A genetically engineered bacterium for efficiently utilizing corn straw hydrolyzate to produce succinic acid and its application

Abstract

The present invention discloses a genetically engineered bacterium and its application for efficiently utilizing corn stalk hydrolyzate to produce succinic acid, and belongs to the technical field of gene recombination and metabolic engineering. The genetically engineered bacterium disclosed in the present invention is a recombinant Escherichia coli obtained by inactivating the pyruvate dehydrogenase complex regulatory factor PdhR, overexpressing the transhydrogenase gene sthA to increase the supply of NADH, promoting succinic acid transport through an oxygen-responsive metabolic switch, and using a low-expression-intensity constitutive promoter to complement the expression of the phosphate acetyltransferase gene Pta to increase the supply of coenzyme A, acetyl phosphate and ATP on the basis of strain BW20. The conversion rate of succinic acid produced by the genetically engineered bacterium in fermentation in an anaerobic bottle reaches 1.05 g / g (total sugar), and the output of succinic acid produced by metabolizing corn stalk hydrolyzate in the "aerobic-anaerobic" two-stage batch feed fermentation reaches 92.4 g / L. The genetically engineered bacterium of the present invention can achieve efficient metabolism of cellulose hydrolyzate to produce succinic acid.

Description

Technical Field

[0001] The invention relates to the technical field of gene recombination and metabolic engineering, and more specifically to a genetic engineering bacterium for efficiently utilizing corn stalk hydrolyzate to produce succinic acid and its application. Background Art

[0002] Succinic acid, also known as succinic acid, is a dicarboxylic acid, colorless crystal, sour taste, soluble in water, slightly soluble in ethanol and ether, insoluble in chloroform and dichloromethane, with a molecular formula of C4H6O4 and a molecular weight of 118.1. It is a precursor of many important compounds. Succinic acid has a wide range of applications, including food additives, pharmaceutical synthesis, plastics, dyes, resins, pesticides, and many other aspects. In terms of food additives, succinic acid can be used as an acidulant, preservative, etc. In the field of pharmaceutical synthesis, succinic acid is an important raw material for a variety of drugs; in the field of plastics, succinic acid can be used to produce degradable plastics, such as polybutylene succinate (PBS), which is of great significance for reducing environmental pollution and promoting a circular economy.

[0003] Traditional succinic acid production mainly adopts chemical synthesis methods, mainly including the oxidation method of deep oxidation of paraffin to produce a series of carboxylic acid mixtures, followed by distillation and crystallization to obtain succinic acid, and the reduction method of chemical catalytic hydrogenation using maleic anhydride as raw material. The paraffin oxidation process is relatively mature, but the yield and purity are not high, and there is pollution. The maleic anhydride method requires hydrogenation reaction under the action of expensive metal catalysts, which has high production costs and is not conducive to large-scale production. In contrast, the production of succinic acid by microbial fermentation has the advantages of being green, efficient, and sustainable, while avoiding dependence on petrochemical raw materials. It is a low-cost, green production method. At present, many companies and research institutions are involved in the production of succinic acid by microbial fermentation. However, these companies and research institutions mainly use glucose as the raw material for biological fermentation. Although the yield and yield of succinic acid are high, there is a problem of "competing with people for food". Straw biomass comes from agricultural residues and is difficult to use directly due to its complex structure. However, it can be converted into glucose and xylose that can be fermented by microorganisms through a hydrolysis process. It is a non-grain bio-based raw material with great potential. In the previous study, an engineered Escherichia coli was constructed through system metabolic engineering, and the yield of succinic acid produced by corn straw hydrolysate using "aerobic-anaerobic" two-stage batch feeding fermentation reached 70.2g / L, and the conversion rate in the anaerobic fermentation stage reached 0.97g / g (total sugar). However, since the yield and conversion rate have not yet met the production requirements, it is necessary to further improve the yield and conversion rate of the engineered bacteria.

[0004] In view of this, the present invention provides a genetically engineered bacterium for more efficiently utilizing corn straw hydrolyzate to produce succinic acid and its application, providing a technical reference for efficiently utilizing non-grain agricultural straw biomass to produce succinic acid. Summary of the invention

[0005] The present invention further improves the supply of coenzyme A, acetyl phosphate and ATP by inactivating the pyruvate dehydrogenase complex regulator PdhR, overexpressing the endogenous transhydrogenase sthA, and using the oxygen corresponding metabolic switch to promote the succinate transporter and replenishing the phosphate acetyltransferase gene Pta expression by the constitutive promoter with low expression intensity on the basis of the previously constructed engineering bacteria (patent number 202411026118.1, engineering strain BW20), and obtains the Escherichia coli engineering bacteria BW20-5 with further improved yield and yield. The yield of succinic acid produced by the "aerobic-anaerobic" two-stage batch feeding fermentation metabolism of corn straw hydrolyzate reaches 92.4g / L (total sugar), and the conversion rate reaches 0.89g / g (total sugar). The genetically engineered bacteria constructed by the present invention provide the possibility for further efficient use of corn straw hydrolyzate to produce succinic acid.

[0006] In order to achieve the above object, the present invention adopts the following technical solution:

[0007] A genetically engineered bacterium for efficiently utilizing corn straw hydrolyzate to produce succinic acid, wherein the genetically engineered bacterium is a recombinant Escherichia coli transformed with chassis microorganisms;

[0008] The chassis microorganism transformation uses the engineered strain BW20 as the starting strain, knocks out the pyruvate dehydrogenase complex regulator PdhR gene, overexpresses the transhydrogenase sthA gene (PdhR and sthA are genes for increasing NADH supply); overexpresses the Escherichia coli endogenous succinate efflux protein gene yjjPB (yjjPB, including two subunits: putative succinate exporter YjjP and putative succinate exporter YjjB) gene cluster or the C4-dicarboxylate transporter gene dcuC (C4-dicarboxylate transporter);

[0009] The expression regulatory element used for overexpression of the succinate efflux protein yjjPB gene cluster or the C4-dicarboxylate transporter gene dcuC is the oxygen responsive metabolic switch OMS glpA .

[0010] Furthermore, the gene sequence of the endogenous pyruvate dehydrogenase complex regulatory factor PdhR of Escherichia coli is shown in SEQ ID NO.1;

[0011] The Escherichia coli endogenous transhydrogenase sthA gene sequence is shown in SEQ ID NO.8;

[0012] The endogenous succinate efflux protein yjjPB gene cluster sequence is shown in 274-1568 bp in SEQ ID NO.16;

[0013] The endogenous C4-dicarboxylate transporter gene dcuC sequence is shown in 274-1670 bp in SEQ ID NO.24;

[0014] The oxygen responsive metabolic switch OMS glpA The sequence is shown in 1-273 bp of SEQ ID NO.16.

[0015] Furthermore, the genetically engineered bacteria for efficiently utilizing corn straw hydrolyzate to produce succinic acid also include a constitutive promoter P with low expression intensity. J23114 Replenish the phosphate acetyltransferase Pta (phosphateacetyltransferase) gene to increase the supply of coenzyme A, acetyl phosphate and ATP.

[0016] Furthermore, the phosphate acetyltransferase Pta gene sequence is shown in SEQ ID NO.29; the constitutive promoter P J23114 The sequence is shown as SEQ ID NO.37.

[0017] Furthermore, a method for constructing a genetically engineered bacterium for efficiently utilizing corn straw hydrolyzate to produce succinic acid comprises the following steps:

[0018] (1) Using the engineered strain BW20 as the starting strain, the pyruvate dehydrogenase complex regulator PdhR gene was knocked out, the transhydrogenase sthA gene was overexpressed; the endogenous succinate efflux protein yjjPB gene cluster of Escherichia coli or the C4-dicarboxylate transporter gene dcuC was overexpressed;

[0019] The expression regulatory element used for overexpression of the succinate efflux protein yjjPB gene cluster or the C4-dicarboxylate transporter gene dcuC is the oxygen responsive metabolic switch OMS glpA ; and / or

[0020] (2) Use a constitutive promoter with low expression intensity J23114 Replenishment of the phosphate acetyltransferase Pta gene.

[0021] Furthermore, the genetically engineered bacteria or the method described are used in the production of succinic acid.

[0022] Furthermore, the genetically engineered bacteria or the method described are used to increase the yield of succinic acid.

[0023] Furthermore, a method for efficiently utilizing corn straw hydrolyzate to produce succinic acid is provided, wherein the genetically engineered bacteria or the genetically engineered bacteria constructed by the method are used for fermentation; the carbon source used for fermentation is the corn straw cellulose hydrolyzate.

[0024] The present invention utilizes an "aerobic-anaerobic" two-stage fermentation method, switches to anaerobic fermentation at the best time to perform fermentation production.

[0025] The main carbon sources in the corn stalk hydrolysate are glucose and xylose. The genetically engineered bacteria constructed by the present invention can use the cellulose hydrolysate as a carbon source, which provides the possibility for realizing the efficient use of cellulose hydrolysate to produce succinic acid.

[0026] The present invention provides a method for producing succinic acid by metabolizing straw cellulose hydrolyzate ( Figure 1 ):

[0027] In Escherichia coli BW20, the endogenous pyruvate dehydrogenase complex regulator PdhR was eliminated; the endogenous transhydrogenase sthA was overexpressed to utilize the oxygen response metabolic switch OMS glpA Overexpression of the endogenous succinate transporter yjjPB gene cluster or the C4-dicarboxylate transporter gene dcuC in Escherichia coli was achieved by using a constitutive promoter P J23114 Replenish endogenous phosphate acetyltransferase Pta.

[0028] The elimination of the endogenous pyruvate dehydrogenase complex regulator PdhR is to reduce the inhibition of the pyruvate dehydrogenase complex PDH and enhance the synthesis of NADH; the overexpression of the endogenous transhydrogenase sthA is to increase the activity of the pyruvate dehydrogenase complex PDH and enhance the synthesis of NADH; the utilization of the oxygen response metabolic switch OMS glpA The purpose of overexpressing the endogenous succinate transporter yjjPB gene cluster or the C4-dicarboxylate transporter gene dcuC of Escherichia coli is to enhance the expression of yjjPB or dcuC only under anaerobic conditions, thereby increasing the succinate efflux capacity under anaerobic conditions without increasing the metabolic burden in the aerobic growth stage; J23114 The purpose of replenishing endogenous phosphate acetyltransferase Pta is to increase the supply of coenzyme A, acetyl phosphate and ATP required for cell growth and production, thereby promoting growth and production.

[0029] Through the above technical scheme, it can be known that compared with the prior art, the present invention discloses a genetically engineered bacterium for efficiently utilizing corn straw hydrolyzate to produce succinic acid and its application, and specifically provides a recombinant Escherichia coli for more efficiently utilizing corn straw hydrolyzate to produce succinic acid, by eliminating the endogenous pyruvate dehydrogenase complex regulatory factor PdhR; overexpressing the endogenous transhydrogenase sthA, and utilizing the oxygen corresponding metabolic switch OMSglpA to overexpress the endogenous succinate transporter yjjPB gene cluster or the C4-dicarboxylate transporter gene of Escherichia coli. Due to dcuC, the endogenous phosphate acetyltransferase Pta was supplemented by utilizing the constitutive promoter PJ23114 with low expression intensity; the production capacity of the strain was greatly improved, the conversion rate of the anaerobic fermentation production stage in the anaerobic bottle reached 1.05g / g (total sugar), and the output of succinic acid produced by batch feed fermentation metabolism of corn straw hydrolysate reached 92.3g / L (total sugar), and the conversion rate reached 0.89g / g (total sugar), which is the highest record of genetically engineered bacteria that metabolize corn straw hydrolysate to produce succinic acid, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0031] Figure 1 The accompanying drawing shows the transformation pathway for producing succinic acid by metabolizing corn straw hydrolyzate according to the present invention. DETAILED DESCRIPTION

[0032] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0033] LB liquid medium: peptone 10g / L, yeast powder 5g / L, NaCl 10g / L. The corresponding LB solid medium is supplemented with 2% agar.

[0034] Example 1

[0035] A method for constructing a genetically engineered bacterium that efficiently metabolizes corn straw hydrolyzate to produce succinic acid comprises the following steps:

[0036] Using the Escherichia coli engineered strain BW20 as the starting strain, the endogenous pyruvate dehydrogenase complex regulator PdhR gene was knocked out, the endogenous transhydrogenase sthA gene was overexpressed, and the expression regulatory element used was the oxygen response metabolic switch OMS. glpA Overexpression of the endogenous succinate transporter yjjPB gene cluster or the C4-dicarboxylate transporter gene dcuC in Escherichia coli and the low-intensity constitutive promoter P J23114 Replenishment of the phosphate acetyltransferase Pta gene.

[0037] (1) Knockout of the pyruvate dehydrogenase complex regulator PdhR gene (as shown in SEQ ID NO.1)

[0038] (1-1) Step 1: Preparation of knockout fragment ΔPdhR-1000:

[0039] Using Escherichia coli BW20 genomic DNA as a template, primers ΔPdhR-1 and ΔPdhR-2 were used to amplify a PCR product containing the upstream homology arm gene fragment F; primers ΔPdhR-3 and ΔPdhR-4 were used to amplify a PCR product containing the downstream homology arm gene fragment R.

[0040] The specific sequences of primers ΔPdhR-1 and ΔPdhR-2 are as follows:

[0041] ΔPdhR-1: 5'-cgtgctgttgaccttccatcatg-3'; SEQ ID NO. 2.

[0042] ΔPdhR-2: 5'-gacttctgtcgaggagttcctgtcttaagccacttgcc-3'; SEQ ID NO. 3.

[0043] The specific sequences of primers ΔPdhR-3 and ΔPdhR-4 are as follows:

[0044] ΔPdhR-3: 5'-cttaagacaggaactcctcgacagaagtcgtgaagagagc-3'; SEQ ID NO. 4.

[0045] ΔPdhR-4: 5'-ttgcgtgcacggaagaagtg-3'; SEQ ID NO. 5.

[0046] PCR amplification system: Primestar enzyme (Takara) 25 μL, upstream and downstream primers 2 μL each, template 1 μL, ddH2O 20 μL.

[0047] PCR amplification program: pre-denaturation at 98°C for 3 minutes; denaturation at 98°C for 10 seconds, annealing at 57°C for 30 seconds, extension at 72°C for 10 seconds / kb, 35 cycles; extension at 72°C for 10 minutes.

[0048] After agarose gel electrophoresis and product recovery, the upstream homology arm gene fragment F and the downstream homology arm gene fragment R were obtained.

[0049] Using upstream homology arm gene fragment F and downstream homology arm gene fragment R as substrates, ΔPdhR-1 and ΔPdhR-4 as primers, PCR amplification was performed to obtain a PCR product containing the knockout fragment ΔPdhR-1000. The amplification system and amplification conditions were the same as above.

[0050] The PCR product was subjected to agarose gel electrophoresis and product recovery to obtain the knockout fragment ΔPdhR-1000.

[0051] (1-2) Step 2: Preparation of knockout plasmid ΔPdhR-gRNA:

[0052] Using E. coli BW20 genomic DNA as a template, ΔPdhR-gRNA-F and gRNA-R as primers, amplification was performed to obtain a PCR product containing the ΔPdhR-gRNA gene fragment. The amplification system and amplification conditions were the same as above.

[0053] The specific sequences of ΔPdhR-gRNA-F and gRNA-R are as follows:

[0054] ΔPdhR-gRNA-F: 5'-GGACTAGTATAAGCGGCGATAACCTTCCAGTTTTAGAGCTAGAAATAGCAAGTT-3'; SEQ ID NO. 6.

[0055] gRNA-R: 5'-CCGCTCGAGTAGGGATAACAGGGT-3'; SEQ ID NO. 7.

[0056] The PCR product was subjected to agarose gel electrophoresis and product recovery to obtain the ΔPdhR-gRNA gene fragment.

[0057] The ΔPdhR-gRNA gene fragment and pEcgRNA plasmid were digested with endonucleases XhoI and SpeI at 37°C for 2 hours, respectively. The digestion products were recovered to obtain ΔPdhR-gRNA digestion fragments and digested pEcgRNA fragments, respectively.

[0058] ΔPdhR-gRNA gene fragment digestion system: ΔPdhR-gRNA gene fragment 40μL, XhoI enzyme 1μL, SpeI 1μL, rCutSmart 5μL, ddH2O 3μL.

[0059] pEcgRNA plasmid restriction enzyme digestion system: pEcgRNA plasmid 40μL, XhoI enzyme 1μL, SpeI 1μL, rCutSmart 5μL, ddH2O 3μL.

[0060] The ΔPdhR-gRNA digested fragment and the digested pEcgRNA fragment were ligated at 22°C for 2 hours under the action of T4 DNA ligase to obtain a ligation product.

[0061] T4 DNA ligase ligation system: 2 μL of ΔPdhR-gRNA digested fragment, 1 μL of T4 DNA ligase, 1 μL of T4 DNA ligase buffer, 1 μL of digested pEcgRNA fragment, and 5 μL of ddH2O.

[0062] 10 μL of the above ligation product was transferred into the purchased commercial trans 10 competent medium (Quanshijin Company) according to the instructions, revived at 37°C for 1 hour, spread on LB solid culture medium plates containing 50 μg / mL spectinomycin, and cultured at 37°C for 12 hours to obtain single colonies.

[0063] The above single colony was inoculated into LB liquid culture medium containing 50 μg / mL spectinomycin and cultured for 12 hours. The plasmid was extracted and sequenced. The sequencing results showed that the knockout plasmid ΔPdhR-gRNA was the one with the PdhR gene knocked out.

[0064] (1-3) Step 3: Knockout of PdhR gene: The plasmid pEcCas was electroporated into BW20 host competent cells and revived at 37°C, then plated on LB plates containing 50 μg / mL kanamycin sulfate and cultured at 37°C until a single colony grew. The single colony carrying the pEcCas plasmid was inoculated into an LB tube (with 50 μg / mL kanamycin sulfate for resistance) and cultured at 37°C for 12 h.

[0065] Transfer 1 mL of bacterial solution from the above test tube to a vial containing 20 mL of LB liquid culture medium, add 50 μg / mL kanamycin sulfate and a final concentration of 10 mM arabinose, and culture at 37°C until the bacterial solution concentration reaches OD = 0.6-0.8.

[0066] The competent cells were prepared using the E. coli in the above bacterial solution. 100 ng ΔPdhR-gRNA knockout plasmid and 400 ng knockout fragment ΔPdhR-1000 were added to 100 μL of competent cells for electroporation. After electroporation, 1 mL of pre-cooled LB liquid culture medium was immediately added, and the cells were revived at 37°C for 1 h. The cells were spread on a double-resistance LB plate containing 50 μg / mL kanamycin sulfate and 50 μg / mL spectinomycin, and cultured at 37°C until a single colony was grown.

[0067] A single colony was picked for sequencing verification, and the sequencing results showed that the strain with the PdhR gene knocked out was the obtained strain with the PdhR gene knocked out.

[0068] (1-4) Step 4: Elimination of knockout plasmid ΔPdhR-gRNA and pEcCas:

[0069] Pick 3 to 6 strains with knockout PdhR gene and place them in a test tube containing 3mL LB liquid medium, add 50μg / mL kanamycin sulfate and a final concentration of 20mM rhamnose, and culture for about 12h. Take 10μL of the bacterial solution in the above test tube and transfer it to a test tube containing 3mL of antibiotic-free LB liquid medium and culture for about 12h, then streak it on an LB plate containing 20g / L sucrose and culture at 37℃ until a single colony grows.

[0070] The same colony was picked and spotted on non-antibiotic LB, monoclonal antibody LB containing 50 μg / mL kanamycin sulfate, and monoclonal antibody LB containing 50 μg / mL spectinomycin, and cultured overnight at 37°C. If only the non-antibiotic plate grew at the corresponding position, it indicated that the knockout plasmid ΔPdhR-gRNA and pEcCas contained in the bacteria had been eliminated, and it was named the engineered strain BW20-1.

[0071] (2) Based on the engineered strain BW20-1, the endogenous transhydrogenase sthA gene was overexpressed to obtain strain BW20-2.

[0072] (A1) Step 1: Preparation of sthA-1000, an integrated fragment of the overexpressed transhydrogenase sthA gene:

[0073] Using Escherichia coli BW20-1 genomic DNA as a template, primers sthA-1 and sthA-2 were used to amplify a PCR product containing the upstream homologous arm gene fragment F; primers sthA-3 and sthA-4 were used to amplify a PCR product containing the gene to be integrated sthA (sequence as shown in SEQ ID NO.8); primers sthA-5 and sthA-6 were used to amplify a PCR product containing the downstream homologous arm gene fragment R.

[0074] The specific primer sequences are as follows:

[0075] sthA-1: 5'-CGAATGCATGTTGAAGTACGCCTG-3'; SEQ ID NO. 9.

[0076] sthA-2:

[0077] 5'-CTTTAATGAATTCGCTAGCACTGTACCTAGGACTGAGCTAGCCGTCAAGGCTGCAACTTACCGTGATAGC-3'; SEQ ID NO. 10.

[0078] sthA-3:

[0079] 5'-CCTAGGTACAGTGCTAGCGAATTCATTAAAGAGGAGAAAGGTACCATGCCACATTCCTACGATTACGATGC-3'; SEQ ID NO. 11.

[0080] sthA-4: 5'-CATCATCCGCGCAAGAATGGATG-3'; SEQ ID NO. 12.

[0081] sthA-5:

[0082] 5'-CATCCATTCTTGCGCGGATGATGAGCCGTTCATGATACAGGAGTAG-3'; SEQ ID NO. 13.

[0083] sthA-6: 5'-GAGATCAAGGTAATATCTCTTCACTTGCGG-3'; SEQ ID NO. 14.

[0084] PCR amplification system: Primestar enzyme (Takara) 25 μL, upstream and downstream primers 2 μL each, template 1 μL, ddH2O 20 μL.

[0085] PCR amplification program: pre-denaturation at 98°C for 3 minutes; denaturation at 98°C for 10 seconds, annealing at 57°C for 30 seconds, extension at 72°C for 10 seconds / kb, 35 cycles; extension at 72°C for 10 minutes.

[0086] After agarose gel electrophoresis and product recovery, the upstream homology arm gene fragment F, the sthA gene fragment M to be integrated and the downstream homology arm gene fragment R were obtained.

[0087] The upstream homology arm gene fragment F, the sthA fragment to be integrated and the downstream homology arm gene fragment R were used as substrates, and sthA-1 and sthA-6 were used as primers for PCR amplification to obtain a PCR product containing the overexpressed transhydrogenase sthA gene integration fragment sthA-1000. The amplification system and amplification conditions were the same as above.

[0088] The PCR product was subjected to agarose gel electrophoresis and product recovery to obtain the gene integration fragment sthA-1000.

[0089] (A2) Step 2: Preparation of integration plasmid sthA-gRNA:

[0090] Except for the upstream primer sthA-gRNA-F, the other steps for preparing the integration plasmid refer to the above (1-2) Step 2: Preparation of knockout plasmid ΔPdhR-gRNA. The sthA-gRNA-F primer sequence used to prepare the integration plasmid sthA-gRNA is as follows:

[0091] 5'-GGACTAGTGATACGTCTTTGGTGTACCGGTTTTAGAGCTAGAAATAG CAAGTT-3'; SEQ ID NO. 15.

[0092] (A3) Step 3: Integrate the sthA gene into the E. coli genome:

[0093] The gene integration steps are the same as those in step (1-3) above, step 3: knocking out the PdhR gene, except that the knockout plasmid ΔPdhR-gRNA and the knockout fragment ΔPdhR-1000 in step (1-3) above, are replaced with the integration plasmid sthA-gRNA and the integration fragment sthA-1000 used for the integration gene.

[0094] (A4) Step 4: Elimination of integrated plasmid sthA-gRNA and pEcCas:

[0095] Referring to the fourth step above (1-4): elimination of knockout plasmid ΔPdhR-gRNA and pEcCas, the integrated plasmid sthA-gRNA and pEcCas were eliminated. The E. coli that eliminated the integrated plasmid sthA-gRNA and pEcCas was named the engineering strain BW20-2 and used for the next round of gene integration.

[0096] (3) Based on the engineered strain BW20-2, OMS is switched by oxygen-responsive metabolism glpA The endogenous Escherichia coli succinate transporter yjjPB gene cluster was overexpressed. The primers used to prepare the gene integration fragment were yjjPB-1 and yjjPB-2 (using the genomic DNA of Escherichia coli BW25113 as a template), yjjPB-3 and yjjPB-4 (using the synthesized SEQ ID NO.16 as a template, wherein 1-273 bp is the oxygen corresponding metabolic switch OMS glpA) and yjjPB-5 and yjjPB-6 (using E. coli BW25113 genomic DNA as template); the upstream primer used to prepare the integration plasmid was yjjPB-gRNA-F. The strain overexpressing the endogenous E. coli succinate transporter yjjPB gene was named the engineered strain BW20-3.

[0097] The specific primer sequences are as follows:

[0098] yjjPB-1: 5'-TTGCTCGTCATACCACCGATGG-3'; SEQ ID NO. 17.

[0099] yjjPB-2:

[0100] 5'-CTCATTAGGCACCGAAGTAGCCTGAATGTCCAGACACTACC-3'; SEQ ID NO. 18.

[0101] yjjPB-3:5′-CAGGCTACTT CGGTGCCTAATGAGTGAGCTAAC -3'; SEQ ID NO.19.

[0102] yjjPB-4:

[0103] 5'-GGAACGGTGATGTT TATAGTAACACACGGAGGAGGAGGAGGC -3'; SEQ ID NO.20.

[0104] yjjPB-5: 5'-CCGTGTGTTACTATAAACATCACCGTTCCTGGCATCC-3'; SEQ ID NO. 21.

[0105] yjjPB-6: 5'-TTAACGTTGACACAGGAACGACGG-3'; SEQ ID NO. 22.

[0106] yjjPB-gRNA-F:

[0107] 5'-GGACTAGTGCGTCAACATCGATTCAGTGGTTTTAGAGCTAGAAATAG CAAGTT-3'; SEQ ID NO. 23.

[0108] (4) Based on the engineered strain BW20-2, OMS is switched by oxygen-responsive metabolism glpAThe endogenous E. coli C4-dicarboxylate transporter dcuC gene was overexpressed, and the genomic DNA of E. coli BW25113 was used as a template. The primers used to prepare the gene integration fragment were dcuC-1 and dcuC-2 (using the genomic DNA of E. coli BW25113 as a template), dcuC-3 and dcuC-4 (using the synthesized SEQ ID NO.24 as a template, wherein 1-273 bp is the oxygen corresponding metabolic switch OMS glpA ) and dcuC-5 and dcuC-6 (using E. coli BW25113 genomic DNA as template); the upstream primer used to prepare the integration plasmid was dcuC-gRNA-F. The strain overexpressing the endogenous E. coli C4-dicarboxylate transporter dcuC gene was named engineered strain BW20-4.

[0109] The specific primer sequences are as follows:

[0110] dcuC-1: Same as SEQ ID NO.17.

[0111] dcuC-2:

[0112] 5'-CATTAGGCACCGAAGTAGCCTGAATGTCCAGACACTACC-3'; SEQ ID NO. 25.

[0113] dcuC-3: 5′-ATTCAGGCTACTT CGGTGCCTAATGAGTGAGCTAAC -3'; SEQ ID NO.26.

[0114] dcuC-4:

[0115] 5'-GGAACGGTGATGTT GGTTATGCTAGTTACTTGCCTGTGACC -3'; SEQ ID NO.27.

[0116] dcuC-5: 5'-AACTAGCATAACCAACATCACCGTTCCTGGCATCCG-3'; SEQ ID NO. 28.

[0117] dcuC-6: Same as SEQ ID NO.22.

[0118] dcuC-gRNA-F: Same as SEQ ID NO.23.

[0119] (5) Based on the engineered strain BW20-3, the low expression intensity constitutive promoter P J23114 Replenishment of the phosphate acetyltransferase Pta gene.

[0120] Using E. coli BW25113 genomic DNA as a template, the primers used to prepare the gene integration fragment are Pta-1 and Pta-114-2 (using E. coli BW25113 genomic DNA as a template), Pta-114-3 and Pta-4 (using the synthesized SEQ ID NO.29 as a template) and Pta-5 and Pta-6 (using E. coli BW25113 genomic DNA as a template); the upstream primer used to prepare the integration plasmid is Pta-gRNA-F. The strain after overexpressing the phosphate acetyltransferase Pta gene was named the engineered strain BW20-5.

[0121] The specific primer sequences are as follows:

[0122] Pta-1: 5'-AATCCGAACACTGTTCTGTTGTTCAC-3'; SEQ ID NO. 30.

[0123] Pta-114-2:

[0124] 5'-CTTTAATGAATTCGCTAGCATTGTACCTAGGACTGAGCTAGCCATAAACTCCGTTAATTCTTTGTCATATCGCAC-3'; SEQ ID NO. 31.

[0125] Pta-114-3:

[0126] 5'-GGTACAATGCTAGCGAATTCATTAAAGAGGAGAAAGGTACC GTGTC CCGTATTATTATGCTGATCCCTACCG -3'; SEQ ID NO.32.

[0127] Pta-4:

[0128] 5'-CATATTCACATACCGTTA CTGCTGCTGTGCAGACTGAATCG -3'; SEQ ID NO.33.

[0129] Pta-5: 5'-CAGCAGCAGTAACGGTATGTGAATATGCTGACATGCC-3'; SEQ ID NO. 34.

[0130] Pta-6: 5'-GCAGGAGACATCACGTACTTACGTAC-3'; SEQ ID NO. 35.

[0131] Pta-gRNA-F:

[0132] 5'-GGACTAGTCGAGATCCCAATAATCACGGGTTTTAGAGCTAGAAATA GCAAGTT-3'; SEQ ID NO. 36.

[0133] constitutive promoter J23114 The coding sequence is shown in SEQ ID NO.37.

[0134] TTTATGGCTAGCTCAGTCCTAGGTACAATGCTAGC; SEQ ID NO. 37.

[0135] Example 2 Fermentation of recombinant Escherichia coli BW20-3 and BW20-4 in anaerobic bottles

[0136] The seed culture medium was LBG liquid culture medium: peptone 10 g / L, yeast powder 5 g / L, NaCl 10 g / L, glucose 10 g / L.

[0137] Fermentation medium I: glucose 15 g / L, xylose 5 g / L, K2HPO4 3.5 g / L, KH2PO4 5 g / L, (NH4)2HPO4 3.5 g / L, NaCl 1 g / L, CaCl2·2H2O 30 mg / L, MgSO4·7H2O 1.2 g / L, yeast powder 5.0 g / L, trace element solution 0.2%, biotin 4×10 -4 g / L, vitamin B14×10 -4 g / L.

[0138] Preparation method of trace element solution: weigh 1g FeSO4·7H2O, 1g MnSO4·H2O, 0.1g ZnSO4·7H2O, 0.2g CuSO4, 0.002g NiCl2·6H2O, add water to make up to 100mL, then add 100μl concentrated hydrochloric acid to adjust the pH, then filter the bacteria through a membrane, and add 0.2% to the fermentation medium system.

[0139] The anaerobic fermentation of recombinant Escherichia coli BW20-3 or BW20-4 to produce succinic acid comprises the following steps:

[0140] (1) Seed culture: Pick a single colony of Escherichia coli BW20-3 or BW20-4 and inoculate it into LBG liquid culture medium, culture it at 37°C, 200 rpm for 12 h, and then transfer it to fresh LBG liquid culture medium for secondary activation for 12 h. The activated strain BW20-3 or BW20-4 is used for growth test or fermentation.

[0141] (2) Seed expansion culture: The constant temperature shaking conditions were 37°C and 200 rpm. 50 mL of fermentation medium I was placed in a 250 mL baffled bottle and inoculated with a final concentration of OD 600 =0.5, three parallel experiments were performed for each strain, and aerobic culture was carried out for 12 h.

[0142] (3) Anaerobic fermentation: The aerobic cultured cells were collected by centrifugation at 5000 rpm for 4 min, and then 50 ml of fermentation medium I was added and 15 g / L sodium bicarbonate was added to maintain the pH. The cells were transferred to an anaerobic bottle with a total volume of 100 mL and placed in a constant temperature shaker at 37°C and 200 rpm for 96 h.

[0143] Analysis method: UltiMate 3000 high performance liquid chromatograph (HPLC, Thermo Fisher Scientific) was used to detect the components in the fermentation broth. The concentrations of sugars and organic acids in the fermentation broth were determined using a Bio-Rad Aminex HPX-87H organic acid chromatographic column. The results are shown in Table 1.

[0144] Table 1

[0145] strain Glucose (g / L) Xylose(g / L) Succinic acid(g / L) Yield g / g (total sugar) BW20-3 10.44 4.93 16.13 1.05 BW20-4 10.18 4.92 15.57 1.03

[0146] The results in Table 1 show that in the anaerobic bottle, strain BW20-3 produced 16.13% succinic acid, and the conversion rate in the anaerobic fermentation stage was 1.05 (total sugar); strain BW20-4 produced 15.57% succinic acid, and the conversion rate in the anaerobic fermentation stage was 1.03 (total sugar). Anaerobic fermentation stage conversion rate (%) = succinic acid production / total consumption of glucose and xylose x 100%.

[0147] Example 3 Production of succinic acid by fermentation of corn straw hydrolysate by recombinant Escherichia coli BW20-5 in a 5 L fermenter

[0148] Preparation method of corn straw hydrolyzate: crush corn straw and screen with a 25-mesh sieve to obtain corn straw powder, add corn straw powder to 1% NaOH solution, make the solid content of corn straw powder in the solution reach 10%, then treat at 100°C for 1h, and then filter to obtain corn straw residue. Rinse the obtained corn straw residue with tap water, stop rinsing when its pH is the same as the tap water pH, and then dry the corn straw residue at 50°C for standby use. Weigh the dried corn straw residue and dissolve it in 0.05M phosphoric acid solution to make the solid content of corn straw residue in the solution reach 20%, add Novozymes' Novicell HS cellulase (154FPU / mL) with a final concentration of 40FPU / g (corn straw residue), and then place it in a shaker, 50°C, 200rpm, enzymolysis for 72h, centrifuge at 4500rpm for 15min after the enzymolysis, and take the supernatant to obtain corn straw hydrolyzate.

[0149] Fermentation medium II: corn straw hydrolyzate (total sugar 20 g / L, including 12.8 g / L glucose and 7.2 g / L xylose), K2HPO4 3.5 g / L, KH2PO4 5 g / L, (NH4)2HPO4 3.5 g / L, NaCl 1 g / L, CaCl2·2H2O 30 mg / L, MgSO4·7H2O 1.2 g / L, yeast powder 5.0 g / L, trace element solution 0.2%, biotin 4×10 -4 g / L, vitamin B14×10 -4 g / L.

[0150] The recombinant Escherichia coli BW20-5 was used to produce succinic acid by anaerobic fermentation in a 5L fermenter, comprising the following steps:

[0151] (1) Seed culture: A single colony of Escherichia coli BW20-5 was selected and inoculated into LBG liquid medium, cultured at 37°C, 200 rpm for 12 h, and then transferred to fresh LBG liquid medium for secondary activation for 12 h. The activated strain BW20-5 was centrifuged and collected for use as seeds for anaerobic fermentation production.

[0152] (2) Fermentation cell culture: 2 L of fermentation medium II was placed in a 5 L fermenter and inoculated with a final concentration of OD 600 =1.0 The initial pH is 7.0, 37°C, the rotation speed is 200rpm, and the aerobic culture is carried out for 12 hours. At this time, the dissolved oxygen in the fermentation reaches the minimum value and begins to rise. The ventilation is stopped, the stirring is fixed at 200rpm, the temperature is increased to 38°C and the culture is started. During the fermentation process, the total sugar concentration is controlled between 10-20g / L by automatic flow addition supplementation, and the culture is carried out until the end of the fermentation.

[0153] (3) Analysis method: The components in the fermentation broth were determined using an UltiMate 3000 high performance liquid chromatograph (HPLC, Thermo Fisher Scientific). The concentrations of sugars and organic acids in the fermentation broth were determined using a Bio-Rad Aminex HPX-87H organic acid chromatographic column. The results are shown in Table 2.

[0154] Table 2

[0155]

[0156]

[0157] The results in Table 2 show that in a 5L fermenter using an "aerobic-anaerobic" two-stage fermentation, strain BW20-5 produced 92.4 g / L of succinic acid, the total sugar consumed in the entire "aerobic-anaerobic" two-stage process was 103.8 g / L, and the conversion rate reached 0.89 g / g (total sugar).

[0158] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A genetically engineered bacterium for efficiently utilizing corn straw hydrolyzate to produce succinic acid, characterized in that: The genetically engineered bacteria are recombinant Escherichia coli that have been transformed with chassis microorganisms; The chassis microorganism transformation uses the engineered strain BW20 as the starting strain, knocks out the pyruvate dehydrogenase complex regulator PdhR gene, overexpresses the transhydrogenase sthA gene; overexpresses one of the succinate efflux protein yjjPB gene cluster and the C4-dicarboxylate transporter gene dcuC; The expression regulatory element used to overexpress the succinate efflux protein yjjPB gene cluster and the C4-dicarboxylate transporter gene dcuC is the oxygen responsive metabolic switch OMS glpA ; The oxygen responsive metabolic switch OMS glpA The sequence is shown as 1-273 bp in SEQ ID NO. 16; The engineered strain BW20 is from a Chinese patent application, application number CN202411026118.1; The transhydrogenase sthA gene is derived from Escherichia coli; the succinate efflux protein yjjPB gene cluster is derived from Escherichia coli BW25113; and the C4-dicarboxylate transporter gene dcuC is derived from Escherichia coli BW25113.

2. The genetically engineered bacteria for efficiently utilizing corn straw hydrolyzate to produce succinic acid according to claim 1, characterized in that: The gene sequence of the pyruvate dehydrogenase complex regulatory factor PdhR is shown in SEQ ID NO.1; The transhydrogenase sthA gene sequence is shown in SEQ ID NO.8; The succinate efflux protein yjjPB gene cluster sequence is shown in 274-1568 bp in SEQ ID NO.16; The C4-dicarboxylate transporter gene dcuC sequence is shown in 274-1670 bp in SEQ ID NO.

24.

3. The genetically engineered bacteria for efficiently utilizing corn straw hydrolyzate to produce succinic acid according to claim 1, characterized in that: When the succinate efflux protein yjjPB gene cluster is overexpressed, the constitutive promoter P with low expression strength is also included. J23114 Replenishment of the phosphate acetyltransferase Pta gene.

4. The genetically engineered bacteria for efficiently utilizing corn straw hydrolyzate to produce succinic acid according to claim 3, characterized in that: The phosphate acetyltransferase Pta gene sequence is shown in SEQ ID NO.29; the constitutive promoter P J23114 The sequence is shown as SEQ ID NO.

37.

5. A method for constructing a genetically engineered bacterium for efficiently utilizing corn straw hydrolyzate to produce succinic acid, characterized in that: The following steps are involved: The engineered strain BW20 was used as the starting strain, the pyruvate dehydrogenase complex regulator PdhR gene was knocked out, the transhydrogenase sthA gene was overexpressed; one of the succinate efflux protein yjjPB gene cluster and the C4-dicarboxylate transporter gene dcuC was overexpressed; The expression regulatory element used to overexpress the succinate efflux protein yjjPB gene cluster and the C4-dicarboxylate transporter gene dcuC is the oxygen responsive metabolic switch OMS glpA ; The oxygen responsive metabolic switch OMS glpA The sequence is shown as 1-273 bp in SEQ ID NO. 16; The engineered strain BW20 is from a Chinese patent application, application number CN202411026118.1; The transhydrogenase sthA gene is derived from Escherichia coli; the succinate efflux protein yjjPB gene cluster is derived from Escherichia coli BW25113; and the C4-dicarboxylate transporter gene dcuC is derived from Escherichia coli BW25113.

6. The method for constructing a genetically engineered bacterium for efficiently utilizing corn straw hydrolyzate to produce succinic acid according to claim 5, characterized in that: When the succinate efflux protein yjjPB gene cluster was overexpressed, the low expression intensity constitutive promoter P J23114 Replenishment of the phosphate acetyltransferase Pta gene.

7. Use of the genetically engineered bacteria according to any one of claims 1 to 4 or the method according to any one of claims 5 to 6 in producing succinic acid.

8. Use of the genetically engineered bacteria according to any one of claims 1 to 4 or the method according to any one of claims 5 to 6 in increasing the yield of succinic acid.

9. A method for efficiently utilizing corn straw hydrolyzate to produce succinic acid, characterized in that: Fermentation is carried out using the genetically engineered bacteria described in any one of claims 1 to 4 or the genetically engineered bacteria constructed by the method described in any one of claims 5 to 6; the carbon source used for fermentation is corn straw hydrolyzate.

Images