Pseudomonas putida YC15 capable of resisting low temperature and promoting early growth and rapid germination of tobaccos and application of pseudomonas putida YC15

Abstract

The invention discloses a pseudomonas putida YC15 resistant to low temperature and capable of promoting tobacco to grow early and fast and application of the pseudomonas putida YC15. The pseudomonas putida YC15 is preserved in China General Microbiological Culture Collection Center (CGMCC), the preservation address is Beijing, the preservation number is CGMCC No.29990, the preservation date is March 11, 2024, and the pseudomonas putida YC15 is classified and named as pseudomonas putida. The strain YC15 produces siderophores at low temperature, has high nitrogen fixation and phosphate solubilizing activity, is efficiently and stably colonized on the root surface of a tobacco seedling, and significantly improves the biomass and plant height of tobacco. The tobacco growth-promoting bacterial strain obtained by the method has the effects of promoting early growth and rapid germination of tobacco plants and improving agronomic characters of the tobacco plants, and is easy to popularize.

Description

Technical Field

[0001] The invention relates to a low temperature resistant Pseudomonas putida YC15 which promotes early growth and rapid development of tobacco and application thereof, belonging to the technical field of tobacco production. Background Art

[0002] The research and application of early growth and rapid development of tobacco not only brings technological innovation to the tobacco industry, but also provides a new way to improve tobacco yield and quality. Studies have shown that environmental factors such as light, temperature, soil moisture, and agricultural management factors such as tobacco varieties and planting techniques are key factors affecting early growth and rapid development of tobacco. In terms of application, by optimizing planting techniques, such as adopting appropriate sowing time, planting density and fertilization methods, early growth and rapid development of tobacco can be effectively promoted. In addition, tobacco varieties with excellent traits such as disease and pest resistance, drought resistance and cold resistance cultivated by biotechnology also provide a strong guarantee for early growth and rapid development of tobacco. The application of these technologies not only improves the yield and quality of tobacco, but also reduces production costs and enhances the competitiveness of the tobacco industry. However, excessive pursuit of early growth and rapid development may shorten the tobacco growth cycle, thereby affecting the quality and yield of tobacco leaves. Competition in the tobacco market is becoming increasingly fierce. How to make tobacco early growth and rapid development technology better adapt to market demand and improve the competitiveness of tobacco products is also a problem that needs to be solved urgently.

[0003] Using microbial means to solve plant growth and health problems has gradually become a general trend. As an important part of the ecosystem, microorganisms have unique ecological functions and biological activities. They can participate in the decomposition and transformation of soil organic matter, improve soil fertility, and provide necessary nutrients for tobacco growth. By introducing microbial strains with growth-promoting and disease-resistant functions, the rhizosphere microecological environment can be effectively improved, and the development of the root system and nutrient absorption can be promoted. However, there is still a lack of microbial solutions for the early growth and rapid development of tobacco. Therefore, the application of microbial means to solve the problem of early growth and rapid development of tobacco is extremely necessary and important. At the same time, microbial technology also has the advantages of environmental protection, safety and sustainability, which meets the requirements of the current green development of agriculture and is of great significance for promoting the sustainable development of the tobacco industry. Summary of the invention

[0004] Purpose of the invention: The technical problem to be solved by the present invention is to provide a strain of Pseudomonas putida YC15 that is resistant to low temperature and promotes early growth and rapid development of tobacco, and its application.

[0005] Technical solution: In order to solve the above technical problems, the present invention provides a strain of Pseudomonas putida YC15, which is deposited in the General Microbiological Center of China Microbiological Culture Collection Administration, with a storage address of CGMCC No. 29990 in Beijing, China, and a storage date of March 11, 2024. Its classification name is: Pseudomonas putida.

[0006] Wherein, the Pseudomonas putida YC15 is isolated at 20°C.

[0007] The 16s rDNA base sequence of Pseudomonas putida YC15 is shown as SEQ ID No.1.

[0008] The present invention also provides a bacterial agent or preparation, which contains one or more of the Pseudomonas putida YC15 or its fermentation liquid and sterile supernatant.

[0009] The present invention also provides the use of the Pseudomonas putida YC15 or the bacterial agent or preparation in promoting tobacco growth, thereby effectively improving the agronomic traits of tobacco plants and the quality of flue-cured tobacco. The method of the present invention has strong specialization and stable effect.

[0010] The method comprises the following steps: applying the Pseudomonas putida YC15 or bacterial agent or preparation to tobacco.

[0011] Wherein, the dosage of Pseudomonas putida YC15 is 4×10 9 ~6×10 9 Pieces / plant.

[0012] Wherein, the concentration of Pseudomonas putida YC15 in the bacterial agent or preparation is 4×10 8 cfu / ml~6×10 8 cfu / ml.

[0013] The present invention also provides the acquisition of the YC15 strain on the tobacco root surface:

[0014] (1) Tobacco seedlings were grown at low temperature (20°C) for 20 days. Well-grown tobacco plants were selected, the aboveground parts of the plants were cut off, and the roots were clamped with sterile tweezers and stirred vigorously in a conical bottle filled with PBS buffer so that all the soil on the root surface entered the buffer. The roots were then rinsed with PBS buffer and placed in a test tube filled with a surfactant (0.5 mmol / L Tween 80) to just immerse the roots. The roots were ultrasonically cleaned twice in an ultrasonic cleaner with ice cubes for 30 seconds each time, and the roots were taken out to obtain the tobacco root surface microbiome suspension.

[0015] (2) Take 1 mL of tobacco root microbial suspension and dilute it by 10 -2 , 10 -3 , 10 -4 , 10 -5 and 10 -6 For the series of gradients, take 200 μL of 10 -4 , 10 -5 , 10 -6 The suspension of different concentrations was evenly spread on 0.1TSA medium (containing cycloheximide, 100 mg / L), and each concentration gradient was repeated twice, and cultured in the dark at 20°C for 5 days. According to the morphology, color and size of bacteria, single colonies were picked from the plates with appropriate concentration gradients, and lines were drawn on the plate separation medium for purification and culture. The strains obtained after purification and culture were used as test strains and inoculated on beef extract peptone slant for temporary storage.

[0016] (3) Extract DNA from the test strain and perform 16S rRNA sequencing to determine the taxonomic status of the strain.

[0017] (4) The growth-promoting ability of the strains under low temperature was measured, including nitrogen fixation, phosphate solubilization, and iron carrier production.

[0018] The present invention also provides the method for determining the root surface colonization effect of the strain under low temperature through the sterile seedling colonization test.

[0019] (1) Prepare 1 / 2 strength MS medium: Dissolve 2.2 g Murashige Skoog medium (containing vitamins) dry powder, 10 g sucrose and 8 g agar powder in 1 L sterile deionized water, adjust pH to 5.8, and sterilize by autoclave at 121°C for 15 minutes. Dispense into 13 cm square culture dishes in a clean bench, 50 ml per dish.

[0020] (2) Tobacco seedling culture: Tobacco seeds were surface sterilized with 75% ethanol (30 s) and 3% NaClO (15 min, 3 times), and then placed in 1 / 2 strength MS medium. After germination for 7 days, the seedlings were transferred to MS medium, with 3 seedlings per medium. The medium was maintained at 20°C for 16 h of light and 8 h of darkness for 7 days.

[0021] (3) Preparation of YC15 fermentation broth: YC15 was fermented at 20°C and 170 rpm for 2 days, and the concentration of the bacterial broth was adjusted to OD 600 =0.1. Each strain was inoculated with 50 μl of bacterial suspension. After 14-28 days of inoculation, bacteria were recovered once a week for a total of 3 times. The tobacco roots were rinsed with sterile water to remove floating bacteria. The roots were then placed in PBS buffer for 5 minutes to extract bacteria on the tobacco root surface. After removing the roots, the suspension was diluted and plated. The YC15 strain grew on the plate, indicating that it was able to colonize the tobacco root surface.

[0022] The present invention also provides verification of the early growth and rapid development effect of the YC15 strain. YC15 bacterial solution was inoculated into the roots of sterile tobacco seedlings. Compared with no inoculation, YC15 significantly increased the biomass and plant height of tobacco plants. The strain YC15 can colonize the root surface, produce iron carriers, fix nitrogen and solubilize phosphorus to promote the growth of tobacco.

[0023] The invention provides a screening system for fast-growing bacterial strains. The culture temperature for separating the bacterial strains is 20° C., and the tobacco is a tobacco seedling transplanted for 30 to 50 days.

[0024] The present invention also provides application of the growth-promoting strain in promoting the growth of tobacco seedlings and improving the agronomic traits of tobacco plants.

[0025] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: 1. The present invention is the first to isolate and screen out a specific strain YC15 from the tobacco root surface at low temperature (20°C), and determine the growth-promoting characteristics based on IAA and iron carrier production, nitrogen fixation and phosphorus solubilization capabilities; 2. YC15 significantly colonizes on the tobacco root surface at low temperatures and proliferates 12 times, which has a significant early growth and rapid development effect on the tobacco plants, and at the same time has a significant improvement effect on the agronomic traits of the tobacco plants; 3. The strain described in the present invention has an early growth and rapid development effect and improves the agronomic traits of the tobacco plants, and is easy to promote. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 is the growth effect of YC15 on nitrogen-fixing medium;

[0027] Figure 2 is the growth effect of YC15 on phosphate-dissolving medium;

[0028] Figure 3 is the growth effect of YC15 on CAS medium;

[0029] Figure 4 The colonization effect of sterile tobacco seedlings 4 weeks after inoculation with YC15;

[0030] Figure 5Potted experiment to verify the growth-promoting effect of growth-promoting strains on tobacco plant biomass and plant height: (A) plant height; (B) above-ground dry weight; (C) underground dry weight. DETAILED DESCRIPTION

[0031] The technical solution of the present invention is further described below in conjunction with the accompanying drawings.

[0032] Embodiment 1:

[0033] (1) Soil sample acquisition: The sampling site is located in 4 representative soils in Yongzhou, Hunan Province (26°42'N, 111°70'E), which has a history of rice and tobacco rotation. Samples were collected 20 days after tobacco sowing and transplanting. The aboveground part of the plant was cut off, and the roots were clamped with sterile tweezers and stirred vigorously in a conical bottle filled with PBS buffer so that all the soil on the root surface entered the buffer. The roots were then rinsed with PBS buffer and placed in a test tube containing a surfactant (0.5mmol / L Tween80) so that the surfactant just submerged the roots. The roots were ultrasonically cleaned twice in an ultrasonic cleaner with ice cubes for 30 seconds each time, and the roots were taken out to obtain the tobacco root surface microbiome suspension.

[0034] (2) Spreading, isolation, culture and purification: 1 mL of tobacco root microbial suspension was taken and diluted 10 -2 , 10 -3 , 10 -4 , 10 -5 and 10 -6 For the series of gradients, take 200 μL of 10 -4 , 10 -5 , 10 -6 The suspension of different concentrations was evenly spread on 0.1TSA medium (containing cycloheximide, 100 mg / L), and each concentration gradient was repeated twice, and cultured in the dark at 20°C for 5 days. Single colonies were picked from the plates with appropriate concentration gradients according to bacterial morphology, color, and size.

[0035] (3) Determination of taxonomic status: DNA of bacteria was extracted using a DNA extraction kit (TIANamp Bacteria DNA Kit, TIANGEN). The extracted DNA was subjected to PCR amplification of 16S rDNA. The length of the PCR amplification product was detected by 1% agarose gel electrophoresis. The PCR amplification product was then sent to Shanghai Sangon Biotechnology Technology Service Co., Ltd. for sequencing. The sequencing results were subjected to Blast comparative analysis on NCBI and compared with the gene sequences of other strains in Genbank for homology. The results are shown in SEQ ID No. 1:

[0036] TTGCTCCTTGATTCAGCGGCGGACGGGTGAGTAATGCCTAGGAATCTGCCTGGTAGTGGGGGACAACGTTTCGAAAGGGACGCTAATACCGCATACGTCCTACGGGAGAAAGCAGGGGACCTTCGGGCCTTGCGCTATCAGATGAGCCTAGGTCGGATTAGCTAGTTGGTGGGGTAATGGCTCACCAAGGCGACGATCCGTAACTGGTCTGAGAGGATGATCAGTCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCGTGTGTGAAGAAGGTCTTCGGATTGTAAAGCACTTTAAGTTGGGAGGAAGGGCAGTAAGTTAATACCTTGCTGTTTTGACGTTACCGACAGAATAAGCACCGGCTAACTCTGTGCCAGCAGCCGCGGTAATACAGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTTGTTAAGTTGGATGTGAAAGCCCCGGGCTCAACCTGGGAACTGCATCCAAAACTGGCAAGCTAGAGTACGGTAGAGGGTGGTGGAATTTCCTGTGTAGCGGTGAAATGCGTAGATATAGGAAGGAACACCAGTGGCGAAGGCGACCACCTGGACTGA.

[0037] (4) This strain belongs to the Proteobacteria, γ-Proteobacteria, Pseudomonasales, Pseudomonadaceae, and Pseudomonas genus. It was deposited in the General Microbiological Center of China Microbiological Culture Collection Administration on March 11, 2024, with the deposit number CGMCC No. 29990, and its classification name is: Pseudomonas putida.

[0038] Experimental Example 2: Determination of the growth-promoting ability of strains

[0039] The growth-promoting ability test was performed using the purified strains of Example 1: the strains were cultured in TSB medium at 20°C for 48 h, the bacteria were collected by centrifugation, and resuspended in appropriate sterile water to a final density of 10 8cells / mL was used as the bacterial suspension. 2 μL of bacterial solution was respectively spotted on nitrogen-free medium, inorganic phosphorus medium, and CAS detection medium to detect the strain's ability to fix nitrogen, solubilize phosphorus, and produce siderophores, and cultured at 20°C for 7 days. The appearance of obvious hydrolysis circles on the nitrogen-free medium and inorganic phosphorus medium, and the appearance of orange hydrolysis circles on the CAS medium were used as positive reactions indicating that the strain had the corresponding promotion ability. The strength of the bacterial growth promotion ability was preliminarily determined by the ratio (D / d) of the hydrolysis circle diameter (D) to the colony diameter (d), with 4 parallel experiments in each group. The nitrogen fixation, phosphorus solubilization, and siderophore production abilities of YC15 were 2.00, 1.38, and 2.92, respectively. The results are shown in Figure 1-3 .

[0040] Example 3: Colonization ability of YC15 on tobacco root surface

[0041] Tobacco seeds were surface sterilized with 75% ethanol (30 s) and 3% NaClO (15 min, 3 times), respectively, and then placed in 1 / 2 strength Murashige and Skoog (MS) complete medium (Solarbio) containing 2% (wt / vol) sucrose and 0.8% (wt / vol) agar.

[0042] After germination for 7 days, the seedlings were transferred to 1 / 2MS medium, with 3 seedlings per medium. The light was 16 hours at 20℃ and the dark was 8 hours for 7 days. The growth-promoting bacteria YC15 was selected and the concentration of the bacterial solution was adjusted to OD after fermentation with sterile water. 600 = 0.1. Each strain was inoculated with 50 μL of bacterial suspension, and bacteria were collected once a week starting 14 days after inoculation, for a total of 3 times.

[0043] The tobacco roots were rinsed with sterile water to remove floating bacteria. The roots were then placed in PBS buffer for 5 min to extract bacteria on the tobacco root surface. After removing the roots, the suspension was diluted and plated to determine the bacteria colonizing on the root surface.

[0044] Through Table 1 and Figure 4 It can be seen that YC15 proliferated significantly on the root surface 2 weeks after inoculation. The colonization rate stabilized 3 weeks after inoculation, and the bacteria on the root surface increased 12 times. The results showed that YC15 could colonize on the tobacco root surface and promote the growth of tobacco seedlings.

[0045] Table 1 Colonization rate of YC15 on tobacco root surface

[0046] deal with 2 weeks 3 weeks 4 weeks YC15 408％ 1216％ 1263％

[0047] Example 4: Potted plant experiment to verify the growth-promoting effect of the strain on tobacco plants

[0048] After the strain was cultured in TSB medium at 20°C for 48 h, the bacteria were collected by centrifugation and resuspended in appropriate sterile water to a final density of 108 The bacterial suspension was prepared by mixing 100 cells / mL of the suspension. Tobacco seedlings with uniform growth were selected and planted in pots containing sterile soil and vermiculite (1:1, v / v) at low temperature (20°C).

[0049] On the 10th and 30th days, 10 mL of bacterial suspension was inoculated, and the control group was inoculated with the same amount of sterile water. The biomass and plant height increment of tobacco plants were measured 45 days after planting under low temperature conditions. The results are shown in Figure 5 .

[0050] The results showed that YC15 significantly increased tobacco biomass and plant height and promoted tobacco growth.

Claims

1. A strain of Pseudomonas putida YC15, characterized in that: It is deposited in the General Microbiology Center of China Microbiological Culture Collection Administration, with the deposit address being Beijing, China. The deposit number is CGMCC No. 29990, the deposit date is March 11, 2024, and its classification name is Pseudomonas putida.

2. The Pseudomonas putida YC15 according to claim 1, characterized in that Isolated at 20°C.

3. The Pseudomonas putida YC15 according to claim 1, characterized in that The 16srDNA base sequence is shown in SEQ ID No.

1.

4. A bacterial agent or preparation, characterized in that: The bacterial agent or preparation contains one or more of the Pseudomonas putida YC15 or its fermentation liquid and sterile supernatant as described in any one of claims 1 to 3.

5. Use of the Pseudomonas putida YC15 according to any one of claims 1 to 3 or the bacterial agent or preparation according to claim 4 in promoting tobacco growth.

6. The use according to claim 5, characterized in that: The following steps are involved: The Pseudomonas putida YC15 according to any one of claims 1 to 3 or the bacterial agent or preparation according to claim 4 is applied to tobacco.

7. The use according to claim 5 or 6, characterized in that: The dosage of Pseudomonas putida YC15 is 4×10 9 ~6×10 9 Pieces / plant.

8. The use according to claim 5 or 6, characterized in that: The concentration of Pseudomonas putida YC15 in the bacterial agent or preparation is 4×10 8 cfu / ml~6×10 8 cfu / ml.

9. The use according to any one of claims 5 to 8, characterized in that: The application temperature of the Pseudomonas putida YC15 or the bacterial agent or preparation is 15-20°C.

Images