHC11 stably overexpressing cell lines

[0056] First, PC-9 and EO-1 cells in good condition were evenly plated in 6-well plates with 200-300 cells per well. They were placed in an incubator for culture, and fresh culture medium was replaced every few days until most clones in the wells grew to a suitable size. The culture medium in the 6-well plate was removed and washed with PBS. 1 mL of 4% paraformaldehyde was added to each well, and the cells were fixed by placing in a 4°C refrigerator for 30 minutes, and then aspirated. After adding 1 mL of PBS to each well after fixation to wash away the residual paraformaldehyde, 1 mL of the prepared 0.1% crystal violet solution was added to each well, and after standing at room temperature for 10 minutes, the plates were washed several times with ultrapure water to remove the excess crystal violet. After drying at room temperature, the plates were photographed.

[0057] The results showed that the proliferation ability of ZDHHC11 stably transfected cell lines was weakened compared with wild-type cells ( Figure 6 B. Figure 6 C).

[0058] 7. Effect of ZDHHC11 knockout on cell viability

[0059] 7.1. Construction of ZDHHC11 knockout plasmid

[0060] According to the CRISPR-Cas9 technical requirements, sgRNA was designed for the exons of the ZDHHC11 gene. After comparing various parameters such as the off-target and effectiveness of the sequence, two sgRNAs were selected for the experiment ( Figure 7 A). The sequence information of sgRNA is as follows:

[0061] sgRNA1:CACCGCAATGTATTTCCACGCG

[0062] sgRNA2: CACCGAAGGGAATGAAGATCCCGA

[0063] Then, after the oligonucleotide double-strand annealing, the constructed single-stranded sgRNA was connected to the vector px459 digested with BpiⅠ, transformed into Escherichia coli for positive clone identification, and the recombinant knockout plasmid was obtained after sequencing verification. Next, the function of the knockout plasmid was verified. The two sgRNA plasmids targeting ZDHHC11 were transfected into PC-9 cells respectively, and after one round of screening with DMEM medium containing puromycin, the cells were collected to detect the expression level of ZDHHC11. The results of the immunoblotting experiment showed that both sgRNA1 and sgRNA2 had a knockdown effect, and subsequent stable screening of knockout cell lines can be carried out ( Figure 7 B).

[0064] 7.2 Screening of ZDHHC11 knockout cell lines

[0065] The two sgRNA plasmids were transfected into PC-9 cells according to the instructions of Lipofectamine 2000. After about 3 weeks of pressure screening in a medium containing puromycin, the cells were divided into monoclonal cells using the limiting dilution method. After monoclonal cell selection and expansion culture experiments, multiple monoclonal cells were collected for immunoblotting experiments to verify the expression of ZDHHC11 protein ( Figure 7 C). After repeated verification, a monoclonal cell with ZDHHC11 knockout was finally obtained, named PAU-5. The results of immunoblotting ( Figure 7 D). After extracting the cell genome, PCR amplified the ZDHHC11 genome sequence containing the sgRNA1 target region. After sequencing, it was found through comparison that the corresponding sequence in the first exon of ZDHHC11 was edited compared to the original sequence in PC-9 cells, missing a base, resulting in an early stop codon ( Figure 7 E).

[0066] 7.3. MTT assay to detect cell viability of ZDHHC11 knockout cell lines

[0067] PC-9 and PAU-5 cells in good condition were seeded into 96-well plates with the same number of cells per well (about 3000). After 48h and 72h, 20μL of MTT solution (5mg / mL) was added to each well of the 96-well plate. The plate was placed in a 37℃ incubator for 4h. The solution in each well was carefully discarded, and crystals at the bottom were not absorbed. 150μL of DMSO solution was added to each well, and the plate was placed on a shaker for 10min at a low speed. The absorbance value at a wavelength of 490nm was detected using an enzyme reader. The results showed that the cell viability of the ZDHHC11 knockout cell line was higher than that of the wild-type cell ( Figure 8 ).

[0068] Conclusion

[0069] The ZDHHC11 gene can be used as a new target for the treatment of NSCLC. This gene can affect the proliferation, migration and apoptosis of NSCLC and has potential application value in the treatment of NSCLC.

[0070] The above-mentioned embodiments only express several implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the present invention. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention.

Claims

1. Application of ZDHHC11 gene in the preparation of a drug for treating non-small cell lung cancer, characterized in that: Overexpression of the ZDHHC 11 gene increased the level of ZDHHC11 protein, thereby inhibiting the proliferation and migration ability of non-small cell lung cancer cells and promoting cell apoptosis.

2. The use according to claim 1, characterized in that: The NCBI accession number of the ZDHHC11 gene is 79844, and the sequence of the encoded ZDHHC11 protein is shown in SEQ ID No.

1.

3. The use according to claim 1, characterized in that: The overexpression of the ZDHHC11 gene is transient overexpression or stable overexpression of the ZDHHC11 gene.

4. A recombinant plasmid for overexpression of ZDHHC11 gene, characterized in that: The overexpression recombinant plasmid of the ZDHHC11 gene is constructed by the ZDHHC11 gene and the pCMV expression vector, and the NCB I accession number of the ZDHHC11 gene is 79844.

5. Use of the ZDHHC11 gene overexpression recombinant plasmid according to claim 4 in the preparation of a drug for treating non-small cell lung cancer.

6. A drug for treating non-small cell lung cancer, characterized in that: The medicine comprises a therapeutically effective amount of the ZDHHC11 gene overexpression recombinant plasmid as claimed in claim 4.

7. A ZDHHC11 gene overexpression cell line, characterized in that: The ZDHHC11 gene overexpression cell line is obtained by transfecting the ZDHHC11 gene overexpression recombinant plasmid described in claim 4 into non-small cell lung cancer cells.

8. A ZDHHC11 gene overexpression cell line according to claim 7, characterized in that: The non-small cell lung cancer cells are A549 and PC-9 cells.

Images